CN111686133A

CN111686133A - Application of bacterium dorferi in preventing and improving obesity and related diseases

Info

Publication number: CN111686133A
Application number: CN202010721469.XA
Authority: CN
Inventors: 朱升龙; 陈永泉; 姜旋
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-07-24
Filing date: 2020-07-24
Publication date: 2020-09-22

Abstract

The invention relates to an application of bacterium duchenii in preventing and improving obesity and related diseases, belonging to the technical field of biological medicines and microorganisms. The strain of the bacterium Du's bacterium (Dubosielnwyorkensis) NYU-BL-A4 used in the invention can improve the abnormal indexes of fat-induced obese mice caused by high fat diet, and can reduce the serum low density lipoprotein cholesterol (LDL-C) of the obese mice by 25 percent and reduce the content of Triglyceride (TG) of the liver by 32 percent; meanwhile, the related indexes of the weight and the blood sugar of the obese mouse can be reduced, and the digestion and absorption capacity of the body to the glucose is improved; the strain NYU-BL-A4 of the Dunaliella can improve the abundance of beneficial microorganisms in obese mice, improve the structural disorder of intestinal flora of mice caused by high-fat diet, improve the intestinal metabolism and the immunity, and reduce the occurrence of diseases such as bacterial infection and the like.

Description

Application of bacterium dorferi in preventing and improving obesity and related diseases

Technical Field

The invention relates to an application of bacterium duchenii in preventing and improving obesity and related diseases, belonging to the technical field of biological medicines and microorganisms.

Background

With the development and application of the second-generation sequencing technology, metagenomics and metabonomics technology, people are also continuously and deeply researching the intestinal microorganisms. The microbiota in the adult intestinal tract has about 330 ten thousand genes, which are 150-200 times of the whole human genome, and are considered as the second genome of the human body, while the human body is described as a "super organism". The intestinal flora participates in the metabolic process of nutrition and energy of human body, not only can mediate the occurrence and development of obesity by influencing the energy metabolism absorption and intestinal wall permeability of the body, but also can participate in the metabolic process of carbohydrate, bile acid, choline and the like of the body to generate small molecular chemical substances which interact with tissues and organs of the human body to form an intestinal flora-intestine-target organ axis to mediate the occurrence and development of obesity.

The intestinal flora is taken as a 'invisible endocrine organ' of an organism, and multiple effects of multiple chemical substances generated by the metabolism of the substances on a host need more foundations and clinical tests to be researched so as to provide more theoretical bases for the prevention and treatment of obesity. With the development and maturity of the technology, intestinal intervention can be better performed on sensitive flora, the blank of clinical research is filled, such as the research and development of probiotics and prebiotics specificity strains, the intestinal transplantation of the sensitive strains, and related receptors and ligand agonists or blockers of the effect of metabolites, so as to more effectively play the weight reduction effect of the flora, and the individual intervention on the intestinal flora provides a new idea for the prevention and treatment of obesity.

However, due to the specificity of the microbiota-host interaction, beneficial organisms must be obtained in pure culture in order to consistently provide them as therapeutic agents. There are relatively few genera used in probiotics available on the market today compared to the large number of organisms in the gastrointestinal tract. The need to grow and characterize members of the new bacterial class is increasing, and potential microorganisms are identified and studied for association with the host on a regular basis.

Disclosure of Invention

The present invention has been made to solve the problems occurring in the background art as described above, and the present invention provides the use of Du's bacterium (Dubosielnewyorkensis) or a probiotic preparation containing Du's bacterium for the preparation of a product for preventing, alleviating or improving obesity and its complications.

In one embodiment of the invention, the bacterium duchenne is NYU-BL-A4, published in U.S. Pat. No. 3, 2018125900, 1.

In one embodiment of the invention, the obesity and its complications include hyperlipidemia, fatty liver, insulin resistance, glucose intolerance.

In one embodiment of the present invention,

the product is used in at least one of (a) to (c):

(a) reducing body weight;

(b) reduce the accumulation of liver fat;

(c) reducing the level of at least one of serum low density lipoprotein cholesterol, liver cholesterol, and triglyceride.

In one embodiment of the invention, the product is used to increase the abundance of beneficial microorganisms in the gut.

In one embodiment of the invention, the beneficial microorganisms include, but are not limited to, bifidobacteria, lactobacilli.

In one embodiment of the invention, the probiotic preparation contains other auxiliary materials besides the bacterium duchenii, the auxiliary materials include but are not limited to excipients or food additives, and the content of the bacterium duchenii in the probiotic preparation is not lower than 1.0 × 10⁸cfu/mL or 1.0 × 10⁸cfu/g。

In one embodiment of the invention, the product comprises a medicament or pharmaceutical composition, the content of the bacterium duchenne in the medicament or pharmaceutical composition is not less than 1.0 × 10⁸cfu/mL or 1.0 × 10⁸cfu/g。

In one embodiment of the invention, the medicament or pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

In one embodiment of the present invention, the pharmaceutically acceptable excipient refers to any diluent, adjuvant and/or carrier that can be used in the pharmaceutical field.

In one embodiment of the invention, the product includes, but is not limited to, a food product, a nutraceutical beverage, an enteral nutritional formulation, a dietary supplement, a veterinary drug, or a feed additive.

In one embodiment of the present invention, the food, health drink, enteral nutrition preparation, dietary supplement, veterinary drug, or feed additive further contains ingredients commonly used in the art, which are appropriately selected by those skilled in the art according to the formulation and the purpose of use, and may be used together with other materials.

In one embodiment of the invention, the conventional excipients include one or more of fillers, flavoring agents, binders, disintegrants, lubricants, antacids, and fortifiers.

Has the advantages that: the strain of the bacterium Dunaliella (Dubosiella newyorkensis) NYU-BL-A4 can improve the abnormal indexes of fat-diet-induced obese mice, and can reduce the serum and liver low-density lipoprotein cholesterol (LDL-C) of the obese mice by 15 percent and reduce the content of Triglyceride (TG) by 32 percent; meanwhile, the related indexes of the weight and the blood sugar of the obese mouse can be reduced, and the digestion and absorption capacity of the body to the glucose is improved; the strain NYU-BL-A4 of the genus Dunaliella can improve the abundance of bifidobacteria (Bifidobacterium) and lactobacilli (Lactobacillus) in obese mice, improve the structural disorder of intestinal flora of mice caused by high-fat diet, improve the intestinal metabolism and the immunity, and reduce the occurrence of diseases such as bacterial infection. The strain can be used for preparing health-care food or medicines for relieving metabolic syndrome, and has a very wide application prospect.

Drawings

FIG. 1 is a graph of the effect of Bacillus dunaligenes NYU-BL-A4 on the abundance of related beneficial bacteria in the gut of obese mice.

FIG. 2 is a graph showing the effect of Bacillus dunaligenes NYU-BL-A4 on body weight in obese mice.

FIG. 3 is a graph of the fasting blood glucose level of Duchenella bacterium NYU-BL-A4 in obese mice.

FIG. 4 is a graph of the effect of Bacillus dunaligenes NYU-BL-A4 on glucose tolerance (GTT) in obese mice.

FIG. 5 is a graph of the effect of Deutsche NYU-BL-A4 on insulin sensitivity (ITT) in obese mice.

FIG. 6 is a graph of the effect of Bacillus dunaligenes NYU-BL-A4 on liver weight in obese mice.

FIG. 7 is a graph showing the effect of Bacillus dunaliensis NYU-BL-A4 on serum low density lipoprotein cholesterol (LDL-C) in obese mice.

FIG. 8 is a graph showing the effect of Bacillus dunaligenes NYU-BL-A4 on hepatic Triglycerides (TG) in obese mice.

FIG. 9 is a graph showing the effect of Bacillus dunaligenes NYU-BL-A4 on hepatic lipid metabolism genes in obese mice.

Detailed Description

C57BL/6J mice were purchased from Shanghai Spiker laboratory animals, Inc.

Modified MTGE broth medium: MTGE broth + 0.05% cysteine hydrochloride.

Example 1: tolerance of Dunaliella NYU-BL-A4 to simulated gastrointestinal fluids

Inoculating Dunaliella strain NYU-BL-A4 stored at freezing-80 deg.C in improved MTGE broth culture medium, culturing at 37 deg.C under anaerobic condition for 48h, subculturing with inoculum size of 2-4mL/100mL for 2 times, activating strain sufficiently, adjusting viable bacteria concentration of strain culture solution to 5 × 10⁸CFU/mL, and 1mL of the culture broth was taken out and mixed with 9.0mL of artificial simulated gastric juice (MTGE broth medium containing 1g/100mL of pepsin at pH 2.5) at pH2.5, and cultured under anaerobic conditions at 37 ℃, and samples were taken at 0h, 0.5h, 1h and 2h, respectively, spread on brucella solid medium and cultured, plate colony counting was performed, viable cell count was determined and survival rate was calculated. The survival rate is the ratio of the log of viable bacteria in the culture broth at the time of sampling to the log of viable bacteria at 0h, expressed as%. The results of the experiment are shown in table 1.

TABLE 1 tolerance of Dunaliella NYU-BL-A4 in simulated gastric fluid

Adding 1mL of mixed culture solution into 9mL of artificial simulated intestinal fluid (MTGE broth culture medium containing 0.3% of bovine bile salt, 1% of trypsin and pH 8.0), culturing at 37 ℃ in an anaerobic environment, sampling at 0h, 0.5h, 1h, 2h, 3h and 4h respectively, coating on brucella solid culture medium, culturing, counting plate colonies, measuring viable count and calculating the survival rate. The survival rate is the ratio of the logarithmic viable count at the sampling time to the logarithmic viable count at the 0h time in the culture solution, and is expressed by%. The results of the experiment are shown in table 2.

TABLE 2 tolerance of Dunaliella (Dubosiella newyorkensis) NYU-BL-A4 in artificially simulated intestinal fluid

The results of the experiments are shown in tables 1 and 2, and show that the Dunaliella (Dubosiella newyorkensis) NYU-BL-A4 has higher survival rate in acidic and alkaline artificial gastrointestinal fluids, and thus has better tolerance to intestinal fluids.

Example 2: the Dunaliella bacterium NYU-BL-A4 has no toxic or side effect on C57BL/6J mice

Suspending the bacterial body of Dunaliella NYU-BL-A4 in 3g/100mL sucrose solution to make the concentration 3.0 × 10⁸Taking 8 healthy male C57BL/6J mice with the weight of 20-22g, adapting to the breeding environment for one week, and then taking the mice with the daily administration concentration of 3.0 × 10⁸The CFU/mL bacterial suspension is used for intragastric administration once, each intragastric administration is 0.2mL, observation is carried out for one week, and actual death and weight conditions are recorded. The results are shown in Table 3.

TABLE 3 weight change and mortality in mice

Time (sky)	1	2	3	4	5	6	7
								Body weight (g)	21..25±0.2	21.39±0.3	21.68±0.3	21.97±0.2	22.12±0.3	22.32±0.2	22.45±0.3
Death situation	-	-	-	-	-	-	-

Note: -means no death.

The results in Table 3 show that the feed concentration was 3.0 × 10⁸The Dunaliella NYU-BL-A4 of CFU/m L has no obvious influence on mice, no obvious change in weight and no death phenomenon. The normal appearance of the signs of the mice has no obvious pathological symptoms.

Example 3: effect of Dunaliella NYU-BL-A4 on abundance of intestinal flora

The experimental animals adopt 36 SPF male C57BL/6J mice with 5-6 weeks old and 20-22g weight, the animals freely eat and drink water, the ambient temperature is 22 +/-2 ℃, the humidity is 55 +/-5%, the illumination is 12h light-dark alternation, after adapting to the environment for 7 days, the experiment is started, the animals are randomly divided into 3 groups, namely a blank control group (ND), a high-fat model control group (HFD) and a Bacillus dolichiana NYU-BL-A4 treatment group (NYU-BL-A4), each group contains 8 mice, the high-fat feed is 60% high-fat model feed of TP23300 series of Nantong Turofen, the blank control group adopts 10% control feed (product number: D12450B) of Nantong Turofen, the mice of the treatment group are fed with the high-fat feed for 4 weeks and then are subjected to gastric lavage bacteria suspension, and the dosage is 1.0 × 10⁹CFU/mL, bacteria suspended in 3g/100mL sucrose solution, gavage for 6 weeks.

The grouping and treatment methods of the experimental animals are shown in Table 4:

table 4 experimental groups mice number, experimental period, feed and treatment protocol

The body weight of the mouse is monitored and recorded periodically and weekly during the experiment, fresh excrement of the mouse is collected and frozen at-80 ℃ before the experiment is finished, and bacterial genomes in the excrement are extracted for 16S rRNA sequencing for carrying out subsequent analysis on the characteristic structure of the intestinal flora. At the end of the experiment at week 10, mice were fasted for 12h without water deprivation, anesthetized by intraperitoneal injection of 100mg/kg bw of ketamine, collected in orbital venous plexus, and sacrificed by dislocation of cervical vertebrae. Centrifuging the blood sample at 3000 Xg and 4 deg.C for 15min to separate serum, collecting the upper layer, and freezing at-80 deg.C for subsequent measurement of related serum biochemical indexes. After liver tissues and adipose tissues (epididymal fat and inguinal fat) of each part are accurately weighed, the same part of liver is collected and then is quickly placed in precooled physiological saline for rinsing and removing blood, and is fixed in 4% paraformaldehyde for manufacturing paraffin pathological sections. The rest part of liver, various parts of fat and other tissues are taken out, quickly placed in liquid nitrogen for quick freezing, transferred to-80 ℃ for long-term cryopreservation, and subsequently prepared into liver homogenate to measure related indexes, wherein the specific preparation method comprises the following steps: weighing a certain amount of liver tissue, adding 9 times volume of physiological saline for tissue grinding, centrifuging at 3000rpm for 10min, taking supernatant, freezing and storing at-80 ℃ for testing, and testing liver Triglyceride (TG) and liver cholesterol (TC) according to Nanjing built kit instructions.

The results of the intestinal flora analysis are shown in fig. 1. The relative abundance of Dubosiella in the excrement of a model group mouse induced by high-fat feed is remarkably reduced, and the Dubsiella can remarkably increase the abundance of Dubosiella after being perfused with the Dunaliella NYU-BL-A4, and simultaneously improve the genera of Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) for enhancing the intestinal metabolism of the organism and improving the immunity, which shows that the selected Dunaliella NYU-BL-A4 has the functions of regulating the basal metabolism, enhancing the immunity, recovering the intestinal homeostasis and the like.

Example 4: effect of Bacillus dunaliensis NYU-BL-A4 on body weight of obese mice

The grouping, modeling and handling methods of the C57BL/6J mice were the same as in example 3. The results of the experiment are shown in FIG. 2. Compared with the control group, the body weight of the high-fat model control group (HFD) mice is obviously increased, and the body weight of the mice of the Dunaliella gastri NYU-BL-A4 is obviously reduced and tends to the blank control group. The bacterial strain has good effect on losing weight.

Example 5: effect of Bacillus dunaliensis NYU-BL-A4 on glucose intolerance and insulin resistance status in obese mice

The grouping, modeling and handling methods of the C57BL/6J mice were the same as in example 3. Blood glucose measurements were performed on each week prior to the end of the experiment (week 9) and tail vein blood glucose values were determined using a glucometer.

Determination of fasting blood glucose: mice were assayed overnight (12h) after fasting without water deprivation;

sugar tolerance measurement: the mice are fasted overnight (12h) without water prohibition, the initial blood sugar is detected (0min), then 2g/kg BW glucose solution is injected into the abdominal cavity, and the blood sugar values are detected at 30 min, 60 min, 90 min and 120min respectively;

insulin sensitivity assay: mice were fasted without water deprivation (6h), and then were assayed for initial blood glucose (0min), followed by intraperitoneal injection of 0.75U/kg BW glucose solution, and blood glucose values were assayed at 30, 60, 90, and 120min, respectively. The blood glucose change curve was plotted from each point blood glucose value and the Area Under the glucose tolerance and insulin sensitivity curve (Area Under center, AUC) was calculated for comparison between groups.

The experimental results are shown in FIGS. 3 to 5. As can be seen from FIG. 3, the fasting blood glucose value of the high fat model control group (HFD) is significantly higher than that of the blank control group (ND), while the Du's bacterium NYU-BL-A4 treatment group can significantly reduce the increase of fasting blood glucose caused by obesity. As shown in fig. 4 and 5, the high fat model control group (HFD) showed poor glucose tolerance and digestive absorption ability and insulin insensitivity after glucose or insulin injection, and blood glucose values were significantly increased and slowly decreased by glucose stimulation; the drop in blood glucose values after insulin injection was not significant, but subsequently rose more rapidly. The area under the curve AUC is obviously reduced after the Du's bacterium gastri NYU-BL-A4, and the curve approaches to a blank control (ND) group. This demonstrates that, Du's bacterium (Dubosielnewyorkensis) NYU-BL-A4 can significantly improve oral glucose tolerance and insulin resistance status, and enhance the ability to regulate glucose homeostasis and utilize insulin.

TABLE 5 mouse blood glucose levels (mmol) after glucose injection

Grouping

0min

30min

60min

90min

120min

AUC

Blank control

6.07±0.15

16.7±1.19

12.3±0.94

11.05±1.43

7.97±0.75

1415±45.92

High fat model control group

8.07±0.06

21.15±2.26

17.56±0.88

16.62±0.77

12.97±0.95

1976±56.79

Group of treatment with Du's bacterium

7.55±0.71

17.87±0.85

14.25±1.01

12.55±1.03

10.25±0.53

1607±38

TABLE 6 blood glucose levels (mmol) of mice after insulin injection

Grouping

0min

30min

60min

90min

120min

AUC

Blank control

10.35±0.54

6.17±0.27

5.97±1.05

5.45±0.46

5.7±0.59

768±27.93

High fat model control group

12.15±0.44

10±0.79

8.3±0.64

9.55±0.75

10.12±0.50

1170±28.69

Group of treatment with Du's bacterium

10.8±0.57

7.2±0.54

6.78±0.37

7.47±0.45

7.58±0.39

926.6±26.89

Example 6: effect of Bacillus dunaliensis NYU-BL-A4 on liver weight in obese mice

As shown in fig. 5, the weight of liver in HFD group obese mice was significantly increased compared to the blank control (ND) group. Compared with the HFD group, the weight of the liver in the Du's bacillus intervention group is obviously reduced, which shows that the strain has obvious effect on reducing the weight of the liver of the obese mice.

Example 7: effect of Bacillus dunaliensis NYU-BL-A4 on serum Low Density lipoprotein Cholesterol (LDL-C) levels in obese mice

The grouping, modeling and handling methods of the C57BL/6J mice were the same as in example 3. Measuring corresponding indexes in serum according to the detection method of Nanjing constructed low-density lipoprotein cholesterol (LDL-C). The results of the experiment are shown in FIG. 7.

The results of the experiment are shown in FIG. 7. The experimental result shows that compared with the normal control group, the serum low-density lipoprotein cholesterol (LDL-C) content of the mice in the high-fat diet group is obviously increased, and the content of the indexes in the serum can be reduced by the dolantin bacterium NYU-BL-A4.

Example 8: effect of Bacillus dunaliensis NYU-BL-A4 on hepatic Triglyceride (TG) of obese mice

The grouping, modeling and handling methods of the C57BL/6J mice were the same as in example 2. Weighing a certain amount of liver tissues of each group of mice respectively, adding physiological saline according to a ratio of 1:9 for tissue grinding, centrifuging at 3000rpm for 10min, taking supernatant, and determining the content of Triglyceride (TG) in the liver according to a detection method of a Nanjing constructed kit.

The results of the experiment are shown in FIG. 8. Compared with a normal control group, the content of Triglyceride (TG) in the liver of the mice in the high-fat diet group is obviously increased, and the content of the three indexes in the liver can be reduced in the gavage strain group, so that the pathological state of the liver caused by obesity can be relieved to a certain extent by the strain.

Example 9: influence of Dunaliella NYU-BL-A4 on liver lipid metabolism gene of obese mice

Extraction of total RNA of liver tissue: 50mg of liver tissue of each group of mice is taken and put into a 1.5ml EP tube without RNase, 1ml Trizol is added into each tube, steel balls are added and fully ground by a high-flux tissue grinder, 200ul chloroform is added after the mixture is kept stand for 10min at room temperature, the mixture is inverted and mixed evenly for 30s, and the mixture is kept stand for 5min at room temperature. Centrifugation was carried out at 4 ℃ and 12000rpm for 15 min. The upper aqueous phase containing total RNA was pipetted into a new RNase-free EP tube. Add 1 volume of 4 ℃ pre-cooled isopropanol to the new tube and let stand at room temperature for 15 min. Centrifugation was carried out at 4 ℃ and 12000rpm for 15min to precipitate RNA, and the supernatant was discarded. The pellet was washed with 1ml of pre-cooled 75% ethanol (DEPC water make up), centrifuged at 12000rpm for 10min at 4 ℃, the supernatant discarded and the washing step repeated. Naturally drying at room temperature, volatilizing ethanol, dissolving RNA precipitate with DEPC water, and using for subsequent experiment.

Reverse transcription cDNA Synthesis: the cDNA synthesis was carried out using a reverse transcription kit (cat # RR036A) from takara and the procedures described in the kit were followed.

SYBR Green method fluorescent real-time quantitative PCR:

fluorescent quantitative PCR primers (synthesized by Shanghai Biotechnology, Ltd.):

GAPDH-F：AGG TCG GTG TGAACG GATTTG(SEQ ID NO.1)，

GAPDH-R：TGTAGA CCA TGTAGT TGA GGT CA(SEQ ID NO.2)；

CD36-F：GCCTTGAAGCCGGGAGTTATT(SEQ ID NO.3)，

CD36-R：GTGGAGCGATCCATACAGGG(SEQ ID NO.4)；

FASN-F：ACAAGACAGACCTCTTCCCTC(SEQ ID NO.5)，

FASN-R：ATGGTTCGGAAATGTTGCACC(SEQ ID NO.6)；

pparγ-F：GATCCTACTGCTTGGGACATGG(SEQ ID NO.7)，

pparγ-R：GGAACACAAAGGCCAAGTG(SEQ ID NO.8)。

reaction system (10ul system): 2 XSYBR Green IMix 5ul, cDNA 0.5ul, upper and lower primers 0.5ul, sterile water 4 ul. The reaction system is added into a 96-well real-time quantitative special reaction plate, and each sample is provided with 4 multiple wells. The special transparent film is covered on a 96-well plate and sealed tightly, and the reaction plate is placed into a BIO RID fluorescent quantitative PCR instrument after centrifugation at 1500rpm for 2 minutes.

The reaction program includes pre-denaturation at 95 deg.c for 10min, amplification at 95 deg.c for 10s, amplification at 60 deg.c for 20s and amplification at 72 deg.c for 30 s.45 cycles, melting curve at 95 deg.c for 5s and 65 deg.c for 1min, calculating mRNA level relative expression, reaction to obtain Ct value of each sample when the fluorescence intensity reaches the threshold, and subtracting the Ct value of the reference Gene (GAPDH) in the corresponding treating group from the Ct value of each sample to obtain △ Ct value of each sample.

In order to explore the influence of the dorferia on the liver lipid metabolism gene level, the expression levels of three genes closely related to lipid metabolism, namely CD36 (fatty acid transporter 36), FASN (fatty acid synthase) and ppar gamma (peroxisome proliferator-activated receptor gamma) are selected and detected in the example, and as shown in fig. 9, compared with a normal control group, the expression levels of liver CD36, FASN and ppar gamma of mice in a high-fat diet group are remarkably increased, which indicates that the liver lipid metabolism related gene is abnormally expressed due to long-term high-fat intake, and the expression levels of liver CD36, FASN and ppar gamma of the mice in the dorferia treatment can be reduced, which indicates that the strain can influence the expression of the liver lipid metabolism gene, so that the lipid metabolism disorder state caused by obesity is relieved.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> use of Du's bacterium for preventing and improving obesity and related diseases

<160>8

<170>PatentIn version 3.3

<210>1

<211>21

<212>DNA

<213> Artificial sequence

<400>1

aggtcggtgt gaacggattt g 21

<210>2

<211>23

<212>DNA

<213> Artificial sequence

<400>2

tgtagaccat gtagttgagg tca 23

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<400>3

gccttgaagc cgggagttat t 21

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

gtggagcgat ccatacaggg 20

<210>5

<211>21

<212>DNA

<213> Artificial sequence

<400>5

acaagacaga cctcttccct c 21

<210>6

<211>21

<212>DNA

<213> Artificial sequence

<400>6

atggttcgga aatgttgcac c 21

<210>7

<211>22

<212>DNA

<213> Artificial sequence

<400>7

gatcctactg cttgggacat gg 22

<210>8

<211>19

<212>DNA

<213> Artificial sequence

<400>8

ggaacacaaa ggccaagtg 19

Claims

1. Use of a bacterium duchenne (Dubosielnewyorkensis) or a probiotic formulation comprising a bacterium duchenne for the manufacture of a product for preventing, alleviating or ameliorating obesity and its complications.

2. The use according to claim 1, wherein said bacterium duchenne is NYU-BL-a 4.

3. The use according to claim 1, wherein said obesity and its complications include hyperlipidemia, fatty liver, insulin resistance, glucose intolerance.

4. Use according to claim 1, wherein the product is used in at least one of (a) - (c):

(a) reducing body weight;

(b) reduce the accumulation of liver fat;

5. The use according to claim 1, wherein the product is for increasing the abundance of beneficial microorganisms in the gut.

6. Use according to claim 1, wherein the beneficial microorganisms include, but are not limited to, microorganisms of the genus Bifidobacterium and/or Lactobacillus.

7. The use of claim 1, wherein the probiotic preparation comprises, in addition to the bacterium duchenne, an excipient including, but not limited to, an excipient or a dietary supplement as a food additive, wherein the bacterium duchenne is present in the probiotic preparation in an amount of at least 1.0 × 10⁷cfu/mL or 1.0 × 10⁷cfu/g。

8. The use according to claim 1, wherein the product comprises a medicament or pharmaceutical composition, the content of the bacterium duchenne in the medicament or pharmaceutical composition being not less than 1.0 × 10⁷cfu/mL or 1.0 × 10⁷cfu/g。

9. The use according to claim 8, wherein the medicament or pharmaceutical composition further comprises a pharmaceutically acceptable excipient; the pharmaceutically acceptable excipient refers to any diluent, adjuvant and/or carrier that can be used in the pharmaceutical field.

10. Use according to claim 1, wherein the product comprises, but is not limited to, a food product, a nutraceutical beverage, an enteral nutritional preparation, a dietary supplement, a veterinary drug or a feed additive.