CN111676270B

CN111676270B - Screening method of polymorphic SNP molecular markers, polymorphic SNP molecular markers and primer pair

Info

Publication number: CN111676270B
Application number: CN202010655471.1A
Authority: CN
Inventors: 朱英; 李裕冬; 熊铁一; 鲜义坤
Original assignee: MOUNT EMEI BIOLOGICAL RESOURCE EXPERIMENTAL STATION; SICHUAN PROVINCE NATURAL RESOURCES SCIENCE ACADEMY
Current assignee: MOUNT EMEI BIOLOGICAL RESOURCE EXPERIMENTAL STATION; SICHUAN PROVINCE NATURAL RESOURCES SCIENCE ACADEMY
Priority date: 2020-07-09
Filing date: 2020-07-09
Publication date: 2023-07-25
Anticipated expiration: 2040-07-09
Also published as: CN111676270A

Abstract

The invention relates to the technical field of SNP molecular markers, in particular to a screening method of polymorphic SNP molecular markers, comprising the following steps: obtaining candidate SNP sites by sequencing specific gravity and referencing genome data; step two, competitive allele specific PCR amplification and fluorescent typing are carried out, and SNP molecular markers with clear typing of polymorphism are determined. The polymorphic SNP molecular marker and the primer pair comprise at least one of a first SNP marker to a nineteenth SNP marker. The invention solves the problems of time and labor waste in the screening process of polymorphic SNP molecular markers. The universal polymorphic SNP molecular markers of pandas obtained by the screening method provide 19 effective SNP molecular markers and supplement a pandas SNP molecular marker library.

Description

Screening method of polymorphic SNP molecular markers, polymorphic SNP molecular markers and primer pair

Technical Field

The invention relates to the technical field of SNP molecular markers, in particular to a screening method of polymorphic SNP molecular markers, polymorphic SNP molecular markers and primer pairs.

Background

Single nucleotide polymorphisms (Single Nucleotide Polymorphism, SNPs), which are DNA sequence polymorphisms caused by variation of single nucleotides in the genome of animals and plants, including single base transitions, transversions, insertions and deletions, are new generation molecular markers following microsatellite markers. Compared with microsatellite markers, the SNP has high distribution density, numerous SNP and abundant polymorphism; the mutation rate is low, and the stability and the accuracy are high; the fragment length is not required to be detected, and the polymorphism is determined by detecting the existence or non-existence of the fragment, so that the automatic screening is easy to realize.

SNP markers have the following applications: 1) Can be used for the association research of genes and diseases and positioning target genes of the diseases; 2) Can be used for screening animal and plant breeding key genes, and screening key SNP (single nucleotide polymorphism) with stress resistance, high yield and the like by comparing genetic differences of different phenotypes; 3) Can be used for reckoning the evolution relationship among species and identifying the affine relationship in the species, and has good application potential in the aspects of medicine, agriculture and forestry.

Pandas are rare endangered wild animals protected in the first class of China, and SNP molecular markers related to pandas breeding characters, disease characters and the like are mined, so that the pandas are one of important targets of pandas genetic management work. Although pandas have a large number of SNP sites, only SNP sites which are successfully amplified, typed and polymorphic in a population can be effective SNP molecular markers. Therefore, a simple, convenient, economical and efficient SNP molecular marker development method suitable for pandas is developed, and powerful tools can be provided for genetic analysis and functional verification of important characters of pandas.

In the SNP population verification method, the traditional method is to design primers, determine nucleotide sequences after amplification, and judge by observing a sequencing peak diagram: 1) Whether the sequencing result is clearly available; 2) Whether the SNP is polymorphic; 3) And if the polymorphism is the polymorphism, determining the type of the SNP. Because each individual sequencing result needs to be analyzed one by one, the automation of SNP typing detection is not easy to realize, and the screening of large-scale groups is time-consuming and labor-consuming.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the present invention aims to provide a method for screening high-throughput polymorphic SNP molecular markers, which is used for solving the problem of time and effort consuming in the screening process of polymorphic SNP molecular markers in the prior art, and at the same time, the present invention also provides a general polymorphic SNP molecular marker for pandas; in addition, the invention also provides a primer pair for the polymorphic SNP molecular marker universal for pandas.

To achieve the above-mentioned objects and other related objects,

in a first aspect of the present invention, there is provided a method for screening high-throughput polymorphic SNP molecular markers, comprising the steps of

Step one, obtaining candidate SNP loci by sequencing specific gravity and referencing genome data; wherein, the candidate SNP locus simultaneously satisfies the following conditions: a. the section only comprises 1 SNP locus, and the upstream and downstream of the SNP locus do not have InDel markers and other SNP loci within 100 bp; b. the SNP site exhibits polymorphism in all individuals; c. the SNP mass is more than 1000;

step two, competitive allele specific PCR amplification and fluorescent typing are carried out, and SNP molecular markers with clear typing of polymorphism are determined.

In the first step, the probability of detection of an actual polymorphic SNP marker is increased by controlling the screening conditions (selecting SNPs having a SNP mass of 1000 or more and exhibiting polymorphism in the population). In the second step, by competitive allele-specific PCR amplification and fluorescent typing, whether the SNP locus is an effective SNP molecular marker can be directly judged according to a KASP typing peak diagram. If all the individual typing result graphs show the same color fluorescence, the SNP locus is represented as a single state; if all the individual typing result graphs show two or more kinds of fluorescence, the SNP locus is heterozygous, and the SNP locus is an effective SNP molecular marker. The screening method is visual and clear, can realize the automation of SNP typing detection, and is convenient for the screening and detection of large-scale groups. The screening method not only can be used for SNP molecular marker development of pandas, but also can be used for SNP molecular marker development of other species with known reference genome sequences.

Further, the resequencing is panda whole genome resequencing sequence, and the reference genome is panda reference genome sequence.

The development of a simple, convenient, economical and efficient SNP molecular marker screening method suitable for pandas can provide powerful tools for genetic analysis and functional verification of important characters of pandas.

The effective SNP molecular marker is developed by the screening method of the high-throughput polymorphic SNP molecular marker, and is the basis of researches such as genetic map construction, gene association of key characters, genetic relationship, individual identification and the like of pandas. The screening method is simple, convenient and efficient. Meanwhile, the screening method also provides 19 effective SNP molecular markers, and supplements a panda SNP molecular marker library.

Further, the competitive allele-specific PCR amplification in step two is specifically: competitive allele-specific PCR uses fluorescent probes, combined with touchdown PCR to achieve SNP bi-allele typing.

The competitive allele-specific PCR adopts a universal fluorescent probe and combines Touchdown PCR (Touchdown PCR is Touchdown PCR, which means that every other cycle is reduced by a certain annealing temperature until reaching the "Touchdown" annealing temperature, and then the annealing temperature is used for about 20 cycles) to realize SNP double-allele typing. The above PCR reaction was performed in a water bath PCR in a manner of SNP genotyping outline in a hydrocycle.

The total volume of the PCR amplification system used for the competitive allele-specific PCR amplification is 1.6. Mu.l, and specifically comprises: 0.8. Mu.l of DNA (5-10 ng/. Mu.l), 0.4. Mu.l of 2x KASP Master mix (LGC genemics Ltd) and 0.4. Mu.l of primer mix (Biotechnology Co., ltd., lianghuan).

In a second aspect of the present invention, there is provided a polymorphic SNP molecular marker commonly used in pandas obtained by the above screening method, the polymorphic SNP molecular marker comprising at least one of a first SNP marker, a second SNP marker, a third SNP marker, a fourth SNP marker, a fifth SNP marker, a sixth SNP marker, a seventh SNP marker, an eighth SNP marker, a ninth SNP marker, a tenth SNP marker, an eleventh SNP marker, a twelfth SNP marker, a thirteenth SNP marker, a fourteenth SNP marker, a fifteenth SNP marker, a sixteenth SNP marker, a seventeenth SNP marker, an eighteenth SNP marker, and a nineteenth SNP marker:

the first SNP marker is a base A or G, the SNP marker is positioned at position 101 of a nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO:1, a nucleotide sequence shown in the specification;

the second SNP marker is a base T or C, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:2, a nucleotide sequence shown in the specification;

the third SNP marker is a base T or C, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:3, a nucleotide sequence shown in 3;

the fourth SNP marker is a base C or T, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:4, a nucleotide sequence shown in figure 4;

the fifth SNP marker is a base T or A, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:5, a nucleotide sequence shown in seq id no;

the sixth SNP marker is a base T or C, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:6, a nucleotide sequence shown in the specification;

the seventh SNP marker is a base G or T, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO: 7;

the eighth SNP marker is a base C or T, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:8, a nucleotide sequence shown in figure 1;

the ninth SNP marker is a base G or A, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO: 9;

the tenth SNP marker is a base G or A, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:10, a nucleotide sequence shown in seq id no;

the eleventh SNP marker is a base G or T, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:11, a nucleotide sequence shown in seq id no;

the twelfth SNP marker is a base C or A, the SNP marker is located at position 101 of a nucleic acid having the sequence of SEQ ID NO:12, a nucleotide sequence shown in seq id no;

the thirteenth SNP marker is a base G or T, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:13, a nucleotide sequence shown in seq id no;

the fourteenth SNP marker is a base A or G, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:14, a nucleotide sequence shown in seq id no;

the fifteenth SNP marker is a base G or A, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:15, a nucleotide sequence shown in seq id no;

the sixteenth SNP marker is a base C or T, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:16, a nucleotide sequence shown in seq id no;

the seventeenth SNP marker is a base A or C, the SNP marker is located at position 101 of a nucleic acid having the nucleotide sequence of SEQ ID NO:17, a nucleotide sequence shown in seq id no;

the eighteenth SNP marker is a base A or G, the SNP marker is located at position 101 of a nucleic acid having the sequence of SEQ ID NO:18, a nucleotide sequence shown in seq id no;

the nineteenth SNP marker is a base C or G, the SNP marker is located at position 101 of a nucleic acid having the sequence of SEQ ID NO:19, and a nucleotide sequence shown in seq id no.

The universal polymorphic SNP molecular markers of pandas obtained by the screening method provide 19 effective SNP molecular markers and supplement a pandas SNP molecular marker library. The above 19 effective SNP molecular markers can clearly distinguish homozygotes and heterozygotes from the corresponding typing patterns.

In a third aspect of the present invention, there is provided a primer pair for detecting a polymorphic SNP molecular marker common to pandas, the primer pair comprising at least one of a primer pair corresponding to a first SNP marker, a primer pair corresponding to a second SNP marker, a primer pair corresponding to a third SNP marker, a primer pair corresponding to a fourth SNP marker, a primer pair corresponding to a fifth SNP marker, a primer pair corresponding to a sixth SNP marker, a primer pair corresponding to a seventh SNP marker, a primer pair corresponding to an eighth SNP marker, a primer pair corresponding to a ninth SNP marker, a primer pair corresponding to a tenth SNP marker, a primer pair corresponding to an eleventh SNP marker, a primer pair corresponding to a twelfth SNP marker, a primer pair corresponding to a thirteenth SNP marker, a primer pair corresponding to a fourteenth SNP marker, a primer pair corresponding to a sixteenth SNP marker, a primer pair corresponding to a seventeenth SNP marker, a primer pair corresponding to a eighteenth SNP marker, a primer pair corresponding to a nineteenth SNP marker;

the primer pair corresponding to the first SNP marker comprises a first primer pair and a second primer pair, and the forward primer of the first primer pair is shown as SEQ ID NO:20, and the forward primer of the second primer pair is shown in SEQ ID NO:21, the reverse primers of the first primer pair and the second primer pair are respectively shown in SEQ ID NO: shown at 22;

the primer pair corresponding to the second SNP marker comprises a third primer pair and a fourth primer pair, and the forward primer of the third primer pair is shown as SEQ ID NO:23, the forward primer of the fourth primer pair is shown in SEQ ID NO:24, the reverse primers of the third primer pair and the fourth primer pair are respectively shown in SEQ ID NO: shown at 25;

the primer pair corresponding to the third SNP marker comprises a fifth primer pair and a sixth primer pair, and the forward primer of the fifth primer pair is shown as SEQ ID NO:26, the forward primer of the sixth primer pair is shown in SEQ ID NO:27, the reverse primers of the fifth primer pair and the sixth primer pair are respectively shown in SEQ ID NO: 28;

the primer pair corresponding to the fourth SNP marker comprises a seventh primer pair and an eighth primer pair, and the forward primer of the seventh primer pair is shown as SEQ ID NO:29, the forward primer of the eighth primer pair is shown in SEQ ID NO:30, the reverse primers of the seventh primer pair and the eighth primer pair are respectively shown in SEQ ID NO: 31;

the primer pair corresponding to the fifth SNP marker comprises a ninth primer pair and a tenth primer pair, and the forward primer of the ninth primer pair is shown as SEQ ID NO:32, the forward primer of the tenth primer pair is shown as SEQ ID NO:33, and the reverse primers of the ninth primer pair and the tenth primer pair are respectively shown in SEQ ID NO: shown at 34;

the primer pair corresponding to the sixth SNP marker comprises an eleventh primer pair and a twelfth primer pair, and the forward primer of the eleventh primer pair is shown as SEQ ID NO:35, the forward primer of the twelfth primer pair is shown as SEQ ID NO:36, and the reverse primers of the eleventh primer pair and the twelfth primer pair are respectively shown in SEQ ID NO: shown at 37;

the primer pair corresponding to the seventh SNP marker comprises a thirteenth primer pair and a fourteenth primer pair, wherein the forward primer of the thirteenth primer pair is shown as SEQ ID NO:38, the forward primer of the fourteenth primer pair is set forth in SEQ ID NO:49, the reverse primers of the thirteenth and fourteenth primer pairs are each set forth in SEQ ID NO: shown at 40;

the primer pair corresponding to the eighth SNP marker comprises a fifteenth primer pair and a sixteenth primer pair, and the forward primer of the fifteenth primer pair is shown as SEQ ID NO:41, and the forward primer of the sixteenth primer pair is shown as SEQ ID NO:42, and the reverse primers of the fifteenth primer pair and the sixteenth primer pair are respectively shown in SEQ ID NO: 43.

The primer pair corresponding to the ninth SNP marker comprises a seventeenth primer pair and an eighteenth primer pair, and the forward primer of the seventeenth primer pair is shown as SEQ ID NO:44, the forward primer of the eighteenth primer pair is set forth in SEQ ID NO:45, the reverse primers of the seventeenth primer pair and the eighteenth primer pair are respectively shown in SEQ ID NO: 46;

the primer pair corresponding to the tenth SNP marker comprises a nineteenth primer pair and a twentieth primer pair, and the forward primer of the nineteenth primer pair is shown as SEQ ID NO:47, the forward primer of the twentieth primer pair is set forth in SEQ ID NO:48, and the reverse primers of the nineteenth primer pair and the twentieth primer pair are set forth in SEQ ID NO: shown at 49;

the primer pair corresponding to the eleventh SNP marker comprises a twenty-first primer pair and a twenty-second primer pair, and the forward primer of the twenty-first primer pair is shown as SEQ ID NO:50, and the forward primer of the twenty-second primer pair is set forth in SEQ ID NO:51, and the reverse primers of the twenty-first primer pair and the twenty-second primer pair are each as set forth in SEQ ID NO: 52;

the primer pair corresponding to the twelfth SNP marker comprises a twenty-third primer pair and a twenty-fourth primer pair, and the forward primer of the twenty-third primer pair is shown as SEQ ID NO:53, the forward primer of the twenty-fourth primer pair is set forth in SEQ ID NO:54, and the reverse primers of the twenty-third primer pair and the twenty-fourth primer pair are set forth in SEQ ID NO: indicated at 55;

the primer pair corresponding to the thirteenth SNP marker comprises a twenty-fifth primer pair and a twenty-sixth primer pair, wherein the forward primer of the twenty-fifth primer pair is shown as SEQ ID NO:56, the forward primer of the twenty-sixth primer pair is set forth in SEQ ID NO:57, and the reverse primers of the twenty-fifth primer pair and the twenty-sixth primer pair are each as set forth in SEQ ID NO: indicated at 58;

the primer pair corresponding to the fourteenth SNP marker comprises a twenty-seventh primer pair and a twenty-eighth primer pair, and the forward primer of the twenty-seventh primer pair is shown as SEQ ID NO:59, and the forward primer of the twenty-eighth primer pair is set forth in SEQ ID NO:60, and the reverse primers of the twenty-seventh primer pair and the twenty-eighth primer pair are respectively shown in SEQ ID NO: indicated at 61;

the primer pair corresponding to the fifteenth SNP marker comprises a twenty-ninth primer pair and a thirty-ninth primer pair, and the forward primer of the twenty-ninth primer pair is shown as SEQ ID NO:62, the forward primer of the thirty-first primer pair is set forth in SEQ ID NO:63, and the reverse primers of the twenty-ninth primer pair and the thirty-ninth primer pair are set forth in SEQ ID NO: indicated at 64;

the primer pair corresponding to the sixteenth SNP marker comprises a thirty-first primer pair and a thirty-second primer pair, wherein the forward primer of the thirty-first primer pair is shown as SEQ ID NO:65, the forward primer of the thirty-second primer pair is set forth in SEQ ID NO:66, and the reverse primers of the thirty-first primer pair and the thirty-second primer pair are each set forth in SEQ ID NO: 67;

the primer pair corresponding to the seventeenth SNP marker comprises a thirty-third primer pair and a thirty-fourth primer pair, wherein the forward primer of the thirty-third primer pair is shown as SEQ ID NO:68, the forward primer of the thirty-fourth primer pair is set forth in SEQ ID NO:69, the reverse primers of the thirty-third primer pair and the thirty-fourth primer pair are each set forth in SEQ ID NO: shown at 70;

the primer pair corresponding to the eighteenth SNP marker comprises a thirty-fifth primer pair and a thirty-sixth primer pair, and the forward primer of the thirty-fifth primer pair is shown as SEQ ID NO:71, and the forward primer of the thirty-sixth primer pair is shown in SEQ ID NO:72, and the reverse primers of the thirty-fifth primer pair and the thirty-sixth primer pair are each set forth in SEQ ID NO: shown at 73;

the primer pair corresponding to the nineteenth SNP marker comprises a thirty-seventh primer pair and a thirty-eighth primer pair, and the forward primer of the thirty-seventh primer pair is shown as SEQ ID NO:74, the forward primer of the thirty-eighth primer pair is set forth in SEQ ID NO:75, and the reverse primers of the thirty-seventh primer pair and the thirty-eighth primer pair are each set forth in SEQ ID NO: shown at 76.

Further, each primer pair corresponding to the SNP marker is provided with two forward primers, and the two forward primers respectively correspond to two alleles where the SNP is located.

Further, the forward primers of the first, third, fifth, seventh, ninth, eleventh, thirteenth, fifteenth, seventeenth, nineteenth, twenty first, twenty third, twenty fifth, twenty seventh, twenty ninth, thirty first, thirty third, thirty fifth, thirty seventh primer pairs each have a nucleotide sequence as set forth in SEQ ID NO:77, a specific sequence shown in seq id no;

the second, fourth, sixth, eighth, tenth, twelfth, fourteenth, sixteenth, eighteenth, twentieth, twenty-second, twenty-fourth, twenty-sixth, twenty-eighth, thirty-second, thirty-fourth, thirty-sixth, thirty-eighth, and thirty-eighth primer pairs each have forward primers as set forth in SEQ ID NOs: 78, and a specific sequence shown in seq id no.

Further, the SEQ ID NO:77 with a FAM fluorescent label; the SEQ ID NO:78 with a HEX fluorescent label.

As described above, the screening method of the polymorphic SNP molecular markers, the polymorphic SNP molecular markers and the primer pairs have the following beneficial effects:

1. in the first step, the probability of detection of an actual polymorphic SNP marker is increased by controlling the screening conditions (selecting SNPs having a SNP mass of 1000 or more and exhibiting polymorphism in the population). In the second step, by competitive allele-specific PCR amplification and fluorescent typing, whether the SNP locus is an effective SNP molecular marker can be directly judged according to a KASP typing peak diagram. If all the individual typing result graphs show the same color fluorescence, the SNP locus is represented as a single state; if all the individual typing result graphs show two or more kinds of fluorescence, the SNP locus is heterozygous, and the SNP locus is an effective SNP molecular marker. The screening method is visual and clear, can realize the automation of SNP typing detection, and is convenient for the screening and detection of large-scale groups. The screening method not only can be used for SNP molecular marker development of pandas, but also can be used for SNP molecular marker development of other species with known reference genome sequences.

2. The universal polymorphic SNP molecular markers of pandas obtained by the screening method provide 19 effective SNP molecular markers and supplement a pandas SNP molecular marker library. The above 19 effective SNP molecular markers can clearly distinguish homozygotes and heterozygotes from the corresponding typing patterns.

Drawings

FIG. 1 is a typing map of the first SNP marker in 30 individuals of the panda.

FIG. 2 is a typing map of the second SNP marker in 30 individuals of the panda.

FIG. 3 is a typing map of the third SNP marker in 30 individuals of the panda.

FIG. 4 is a typing map of the fourth SNP marker in 30 individuals of the panda.

FIG. 5 is a typing map of a fifth SNP marker in 30 individuals from the panda.

FIG. 6 is a typing map of a sixth SNP marker in 30 individuals from the panda.

FIG. 7 is a typing map of a seventh SNP marker in 30 individuals of the panda.

FIG. 8 is a typing map of an eighth SNP marker in 30 individuals from the panda.

FIG. 9 is a typing map of a ninth SNP marker in 30 individuals of the panda.

FIG. 10 is a typing map of a tenth SNP marker in 30 individuals of the panda.

FIG. 11 is a typing map of eleventh SNP markers in 30 individuals of the panda.

FIG. 12 is a typing map of twelfth SNP markers in 30 individuals of the panda.

FIG. 13 is a typing map of thirteenth SNP markers in 30 individuals of the panda.

FIG. 14 is a typing map of fourteenth SNP markers in 30 individuals of the panda.

FIG. 15 is a typing map of the fifteenth SNP marker in 30 individuals of the panda.

FIG. 16 is a typing map of sixteenth SNP markers in 30 individuals of the giant panda.

FIG. 17 is a typing map of seventeenth SNP markers in 30 individuals of the panda.

FIG. 18 is a typing map of eighteenth SNP markers in 30 individuals of the panda.

FIG. 19 is a typing map of nineteenth SNP markers in 30 individuals of a panda.

FIG. 20 is a typing map of a haplotype SNP carrying FAM alleles in 30 individuals of pandas.

FIG. 21 is a typing map of a haplotype SNP carrying HEX alleles in 30 individuals of pandas.

Detailed Description

Further advantages and effects of the present invention will become apparent to those skilled in the art from the disclosure of the present invention, which is described by the following specific examples.

Examples

1. Acquisition of candidate SNP loci

37 panda whole genome resequencing sequences (SRR 504857, SRR504866-SRR504872, SRR504873-SRR 504901) and panda reference genome sequences (GCF_000004335.1, ailMel_1.0) were downloaded from NCBI. The resequencing data was aligned to the panda reference genome using BWA 0.7.13. GATK3.8.1 detecting variations in bases, obtaining possible SNP loci, and finding out SNPs that simultaneously meet the following conditions: 1) The segment only comprises 1 SNP locus, and the upstream and downstream of the SNP locus are not provided with InDel markers (InDel markers) and other SNPs within 100 bp; 2) Presenting polymorphisms in all individuals; 3) The SNP quality value (SNP mass) is greater than 1000. 40 SNP sites were randomly selected for testing.

2 sample collection, DNA extraction

30 blood samples were collected from the panda protection centre and stored at-80 ℃. All samples were collected from regular physical examination of pandas. The DNA extraction of blood samples is carried out according to the instruction book of the Axygen blood genome extraction kit, the DNA concentration and quality detection is carried out by a BioDrop uLite nucleic acid microassay, and the concentration is diluted to 5-10 ng/. Mu.l according to the result and stored at-20 ℃ for standby.

3. Primer design

The primer design was performed on 40 SNP sites to be tested using the primer design program in IntelliQube. A Forward primer (also called an upstream primer) precedes the SNP site, and a reverse primer (downstream primer) follows the SNP site. GC content (ratio of guanine and cytosine) > 40%, no hairpin structure can be generated either by the primer itself or between the primer pairs. Two primer pairs are required to be designed for each SNP locus, wherein the two primer pairs respectively correspond to two specific forward primers, and one universal reverse primer is adopted for the two primer pairs. The two forward primers correspond to the two alleles where the SNP is located, and the 5' end has a specific sequence, namely 5' -3' GAAGGTGACCAAGTTCATGC (shown as SEQ ID NO: 77) and 5' -3' GAAGGTCGGAGTCAACGGAT (shown as SEQ ID NO: 78), wherein the former carries FAM fluorescence, and the latter carries HEX fluorescence. The fluorescent primer synthesis was performed by Biotechnology Inc., hangzhou, co.

4. Competitive allele-specific PCR (Kompetitive Allele Specific PCR, KASP) amplification:

s1, PCR reaction Water bath PCR was performed in a manner of SNP genotyping outline in a Hydrocarbon. The total volume of the PCR amplification system was 1.6. Mu.l, including: 0.8. Mu.l of DNA (5-10 ng/. Mu.l), 0.4. Mu.l of 2x KASP Master mix (LGC genemics Ltd) and 0.4. Mu.l of primer mix (Biotechnology Co., ltd., lianghuan).

S2, adopting a universal fluorescent probe for competitive allele specific PCR, and combining with touch-down PCR (touch down PCR means that a certain annealing temperature is reduced every other cycle until the annealing temperature reaches the 'touch down' annealing temperature, and then carrying out about 20 cycles at the annealing temperature) to realize SNP double-allele typing. The procedure is as shown in table 1:

table 1

5. Parting data reading and analysis

After the PCR reaction was completed, fluorescence data were read and analyzed by an IntelliQube machine. Fluorescent FAM: excitation light 485nm and emission light 520nm; fluorescence HEX: excitation light 535nm and emission light 556nm. Fluorescent ROX: excitation light 575nm and emission light 610nm. After the values of FAM and HEX were corrected for ROX dye data, the samples were clustered into different clusters depending on genotype. If the samples are identical at the SNP site tested (AA homozygous or BBhomozygous), then all samples are clustered. If the samples are not identical at the SNP sites tested, all samples are divided into two clusters (AA homozygous and BB homozygous) or three clusters (AA homozygous, BB homozygous and AB heterozygous). Minimal allele frequency MAF was calculated using Cervus 3.03 and heterozygosity H was observed _O Desired heterozygosity H _E Polymorphism information content PIC. Hash equilibrium detection was performed using Genepop 4.7.

6. Screening results

Among 40 pairs of test primers, 31 pairs of primers were excellent in typing, and the typing efficiency was 77.5%. In the case of good primer typing, the number of single-mode SNPs is 12 (12/31=38.7%), and the number of polymorphic SNPs is 19 (19/31=61.3%). The proportion of SNPs of the polymorphism to the total number of SNPs tested was 47.5% (19/40). The nucleotide sequence corresponding to the SNP of the polymorphic site is shown as SEQ ID NO: 1-19, the nucleotide sequence of which shows a specific one of the bi-alleles, the sequence length being 201bp. The SNP types and the corresponding information are shown in Table 2:

table 2

The SNP types and genetic diversity information are shown in Table 3:

TABLE 3

Primer pairs for polymorphic SNP markers are shown in table 4:

table 4

/>

Note that: f represents FAM fluorescence; h represents HEX fluorescence. C represents the universal downstream primer for both alleles.

And directly judging whether the SNP locus is an effective SNP molecular marker according to the KASP typing peak diagram. If all the individual typing result graphs show the same color fluorescence, the SNP locus is represented as a single state, and if all the individual typing result graphs show two or more kinds of fluorescence, the SNP locus is represented as heterozygous, and the SNP locus is an effective SNP molecular marker. From the typing map of the polymorphic SNP molecular markers, homozygotes and heterozygotes can be clearly distinguished from FIGS. 1 to 19.

FIG. 1 is a typing map of the first SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 2 is a typing map of the second SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 3 is a typing map of the third SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 4 is a typing map of the fourth SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 5 is a typing map of a fifth SNP marker in 30 individuals from the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 6 is a typing map of a sixth SNP marker in 30 individuals from the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 7 is a typing map of a seventh SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 8 is a typing map of an eighth SNP marker in 30 individuals from the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 9 is a typing map of a ninth SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 10 is a typing map of a tenth SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 11 is a typing map of eleventh SNP markers in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 12 is a typing map of twelfth SNP markers in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 13 is a typing map of thirteenth SNP markers in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 14 is a typing map of fourteenth SNP markers in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 15 is a typing map of the fifteenth SNP marker in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 16 is a typing map of sixteenth SNP markers in 30 individuals of the giant panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 17 is a typing map of seventeenth SNP markers in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 18 is a typing map of eighteenth SNP markers in 30 individuals of the panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

FIG. 19 is a typing map of nineteenth SNP markers in 30 individuals of a panda. Homozygous and heterozygous individuals (fam+hex) carrying different alleles (FAM or HEX).

In conclusion, the invention develops effective SNP molecular markers through a screening method, and provides a research basis for researches such as genetic map construction of pandas, gene association of key characters, genetic relationship, individual identification and the like. The invention provides a simple, convenient and efficient screening method. The invention also provides 19 effective SNP molecular markers, and supplements a panda SNP molecular marker library. Therefore, the invention effectively overcomes various defects in the prior art and has high industrial utilization value.

The above embodiments are merely illustrative of the principles of the present invention and its effectiveness, and are not intended to limit the invention. Modifications and variations may be made to the above-described embodiments by those skilled in the art without departing from the spirit and scope of the invention. Accordingly, it is intended that all equivalent modifications and variations of the invention be covered by the claims, which are within the ordinary skill of the art, be within the spirit and scope of the present disclosure.

SEQUENCE LISTING

<110> Emei mountain biological resource experiment station, institute of natural resource science, sichuan province

<120> screening method of polymorphic SNP molecular markers, and primer set

<130> 2020.07.07

<160> 78

<170> PatentIn version 3.3

<210> 1

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 1

agaaggtact ttggttcttc tggtaagatt tcctccttca ggatgcagtc accattgaca 60

gaagccaaca tctgcgtcta aaacacagaa ccattctaac ctggtgagtg tgcttcataa 120

gaccgaggca aggcctttgg gagaagagct tggccaaggg agaaaatctg attaaagaag 180

ataagcagcc aagaaataaa t 201

<210> 2

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 2

agacagtac ctcattcctt tgcatagctg aacaatactc cattatatgg gtataccaca 60

ttttgttcat actctcaaca accaatggac atttgggtcg gtttcccctt tttggctatt 120

atgaataacc ctgctggatt attcatggat aagattttat gtggacataa gttttcattt 180

atctcttgtt tatacctagg a 201

<210> 3

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 3

cttttgtagt atttttgaga ggaactagta tggaagagtt cgagcaaaaa taccattttg 60

gtcatataat tttttatcct catcttttat ttgatccttg ggtgaaacac taaacctact 120

tttgttattg aagtgggttt tttttttatt attttcacat tgtttcttgc caaattaatt 180

attttctttc tcattagatc a 201

<210> 4

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 4

catgatcact ttacccattt tgtaaaatgt cacaattaga ttaaacagtt ctaggcttca 60

ctgttgaaaa cagaaataag tgaaacaagt attcataaca ataagaaatg caacaggttt 120

tgattaaaat aatatccagg taatgcacta tataatctta acctttgcga acaatattac 180

agaacatgac tcctatataa g 201

<210> 5

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 5

cacagtgaga taccacttca catactagaa tggctaaaat aaaaaagtat ataattaaag 60

tgttggtgag ggtgtggaga aattagaacc aatcctcatt tcattgatag taggaatgtg 120

aagcagtttt gatgctttgg aaaacagttt gatagttcct caaaatgtta aatatagagt 180

tagcatatga ccagctggtc c 201

<210> 6

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 6

agggacgggg cgcgcacgcg cggtcttgtc cagaacagcg agcttgcgct ggtttttgaa 60

tgttaaacca gctttacatc tttggaataa actcaacacg gtgatctatt ctttcacgga 120

tattttatgt ttatgtttct gagggacatt ggcctgtacg ctttctttct catgatggcc 180

attgtcaagt ttcaggacca c 201

<210> 7

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 7

agacaaccaa caggaacaac tcagctgtcc tcttgtggcg caaatgggga gagtctccta 60

accacagagc cccatgattt gtattttcct ggggtagaga atccccatcc ctctctgctc 120

tctcgccagg cacctcttct atccctgaca ccccctagat ggcctaattc cctttcccca 180

cgaagctcta tccctccacc a 201

<210> 8

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 8

atggaccgtt atcggtgatt ttggtgactg ctcagaaaga agaaaaggag agctttgaga 60

aagcctaagt cttcttaaag aatacctaaa taattctgaa acaggaggtt ggtagaaatg 120

tggatggtaa aggccattct gataaggtct cagatggaaa tgaggtatat gttactgaaa 180

gttggtggaa ggaccttcct t 201

<210> 9

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 9

tgtataagca tatttccttc agcattgttt gtagttgaaa atagtgggaa attaaatgaa 60

tgtccctcat tcatacactc atttatttat tcccttgttt tgttcattaa ttggcccatt 120

gaatgctagg cactgttctc ggtgctgggg atgcattggt gaataaaaca cagcttccat 180

ggtggagttc acattctaga a 201

<210> 10

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 10

ctcctctaca tgctaactgc tcccctttac cacattagct tttggctact tcacctaaag 60

caactaagta agtccacaga agcttcccag ttgctgacat tattctgtaa tttcacagac 120

ttctttggca acccacccta ccagttttta tacttctttt caattagaga caaccagtta 180

tttagtaaca actgaatgaa a 201

<210> 11

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 11

ctgcctcttc ttccttcttc caggaaatga gtaaagatct gtaaaaggga ccactgagct 60

ctgatgcttt tagtactgct ttcagaagat gcgttccata atggagagag tgctatggcc 120

ctacacccac tgttcatcct ctctccgagc ccagagtgcc aaagagaagt gagcagtaga 180

ttgggattct taaattctag g 201

<210> 12

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 12

aagcagccat agacattagg taaagcagta gacacagctg ggaaaacagg gagagggcag 60

gattctgtcc tcgggcttag tctactgacc cctcatctgt tagtatccct gggatactgg 120

aacaccagct gggattactg atgtgggcaa gaggccaaga agaggatcgt ttagtctcta 180

tccttaaggt aataactctc t 201

<210> 13

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 13

tgtattttgg acattaactc cttaccagat gtatggttta caaacatttt ctcccattcc 60

ataggttgtc tctttactgt gctgaatgct tcctttgctg gtgtagaagc ttattagttt 120

gatgcaatct catttgtcta tttttgctca ttgcctgtac tcttgggttc atttccaaaa 180

aaaatcattg ccctgaccaa t 201

<210> 14

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 14

atactcctgt ttcttggaaa agtctttgtg agaactcttt aagacctgga tttaaagagt 60

ctgcattttt ctatccattc tatccaggaa cactgccaac cccaggacca cattaaggta 120

aatttttagt ttgggcattt tgagccatat acagagtatc aattctgacc ctaaactcag 180

gctgacagct accctgaggt t 201

<210> 15

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 15

tattcattaa atacatataa tatcacttgg cctcaatatg gccctaagag atataggtca 60

ggattataat ccccatttta taatgaagaa aatgaggctt ttaagagctt ttgtgatttg 120

cacaaactca ttacagacag ttaatgaaag agctgggatt aaaagtggtc ctagaaacca 180

agggagatag aattttaaca a 201

<210> 16

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 16

tttgttgatg tggtgtatca cacttaccaa tttgtggatg ttgaaccatc ctttcatcct 60

tggaatgaat ctcatatgat catggtatat gattctttta aatgtattgt tgaattcagc 120

ttgcagatat tttgttgaag atttttgcac ctatgttcat cagggttatt ggcctgcaat 180

tttttttctt gtgttgtctt t 201

<210> 17

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 17

aagctctttt ctctcacaac aatattgatg tatctttgag ggcatggtat caagaaaagc 60

tttgagatct ataagaaaaa tcctatcttt tatcaagtgg ggataaatag gtaaagtggg 120

aaattagcca acctaccaat gtttagtaag tcataggata tagtaagaaa tgtatattca 180

ctgtatgtcc ctgtttcatt a 201

<210> 18

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 18

tggagtgcca aggggccaat gccttctaga ctgtgagcgc ctgaagctct tccttctctt 60

gcttcaatca tctcctgatg tttggagctc atctaagttc cccagacctc gttcagaaaa 120

gttaagttta tttctaggta tttcattatt tttggtgcag ttgtaagtgg gattgtttgt 180

taatttctct ttctgctgct t 201

<210> 19

<211> 201

<212> DNA

<213> pandas (Ailuropoda melanoleuca)

<400> 19

tacaaactgg ttccttctga ggggcccttt gtggccttgg tcttgatgtt aatgccagga 60

tttaacttct gagtctagtg agttactgca tcacagcggc cccagggcac atcctgctgt 120

ctgcccacac tgtctaaata tgaccagcgt ctacaccaat ggggctcctt tgggtcacca 180

tgcctgaatc acgagtgacc c 201

<210> 20

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

gaaggtgacc aagttcatgc tcggtcttat gaagcacact caccaa 46

<210> 21

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

gaaggtcgga gtcaacggat tcggtcttat gaagcacact caccag 46

<210> 22

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

tttcctcctt caggatgcag tc 22

<210> 23

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

gaaggtgacc aagttcatgc tatagccaaa aaggggaaat 40

<210> 24

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

gaaggtcgga gtcaacggat tatagccaaa aaggggaaac 40

<210> 25

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

gctgaacaat actccattat atggg 25

<210> 26

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

gaaggtgacc aagttcatgc tgtaggttta gtgtttcact 40

<210> 27

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

gaaggtcgga gtcaacggat tgtaggttta gtgtttcacc 40

<210> 28

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 28

agtatggaag agttcgagca aa 22

<210> 29

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 29

gaaggtgacc aagttcatgc tcaaaacctg ttgcatttct tac 43

<210> 30

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 30

gaaggtcgga gtcaacggat tcaaaacctg ttgcatttct tat 43

<210> 31

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 31

taaaatgtca caattagatt aaacagttc 29

<210> 32

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 32

gaaggtgacc aagttcatgc tgcttcacat tcctactatc aatgt 45

<210> 33

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 33

gaaggtcgga gtcaacggat tgcttcacat tcctactatc aatga 45

<210> 34

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 34

ggtgagggtg tggagaaatt ag 22

<210> 35

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 35

gaaggtgacc aagttcatgc tccgtgaaag aatagatcat 40

<210> 36

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 36

gaaggtcgga gtcaacggat tccgtgaaag aatagatcac 40

<210> 37

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 37

gcgagcttgc gctggttttt ga 22

<210> 38

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 38

gaaggtgacc aagttcatgc tagagagcag agagggatgg ggag 44

<210> 39

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 39

gaaggtcgga gtcaacggat tagagagcag agagggatgg ggat 44

<210> 40

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 40

gctgtcctct tgtggcgcaa at 22

<210> 41

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 41

gaaggtgacc aagttcatgc tccacatttc taccaacctc ctgc 44

<210> 42

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 42

gaaggtcgga gtcaacggat tccacatttc taccaacctc ctgt 44

<210> 43

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 43

tcagaaagaa gaaaaggaga gc 22

<210> 44

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 44

gaaggtgacc aagttcatgc tcaatgggcc aattaatgaa cg 42

<210> 45

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 45

gaaggtcgga gtcaacggat tcaatgggcc aattaatgaa ca 42

<210> 46

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 46

gtccctcatt catacactca tt 22

<210> 47

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 47

gaaggtgacc aagttcatgc tgaagtctgt gaaattacag aatg 44

<210> 48

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 48

gaaggtcgga gtcaacggat tgaagtctgt gaaattacag aata 44

<210> 49

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 49

ttggctactt cacctaaagc aactaa 26

<210> 50

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 50

gaaggtgacc aagttcatgc ttgtagggcc atagcactct ctccag 46

<210> 51

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 51

gaaggtcgga gtcaacggat ttgtagggcc atagcactct ctccat 46

<210> 52

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 52

gatgctttta gtactgcttt cag 23

<210> 53

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 53

gaaggtgacc aagttcatgc tgtgttccag tatcccaggg atactc 46

<210> 54

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 54

gaaggtcgga gtcaacggat tgtgttccag tatcccaggg atacta 46

<210> 55

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 55

ttctgtcctc gggcttagtc ta 22

<210> 56

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 56

gaaggtgacc aagttcatgc tgcatcaaac taataagctt ctacag 46

<210> 57

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 57

gaaggtcgga gtcaacggat tgcatcaaac taataagctt ctacac 46

<210> 58

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 58

ccataggttg tctctttact gtgc 24

<210> 59

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 59

gaaggtgacc aagttcatgc taccttaatg tggtcctgga 40

<210> 60

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 60

gaaggtcgga gtcaacggat taccttaatg tggtcctggg 40

<210> 61

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 61

aaagagtctg catttttcta tc 22

<210> 62

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 62

gaaggtgacc aagttcatgc tgtgcaaatc acaaaagctc ttag 44

<210> 63

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 63

gaaggtcgga gtcaacggat tgtgcaaatc acaaaagctc ttaa 44

<210> 64

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 64

gcctcaatat ggccctaaga ga 22

<210> 65

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 65

gaaggtgacc aagttcatgc tgcaagctga attcaacaat acatc 45

<210> 66

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 66

gaaggtcgga gtcaacggat tgcaagctga attcaacaat acatt 45

<210> 67

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 67

atccttggaa tgaatctcat atg 23

<210> 68

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 68

gaaggtgacc aagttcatgc tcccacttta cctatttatc a 41

<210> 69

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 69

gaaggtcgga gtcaacggat tcccacttta cctatttatc c 41

<210> 70

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 70

tcaagaaaag ctttgagatc ta 22

<210> 71

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 71

gaaggtgacc aagttcatgc tcttttctga acgaggtctg ga 42

<210> 72

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 72

gaaggtcgga gtcaacggat tcttttctga acgaggtctg gg 42

<210> 73

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 73

tctcttgctt caatcatctc ctg 23

<210> 74

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 74

gaaggtgacc aagttcatgc tagacagcag gatgtgccct ggc 43

<210> 75

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 75

gaaggtcgga gtcaacggat tagacagcag gatgtgccct ggg 43

<210> 76

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 76

gatttaactt ctgagtctag tgag 24

<210> 77

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 77

gaaggtgacc aagttcatgc 20

<210> 78

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 78

gaaggtcgga gtcaacggat 20

Claims

1. A primer pair for detecting a polymorphic SNP molecular marker common to pandas, characterized in that the primer pair comprises at least one of a primer pair corresponding to a first SNP marker, a primer pair of a second SNP marker, a primer pair of a third SNP marker, a primer pair of a fourth SNP marker, a primer pair of a fifth SNP marker, a primer pair of a sixth SNP marker, a primer pair of a seventh SNP marker, a primer pair of an eighth SNP marker, a primer pair of a ninth SNP marker, a primer pair of a tenth SNP marker, a primer pair of an eleventh SNP marker, a primer pair of a twelfth SNP marker, a primer pair of a thirteenth SNP marker, a primer pair of a fourteenth SNP marker, a primer pair of a sixteenth SNP marker, a primer pair of a seventeenth SNP marker, a primer pair of an eighteenth SNP marker, a primer pair of a nineteenth SNP marker;