CN111690672B

CN111690672B - Sweet potato chlorogenic acid synthesis pathway key enzyme gene IbPAL2 and application thereof

Info

Publication number: CN111690672B
Application number: CN202010720101.1A
Authority: CN
Inventors: 禹阳; 边小峰; 贾赵东; 马佩勇; 谢一芝
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2020-07-23
Filing date: 2020-07-23
Publication date: 2022-11-01
Anticipated expiration: 2040-07-23
Also published as: CN111690672A

Abstract

The invention discloses IbPAL2 in sweet potatoes and application of a coding gene thereof in regulating and controlling plant nutritional quality. Wherein the IbPAL2 is a gene which codes one of key enzymes in the synthetic pathway of the chlorogenic acid of the sweet potato, and the nucleotide sequence is shown as SEQ ID NO.1. The protein coded by IbPAL2 gene is the amino acid sequence shown in SEQ ID No. 2. The invention separates the complete cDNA of the coding transcription factor IbPAL2 from the sweet potato, connects to the plant expression vector, transforms the plant by using the agrobacterium infection method, obtains the transgenic plant, and improves the chlorogenic acid content of the transgenic plant. The gene can be applied to genetic improvement of plant nutritional quality.

Description

Sweet potato chlorogenic acid synthesis pathway key enzyme gene IbPAL2 and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a key enzyme gene IbPAL2 in a synthesis path of chlorogenic acid of sweet potatoes, a protein coded by the gene, a recombinant vector containing the gene and application of the recombinant vector.

Background

Sweet potatoes (Ipomoea botatas (Lam.) L) belong to annual or perennial sprawl herbaceous plants, also known as sweet potatoes, sweet potatoes and the like, and are important crops of grains, feeds and industrial raw materials in the world. Sweet potatoes are native to tropical regions in south America and are introduced into China more than 400 years ago. Because of its characteristics of stable high yield, strong anti-disaster ability and wide adaptability, it is quickly popularized in China, accounting for 85.9% of the total yield of sweet potatoes in the world, and it becomes a second only food crop to rice, wheat and corn. Sweet potatoes are not only an important food source, but also have important medicinal value. According to the documents in Ben Cao gang mu, etc., the sweet potato has the efficacies of tonifying deficiency and lack, benefiting qi and strength, strengthening spleen and stomach, strengthening kidney yang, etc., can tonify and neutralize blood, tonify qi and promote the production of body fluid, widen intestines and stomach, relax bowels and be mainly used for treating spleen deficiency edema and intestinal dryness constipation. Therefore, the research on the effective active ingredients in the sweet potatoes and the nutrition and health care effects thereof has important significance for providing theoretical basis for the development and utilization of sweet potato resources.

In recent years, with intensive research on the nutrient components of the sweet potatoes, the sweet potatoes are found to contain abundant nutrient substances and some functional components, and compared with common staple food crops and vegetables, the sweet potatoes have complete nutrient components and even have higher content of many beneficial components. Besides abundant proteins, saccharides, vitamins and minerals, sweet potato also contains a large amount of chlorogenic acid. Chlorogenic acid (Chlorogenic acid) is one of the plant phenylpropanoid secondary metabolites, and refers to caffeotannic acid (5-O-Caffeoylquinic acid) composed of caffeic acid (Caffe acid) and Quinic acid (Quinic acid) in a narrow sense. In fact, chlorogenic acid is usually present in plants in the form of several isomers which coexist. Chlorogenic acid thus broadly represents a family of ester compounds formed by the condensation of quinic acid with trans-Cinnamic acid (trans-Coumaric acids), which is commonly known as caffeic acid, p-Coumaric acid (p-Coumaric acid) and Ferulic acid (Ferulic acid). In recent years, chlorogenic acid has been found to have various pharmacological actions such as antioxidation, antihypertensive, antibacterial, antitumor, radioresistance, blood sugar reduction, blood fat reduction, anti-inflammation, kidney tonifying, liver protection and the like, and is an effective component of a plurality of medicinal materials. Besides the medicine, the chlorogenic acid can also be used as a preservative for food and fruits in the food industry. Chlorogenic acid is widely present in higher dicotyledons and ferns, and is higher in content in plants of Lonicera (Lonicera) of Caprifoliaceae and Artemisia (Artemisia) of Compositae, such as Eucommiae cortex and flos Lonicerae. Therefore, at present, honeysuckle and eucommia bark are mainly used as raw materials for extracting and researching chlorogenic acid. Chlorogenic acid substances in the sweet potatoes mainly comprise chlorogenic acid, isochlorogenic acid (ICGA) and the like, although the content of the chlorogenic acid substances is lower than that of honeysuckle and eucommia, the chlorogenic acid substances are wide in planting range, large in biomass and low in price, and therefore the chlorogenic acid substances obtained from the sweet potatoes have a good application prospect.

The phenylalanine ammonia lyase gene PAL is positioned at the upstream of the chlorogenic acid synthesis pathway and is one of the key genes in the chlorogenic acid biosynthesis pathway. The IbPAL2 gene in the sweet potato is positively regulated by applying a molecular biology means to control the carbon flow to a chlorogenic acid synthesis way, which is obviously beneficial to improving the synthesis and the nutritional value of the chlorogenic acid of the sweet potato and further promoting the application of the plant chlorogenic acid secondary metabolism engineering.

Disclosure of Invention

The purpose of the invention is as follows: the invention aims to solve the technical problem of providing a key enzyme gene IbPAL2 of a synthesis pathway of chlorogenic acid of sweet potatoes, wherein the IbPAL2 gene can improve the synthesis capacity of the chlorogenic acid of the sweet potatoes.

The technical problem to be solved by the invention is to provide a protein coded by the gene.

The technical problem to be solved by the present invention is to provide an expression cassette, a recombinant vector or a cell.

The invention also solves the technical problem of providing the application of IbPAL2 gene, protein, expression cassette, recombinant vector or cell in obtaining plants with high content of chlorogenic acid in sweet potatoes.

The technical problem to be solved by the invention is to provide a method for obtaining the plant with high content of the chlorogenic acid of the sweet potatoes.

The technical problem to be solved by the invention is to provide a method for identifying the obtained plant with high content of the chlorogenic acid in the sweet potatoes.

The technical scheme is as follows: in order to solve the technical problems, the technical scheme adopted by the invention is as follows: the invention provides an IbPAL2 gene, the nucleotide sequence of the IbPAL2 gene is shown as SEQ ID NO:1 is shown.

The invention also comprises the protein coded by the IbPAL2 gene, and the amino acid sequence of the protein is shown as SEQ ID NO:2, respectively.

The invention also comprises an expression cassette, a recombinant vector or a cell, which contains the IbPAL2 gene.

The invention also comprises the expression vector, wherein the expression vector is pCAMBIA1305-IbPAL2.

The invention also comprises the application of the IbPAL2 gene, the protein, the expression cassette, the recombinant vector or the cell in obtaining plants with high content of the chlorogenic acid of the sweet potatoes, in particular to the application in preparing transgenic sweet potatoes with high content of the chlorogenic acid of the sweet potatoes.

Wherein, the plant includes but is not limited to sweet potato.

The invention also discloses a method for obtaining the plant with high content of the chlorogenic acid of the sweet potatoes, which comprises the following steps:

1) Allowing the plant to comprise said gene; or

2) Allowing the plant to express said protein.

Wherein, the method comprises the steps of transgenosis, hybridization, backcross or asexual propagation and the like.

The present invention also includes a method for identifying a plant having a high content of chlorogenic acid in sweetpotato, wherein the plant is a plant comprising said gene, a plant expressing said protein or a plant obtained by said method, comprising the steps of:

1) Determining whether said plant comprises said gene; or the like, or, alternatively,

2) Determining whether said plant expresses said protein.

Has the advantages that: compared with the prior art, the invention has the following advantages and effects: the invention separates the complete cDNA of key enzyme gene IbPAL2 of the synthesis route of the chlorogenic acid of the sweet potato from the sweet potato, connects to the plant expression vector, transforms the plant by using the agrobacterium infection method, obtains the transgenic plant and analyzes the chlorogenic acid content, and the result shows that the IbPAL2 gene can improve the synthesis capacity of the chlorogenic acid of the sweet potato. The gene can be applied to genetic improvement of plants.

Drawings

FIG. 1, phylogenetic tree analysis of IbPAL2 protein;

FIG. 2, tissue expression pattern of IbPAL2 in Scotch 16; s: a stem; l: leaves; SR: storing the roots; PR: burdock root; FR: fiber roots;

FIG. 3, ibPAL2 overexpression vector pCAMBIA1305-IbPAL2 schematic diagram;

FIG. 4, analysis of chlorogenic acid and isochlorogenic acid content in untransformed sweet potato strain and overexpressed IbPAL2 transgenic sweet potato leaves; CGA: chlorogenic acid; ICGA-A: isochlorogenic acid A; ICGA-B: isochlorogenic acid B; ICGA-C: isochlorogenic acid C; x29: xu potato No. 29 (transgenic recipient sweet potato variety); OV: ibPAL2 overexpresses the transgenic plants.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are conventional products which are commercially available, and are not indicated by manufacturers.

Example 1: obtaining of key enzyme gene IbPAL2 in synthesis route of chlorogenic acid of sweet potato

The sequence of a key enzyme gene IbPAL2 in the synthesis route of the chlorogenic acid of the sweet potato is obtained as follows:

total RNA was extracted from 100mg of fresh sweetpotato leaves using an OMEGA RNA kit, and cDNA was synthesized using a reverse transcription kit (Bioteke).

The specific reaction system is as follows:

the reverse transcription reaction was performed on a PCR instrument under the following conditions: 1. 50 ℃ for 45min; 2. 10min at 70 ℃; and then cooled on ice.

Sending the extracted total RNA to a Huada gene (Beijing Genomic Institute, BGI), obtaining a sweet potato transcriptome database through high-throughput sequencing, obtaining a sweet potato Unigene database through De novo splicing, obtaining genes possibly participating in chlorogenic acid synthesis through NCBI database comparison and OFR FINDER (http:// www.ncbi.nlm.nih.gov/projects/gorf /) online software prediction, and designing and amplifying complete ORF primers by using Primer Premier 5:

IbPAL2(F)：5′-CCATCCCACAAACATTACA-3′

IbPAL2(R)：5′-GAGGTGATCCGAAGAACA-3′

the amplification was carried out using KOD FX polymerase from TAKARA, as follows:

the reaction conditions were as follows: 94 ℃ for 2min;98 ℃ for 10sec;58 ℃ for 30sec; l.5min at 68 ℃; 10min at 68 ℃;34 cycles. The PCR product was purified using an OMEGA DNA purification Kit, and the purified PCR product was ligated with pEASY-Blunt Vector to obtain pEASY-Blunt-IbPAL2 plasmid (the procedure used pEASY-Blunt Vector Cloning Kit from TransGEN), in the following reaction system: 4. Mu.L of cDNA fragment of IbPAL2 gene, and 1. Mu.L of pEASY-Blunt vector. Reaction conditions are as follows: at 25 ℃ for 20min. The ligation product was transformed into E-Coli.DH5. Alpha. Competence, spread on LB agar plate medium containing 40. Mu.L of 25mg/mL X-Gal, 16. Mu.L of 50mg/mL IPTG, and 100mg/mL Amp, and single colonies were formed. White colonies were picked and the length of the insert in the pEASY-Blunt vector was confirmed using colony PCR, consistent with the expected size. Sent to Nanjing Kingsrey Biotech company for sequencing to obtain the gene sequence SEQ ID NO.1.

Example 2: ibPAL2 protein sequence homology analysis

IbPAL2 protein sequence homology analysis is carried out as follows: the full length of the cDNA fragment obtained by sequencing is 2325bp, the ORF is 2178bp, 725 amino acids are coded by SEQ ID NO.2, the protein sequence obtained by translation is compared with a Gramene database (http:// www.gramene.org /), and the plant species homologous gene similar to the IbPAL2 protein sequence is obtained. Based on multiple comparative analysis, phylogenetic trees of various homologous plant species genes are established, and detailed description is provided in FIG. 1. Including Arabidopsis thaliana (Arabidopsis thaliana, PAL1: at2g37040.1, PAL2: at3g53260.1, PAL3: at5g04230.1, PAL4: at3g10340.1), tobacco (Nicotiana pate, PAL3_ 0. The MEGA6.0 software is used for constructing a phylogenetic tree, and the obtained IbPAL2 genetic relationship is closer to the genetic relationship of NaPAL3_0 and NaTPA1_0 of tobacco (as shown in figure 1).

Example 3: ibPAL2 gene tissue expression pattern in sweet potato

The IbPAL2 gene has a tissue expression pattern in the sweet potato, which is as follows: taking Su potato No. 16 (selected and bred by grain crop research institute of agricultural academy of sciences of Jiangsu province) as a material, selecting 3 individual plants, sampling stems (Stem, S), leaves (Leaf, L), storage Roots (SR), fiber Roots (FR) and burdock roots (Pencil root, PR) at the same parts, quickly freezing by liquid nitrogen, and storing in a refrigerator at-80 ℃. RNA was extracted and inverted to cDNA as described in example 1. A fluorescence quantitative kit from TOYOBO was used. The reaction was carried out on a quantitative PCR instrument (Applied Biosystems tissue plus), the expression level of the gene was determined according to a relative quantitative method, the reaction procedure was carried out according to the manual provided by TOYOBO, the sweetpotato Tubulin gene was used as an internal reference in the reaction, the Tubulin primer sequence: f: CAACTACCAGCCACCAACTGT, R: CAAGATCCTCACGAGCTTCAC; ibPAL2 quantitative primer: f, CTAATGGCGAAGCCGAGATG, R, CTGCATTGCCACTCTCTAGC.

The expression result is shown in FIG. 2, and IbPAL2 gene is constitutively expressed in the threonine potato No. 16. In contrast, the IbPAL2 gene has stronger expression in roots and leaves of burdock.

Example 4: construction of binary plant expression vector pCAMBIA1305-IbPAL2

The construction of binary plant expression vector pCAMBIA1305-IbPAL2 is as follows:

a schematic diagram of pCAMBIA1305-IbPAL2 vector is shown in FIG. 3, which was first obtained in example 1

pEASY-Blunt-IbPAL2 plasmid is used as a template and adopts a primer

IbPAL2-inf(F)：5′-CGGAGCTAGCTCTAGCCATCCCACAAACATTACA-3′

IbPAL2-inf(R)：5′-TCGAGACGTCTCTAGGAGGTGATCCGAAGAACA-3′

An enzyme cutting site XbaI is introduced before and after IbPAL2, and the reaction system and conditions are as described in example 1, so that IbPAL2 plus enzyme cutting site PCR product fragments are obtained. After pCAMBIA1305 empty vector plasmid (provided by crop science research institute of Chinese academy of agricultural sciences) is subjected to single enzyme digestion by XbaI, the PCR product introduced with the enzyme digestion site is connected with the enzyme digestion product of the plasmid, and the connection system is as follows:

the ligation product was transformed into E-Coli. DH5. Alpha. And plated on LB plates containing a kanamycin resistance at a concentration of 100 mg/ml. Culturing at 37 deg.C, selecting single colony for colony PCR verification after 12h, extracting plasmid from the bacteria with positive colony PCR verification, performing enzyme digestion identification to obtain target band, and sequencing by Jinsry sequencing company

pCAMBIA1305-IbPAL2 was constructed correctly.

Example 5: agrobacterium strain EHA105: construction of pCAMBIA1305-IbPAL2

Agrobacterium strain EHA105 (purchased from beijing bomaide gene technology ltd) for plant transgenesis: the construction of pCAMBIA1305-IbPAL2 is as follows: the agrobacterium strain used in the present invention is EHA105. The constructed expression vector is transferred into agrobacterium by adopting a liquid nitrogen freeze-thawing method. The specific process is as follows: 1) Melting EHA105 competent cells in an ice bath, adding at least 100ng of recovered and purified expression vector plasmid pCAMBIA1305-IbPAL2, gently mixing uniformly, and carrying out ice bath for 20-30 min; 2) Quick freezing with liquid nitrogen for 5min, hot shocking at 37 deg.C for 5min, and rapidly freezing on ice for 5min; 3) Adding 800 μ L LB culture medium without antibiotics, and resuscitating at 28 deg.C and 200rpm for 3.5h; 4) Centrifuging at 4000rpm for 3min, and sucking off the culture medium; 5) Uniformly mixing the residual bacteria liquid, and smearing the bacteria liquid on a solid LB culture medium added with 100mg/mL kanamycin and 100mg/mL rifampicin; 6) Carrying out inverted culture at 28 ℃ for 30-48 h; 7) Detecting positive clone by PCR, and storing at 4 ℃ for later use.

Example 6: ibPAL2 transgene overexpression and chlorogenic acid content determination

1. IbPAL2 gene is transformed into Xushu potato No. 29 (bred by Xuzhou city agricultural academy of sciences, the institute of sweet potato, chinese agricultural academy of sciences), which is as follows:

the positive clone in example 5 was inoculated into 50mLYEP (containing 100. Mu.g/mL Rif, 100. Mu.g/mL Kan) liquid medium, and the culture was continued at 28 ℃ and 180rpm to OD₆₀₀To 0.6-0.8. Centrifuging at 4000rpm for 10min, discarding the culture medium, and collecting the thallus. The cells were diluted to OD 0.1% with MS1D liquid medium (4.4 g/l MS +0.4mg/1VB1+30g/l sucrose + inositol 0.1g/l +1mg/12,4D) +0.1% As₆₀₀0.3 to 0.5, and preparing the sweet potato transformation dye-dipping solution. Soaking sweet potato callus in the solution for 20min while shading light and slowly shaking on a shaking table. After ultrasonic treatment for 10sec, the invaded liquid was poured off, the water on the surface of the callus was blotted with a sterile filter paper, and the dried infected callus was transferred to MS1D (containing 0.1% As) medium and co-cultured for 2 to 3 days (dark). The agrobacterium on the surface of the callus is cleaned by sterile water, the callus is transferred to a screening medium (MS 1D +10mg/L hygromycin +400mg/L cefotaxime), and the callus is transferred to a regeneration medium after 4-6 weeks of dark culture. The hygromycin-screened calli were transferred to regeneration medium MSCH (4.4 g/L MS +10mg/L hygromycin +200mg/L cefotaxime), and after differentiation into seedlings, the seedlings were transferred to rooting medium SBMC (4.4 g/L MS +200mg/L cefotaxime +0.3mg/LVB 1).

Transplanting the transgenic seedling differentiated into the seedling into a pot, extracting the DNA of the leaf after survival (about 7-14 d) for PCR identification, cloning the primers and the PCR program as the intermediate fragment of the IbPAL2 gene in the example 1, and detecting the PCR product by 1% agarose gel electrophoresis. The transgenic plants which are detected to be positive by PCR are further sampled, RNA is extracted for Real-time PCR quantitative analysis, so as to verify the IbPAL2 overexpression effect.

2. The chlorogenic acid content of IbPAL2 gene sweet potato overexpression plants is measured:

taking transgenic receptor Xushu No. 29 (bred by Xuzhou city agricultural academy of sciences, ipomoea research institute of Chinese agricultural academy) as a reference, taking the same part of leaves of the IbPAL2 overexpression transgenic plant and the reference plant to perform chlorogenic acid content determination, and the determination result is shown in FIG. 4. The specific operation steps are as follows: accurately weighing 0.2g of dried sweet potato leaves into a 100mL conical flask with a plug, adding 20mL of 50% methanol, soaking for 24h, performing ultrasonic treatment for 0.5h, filtering, and washing. Repeating the operation for 2 times, combining the filtrates, diluting the combined filtrates with 50% methanol to a constant volume in a 50mL volumetric flask by 10 times, and then testing the combined filtrates.

Drawing a standard curve of chlorogenic acid: accurately weighing 5.0mg each of chlorogenic acid and isochlorogenic acid A, B, C standard (purchased from Beijing Solebao science and technology Co., ltd.), completely dissolving with 50% methanol solution under ultrasonic condition, and diluting to 25mL to obtain mixed standard solutions with concentration of 0.2mg/mL each. 0.5 mL, 1.0 mL, 1.5 mL, 2.0 mL, and 2.5mL of the standard solutions were placed in a 25mL brown volumetric flask and the volume was determined with 50% methanol solution. The absorbance was measured by HPLC at an absorption wavelength of 326nm, and the concentration was plotted as x-coordinate and the absorbance as y-coordinate.

The result shows (figure 4) that the IbPAL2 gene is overexpressed in the sweet potato, which can obviously improve the content of chlorogenic acid and isochlorogenic acid A-C in the leaves. The IbPAL2 gene has important value in the aspect of sweet potato nutrition quality improvement.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> key enzyme gene IbPAL2 of sweet potato chlorogenic acid synthetic pathway and application

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2178

<212> DNA

<213> IbPAL2 gene (Ipomoea batatas)

<400> 1

atggagaacg gcaatgggat cagcagcaac ggccacgccc acgcccacgc gcatgatttc 60

tgcgtggagc agaagcgccg cccgtcgccg tcgcaagacc cgttgaactg gaacgcggcg 120

gcggaggccc tgaagggcag ccacctggac gaggtgaaga gaatggtgga ggagtacagg 180

acggcgacgg tgaagctagg aggcgagacg ctgacgatag ctcaggtggc ggccgtagcc 240

gcccgaggga cgtcggaggt gacggtggag ctgtcggagg cggcccgcgc cggcgtgaag 300

gccagcagcg actgggtgat gaccggaatg gaaaatggca ccgatagcta cggcgtcacc 360

accgggttcg gtgcaacctc tcatcgacga acaaagcaag gcgctgctct tcagaaagaa 420

cttattaggt tcttgaacgc cggaatattc gggaaggggg cggagtcatg ccacacgctg 480

ccgcactcgg ccaccagggc cgccatgctg gtcaggatca acacccttct ccagggctac 540

tccgggatca ggttcgagat cctggaggcc ataaccaagc tgctgaacca caacatcacg 600

ccctgcctgc ccctccgtgg caccatcacc gcgtccggcg acttggtccc tctgtcctac 660

atagccgggc tgatcaccgg ccgcccgaac tccaaggcgg tcgggccgaa cggggaggcc 720

ctggacgccg aggaggcgtt caggatggcg ggaatcgagt ccgggttctt caagttgcag 780

ccgaaagaag gcctggccat ggtgaatggc acggccgtcg ggtcaggatt ggcgtcaatg 840

gtgctgtttg aggccaacat aatggcggtt ttatcggagg ttttgtcggc actgttcgca 900

gaagttatgc acggcaagcc ggaattcaca gaccatttga cgcataaatt gaagcaccac 960

ccgggccaga tcgaagccgc ggcaataatg gagcatattt tggatgggag ttcatacata 1020

aaagaagcca cgaaaaccca cgaattagac cctcttcaga agcctaaaca ggaccgctat 1080

gctctcagaa catcacccca atggctcggc cctcagattg aagtgatcag agccgccacc 1140

aagatgattg agagggaaat taactctgta aacgacaacc ctctgattga tgtttccagg 1200

aacaaagcat tgcacggagg gaacttccag gggacaccaa ttggcgtctc gatggacaac 1260

gttcgcctcg cgctggccgc cattgggaag ctaatgtttg ctcagttctc cgagcttgtt 1320

aacgactact acaacaatgg cctgccttca aatctctcgg gcgggcgaaa ccctagcttg 1380

gattatggct tcaaaggggc agaaatcgcg atggcgtctt actgctcaga gctgcagttc 1440

cttggcaacc ctgtcacgaa tcacgtccag agcgccgagc agcataacca ggatgtaaac 1500

tctctcgggc tcatctcgtc gaggaaaaca gccgaggcgc tcgacattct gaagctcatg 1560

tctgcaacct acatggttgc attgtgccaa gccattgacc tgaggcacct ggaggagaat 1620

ctgaaggcct gcactaaaaa tgcagttagt caggttgcca aaaaggtctt gacagtgggg 1680

gaaaatggtg agcttcaccc ttccagattc tccgaaaagg atctcctcaa agtcgtcgac 1740

agagagtacg tgttcgccta cgctgatgac ccgtgcagcg aaaactaccc attgatgcag 1800

aagctcaggc aggtcctggt cgatcacgcc ttggctaatg gcgaagcgga gatgagctct 1860

agcacatcca tcttccacaa aatcggggcg ttcgaggagg aactcaaagc cattttgcct 1920

aaagaaatcg agggcgcgag gtgcgagcta gagagtggca atgcagccat tcctaacagg 1980

atccaagagt gcaggtcctt cccactctac aaatttgtta gggcagaact aggaaccagt 2040

cttctaacgg gcgagaaagt ccggtcgccc ggggaggaat gtgacaaggt attcacagcc 2100

atgtgtgaag ggaagctcat agatccactg ctggattgtt tgaaggaatg gaatggtgcc 2160

cctctgccca tttgctag 2178

<210> 2

<211> 725

<212> PRT

<213> IbPAL2 protein (Ipomoea batatas)

<400> 2

Met Glu Asn Gly Asn Gly Ile Ser Ser Asn Gly His Ala His Ala His

1 5 10 15

Ala His Asp Phe Cys Val Glu Gln Lys Arg Arg Pro Ser Pro Ser Gln

20 25 30

Asp Pro Leu Asn Trp Asn Ala Ala Ala Glu Ala Leu Lys Gly Ser His

35 40 45

Leu Asp Glu Val Lys Arg Met Val Glu Glu Tyr Arg Thr Ala Thr Val

50 55 60

Lys Leu Gly Gly Glu Thr Leu Thr Ile Ala Gln Val Ala Ala Val Ala

65 70 75 80

Ala Arg Gly Thr Ser Glu Val Thr Val Glu Leu Ser Glu Ala Ala Arg

85 90 95

Ala Gly Val Lys Ala Ser Ser Asp Trp Val Met Thr Gly Met Glu Asn

100 105 110

Gly Thr Asp Ser Tyr Gly Val Thr Thr Gly Phe Gly Ala Thr Ser His

115 120 125

Arg Arg Thr Lys Gln Gly Ala Ala Leu Gln Lys Glu Leu Ile Arg Phe

130 135 140

Leu Asn Ala Gly Ile Phe Gly Lys Gly Ala Glu Ser Cys His Thr Leu

145 150 155 160

Pro His Ser Ala Thr Arg Ala Ala Met Leu Val Arg Ile Asn Thr Leu

165 170 175

Leu Gln Gly Tyr Ser Gly Ile Arg Phe Glu Ile Leu Glu Ala Ile Thr

180 185 190

Lys Leu Leu Asn His Asn Ile Thr Pro Cys Leu Pro Leu Arg Gly Thr

195 200 205

Ile Thr Ala Ser Gly Asp Leu Val Pro Leu Ser Tyr Ile Ala Gly Leu

210 215 220

Ile Thr Gly Arg Pro Asn Ser Lys Ala Val Gly Pro Asn Gly Glu Ala

225 230 235 240

Leu Asp Ala Glu Glu Ala Phe Arg Met Ala Gly Ile Glu Ser Gly Phe

245 250 255

Phe Lys Leu Gln Pro Lys Glu Gly Leu Ala Met Val Asn Gly Thr Ala

260 265 270

Val Gly Ser Gly Leu Ala Ser Met Val Leu Phe Glu Ala Asn Ile Met

275 280 285

Ala Val Leu Ser Glu Val Leu Ser Ala Leu Phe Ala Glu Val Met His

290 295 300

Gly Lys Pro Glu Phe Thr Asp His Leu Thr His Lys Leu Lys His His

305 310 315 320

Pro Gly Gln Ile Glu Ala Ala Ala Ile Met Glu His Ile Leu Asp Gly

325 330 335

Ser Ser Tyr Ile Lys Glu Ala Thr Lys Thr His Glu Leu Asp Pro Leu

340 345 350

Gln Lys Pro Lys Gln Asp Arg Tyr Ala Leu Arg Thr Ser Pro Gln Trp

355 360 365

Leu Gly Pro Gln Ile Glu Val Ile Arg Ala Ala Thr Lys Met Ile Glu

370 375 380

Arg Glu Ile Asn Ser Val Asn Asp Asn Pro Leu Ile Asp Val Ser Arg

385 390 395 400

Asn Lys Ala Leu His Gly Gly Asn Phe Gln Gly Thr Pro Ile Gly Val

405 410 415

Ser Met Asp Asn Val Arg Leu Ala Leu Ala Ala Ile Gly Lys Leu Met

420 425 430

Phe Ala Gln Phe Ser Glu Leu Val Asn Asp Tyr Tyr Asn Asn Gly Leu

435 440 445

Pro Ser Asn Leu Ser Gly Gly Arg Asn Pro Ser Leu Asp Tyr Gly Phe

450 455 460

Lys Gly Ala Glu Ile Ala Met Ala Ser Tyr Cys Ser Glu Leu Gln Phe

465 470 475 480

Leu Gly Asn Pro Val Thr Asn His Val Gln Ser Ala Glu Gln His Asn

485 490 495

Gln Asp Val Asn Ser Leu Gly Leu Ile Ser Ser Arg Lys Thr Ala Glu

500 505 510

Ala Leu Asp Ile Leu Lys Leu Met Ser Ala Thr Tyr Met Val Ala Leu

515 520 525

Cys Gln Ala Ile Asp Leu Arg His Leu Glu Glu Asn Leu Lys Ala Cys

530 535 540

Thr Lys Asn Ala Val Ser Gln Val Ala Lys Lys Val Leu Thr Val Gly

545 550 555 560

Glu Asn Gly Glu Leu His Pro Ser Arg Phe Ser Glu Lys Asp Leu Leu

565 570 575

Lys Val Val Asp Arg Glu Tyr Val Phe Ala Tyr Ala Asp Asp Pro Cys

580 585 590

Ser Glu Asn Tyr Pro Leu Met Gln Lys Leu Arg Gln Val Leu Val Asp

595 600 605

His Ala Leu Ala Asn Gly Glu Ala Glu Met Ser Ser Ser Thr Ser Ile

610 615 620

Phe His Lys Ile Gly Ala Phe Glu Glu Glu Leu Lys Ala Ile Leu Pro

625 630 635 640

Lys Glu Ile Glu Gly Ala Arg Cys Glu Leu Glu Ser Gly Asn Ala Ala

645 650 655

Ile Pro Asn Arg Ile Gln Glu Cys Arg Ser Phe Pro Leu Tyr Lys Phe

660 665 670

Val Arg Ala Glu Leu Gly Thr Ser Leu Leu Thr Gly Glu Lys Val Arg

675 680 685

Ser Pro Gly Glu Glu Cys Asp Lys Val Phe Thr Ala Met Cys Glu Gly

690 695 700

Lys Leu Ile Asp Pro Leu Leu Asp Cys Leu Lys Glu Trp Asn Gly Ala

705 710 715 720

Pro Leu Pro Ile Cys

725

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccatcccaca aacattaca 19

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaggtgatcc gaagaaca 18

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caactaccag ccaccaactg t 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caagatcctc acgagcttca c 21

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctaatggcga agccgagatg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctgcattgcc actctctagc 20

<210> 9

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggagctagc tctagccatc ccacaaacat taca 34

<210> 10

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcgagacgtc tctaggaggt gatccgaaga aca 33

Claims

1. An IbPAL2 gene, the nucleotide sequence of which is shown as SEQ ID NO:1 is shown.

2. The protein encoded by the IbPAL2 gene of claim 1, wherein the amino acid sequence of the protein is as shown in SEQ ID NO: 2. as shown.

3. An expression cassette or recombinant vector comprising the IbPAL2 gene of claim 1.

4. The recombinant vector according to claim 3, wherein the recombinant vector is pCAMBIA1305-IbPAL2.

5. The IbPAL2 gene of claim 1, the protein of claim 2, the expression cassette or the recombinant vector of claim 3, for obtaining a plant with high chlorogenic acid content, wherein the plant is Ipomoea batatas.

6. The method for obtaining the sweet potato with high content of chlorogenic acid is characterized by comprising the following steps: allowing sweetpotato to contain the gene of claim 1; or allowing sweet potatoes to express the protein of claim 2.

7. The method according to claim 6, characterized in that it comprises a transgenic, crossing, backcrossing or asexual propagation step.

8. A method for identifying sweetpotato having high content of chlorogenic acid, wherein the sweetpotato comprises IbPAL2 gene of claim 1, or expresses protein of claim 2, or is obtained by the method of any one of claims 6~7, comprising the steps of: determining whether said sweetpotato comprises the IbPAL2 gene of claim 1; or, determining whether the sweetpotato expresses the protein of claim 2.