CN111671895A

CN111671895A - Application of anti-PfHMGB 1 antibody in anti-algal toxin reagent and anti-algal toxin reagent

Info

Publication number: CN111671895A
Application number: CN202010490100.2A
Authority: CN
Inventors: 王赟; 柯飞; 谢朝晖; 肖晓雪; 时佳乐
Original assignee: Jianghan University
Current assignee: Jianghan University
Priority date: 2020-06-02
Filing date: 2020-06-02
Publication date: 2020-09-18
Anticipated expiration: 2040-06-02
Also published as: CN111671895B

Abstract

The invention relates to application of an anti-pelteobagrus fulvidraco PfHMGB1 antibody in preparation of a reagent for relieving the invasion of pelteobagrus fulvidraco or isolated pelteobagrus fulvidraco cells by algal toxins, and also relates to a reagent containing the antibody, and a method for relieving the invasion of the isolated pelteobagrus fulvidraco cells by the algal toxins, wherein the method comprises the step of adding the anti-pelteobagrus fulvidraco PfHMGB1 antibody into a culture environment of the isolated pelteobagrus fulvidraco cells. The invention prepares the anti-pelteobagrus fulvidraco PfHMGB1 antibody, and in vitro cell experiments and in vivo experiments prove that the antibody can relieve the invasion of the pelteobagrus fulvidraco by algal toxins and can also relieve the invasion of the in vitro cells of the pelteobagrus fulvidraco by the algal toxins. Therefore, the antibody can be used for preventing or treating the pelteobagrus fulvidraco from being invaded by the algae toxin, and can also be used for treating the isolated cells of the pelteobagrus fulvidraco to prevent or reduce the invasion of the isolated cells of the pelteobagrus fulvidraco by the algae toxin.

Description

Application of anti-PfHMGB 1 antibody in anti-algal toxin reagent and anti-algal toxin reagent

Technical Field

The invention relates to the field of water ecology, in particular to application of an anti-pelteobagrus fulvidraco PfHMGB1 antibody in preparation of a reagent for reducing invasion of pelteobagrus fulvidraco or isolated pelteobagrus fulvidraco cells by algal toxins, and also relates to a reagent containing the antibody, and a method for reducing invasion of the isolated pelteobagrus fulvidraco cells by the algal toxins.

Background

Blue algae bloom is one of the most important fresh water ecological problems at present, and the microcystis is a common blue algae bloom. The Microcystins (MC) are generated after the Microcystins are cracked in water, so that fresh water resources are polluted, and the water safety of residents, industry and agriculture and the development of agriculture, animal husbandry and fishery are seriously influenced. MC is a class of cyclic heptapeptide hepatotoxins with the structure cyclo (-D-Ala-X-D-MeAsp-Z-Adda-D-Glu-Mdha), where X and Z are variable amino acids. Over 100 isomers have been found, of which MC-LR has the strongest acute and chronic toxicity and the greatest harm.

Prolonged exposure to or consumption of MC-LR contaminated water can cause damage to various target organs such as liver, kidneys, heart, reproductive organs, respiratory and circulatory systems, etc. in humans, livestock and wildlife. Fisheries are most susceptible to microcystins because of their direct correlation with water ecology.

The pelteobagrus fulvidraco belongs to the class of fin-fish, catfish, family of bagrus and genus of pelteobagrus, and is one of the current major economic fish species due to high yield, tender meat quality, delicious taste, less bones and much fat. Like the culture of other freshwater fishes, the culture of the pelteobagrus fulvidraco is also easily influenced by microcystins. Therefore, there is a need for an agent that can prevent or treat the invasion of microcystins.

Disclosure of Invention

In order to solve the problems, intensive research is carried out on the pathogenic mechanism of algal toxin MC-LR in pelteobagrus fulvidraco, the mRNA level and the protein level of the HMGB1(High mobility Group Box 1) gene show significant difference in some organs or tissues compared with healthy pelteobagrus fulvidraco after the pelteobagrus fulvidraco is invaded by the algal toxin, and the invasion of the algal toxin received by the pelteobagrus fulvidraco or the in vitro cell thereof is greatly reduced after the anti-HMGB 1 antibody is applied to the pelteobagrus fulvidraco or the in vitro cell thereof.

Based on the research, the invention provides application of an anti-pelteobagrus fulvidraco PfHMGB1 antibody in preparation of a reagent for relieving the cell invasion of pelteobagrus fulvidraco or in-vitro pelteobagrus fulvidraco by algal toxins.

In a specific embodiment, the amino acid sequence of PfHMGB1 is set forth in SEQ ID NO 2.

In a specific embodiment, the isolated pelteobagrus fulvidraco cell is a hepatocyte.

In a specific embodiment, the algal toxin is a microcystin.

In a specific embodiment, the algal toxin is MC-LR.

The invention also provides a reagent for relieving the cell invasion of the pelteobagrus fulvidraco or the isolated pelteobagrus fulvidraco by algal toxins, which comprises an anti-pelteobagrus fulvidraco PfHMGB1 antibody.

The invention also provides a method for reducing the invasion of the isolated pelteobagrus fulvidraco cells by algal toxins, which comprises the step of adding an anti-pelteobagrus fulvidraco PfHMGB1 antibody into the culture environment of the isolated pelteobagrus fulvidraco cells.

The invention prepares the anti-pelteobagrus fulvidraco PfHMGB1 antibody, and in vitro cell experiments and in vivo experiments prove that the antibody can relieve the invasion of the pelteobagrus fulvidraco by algal toxins and can also relieve the invasion of the in vitro cells of the pelteobagrus fulvidraco by the algal toxins. Therefore, the antibody can be used for preventing or treating the pelteobagrus fulvidraco from being invaded by the algae toxin, and can also be used for treating the isolated cells of the pelteobagrus fulvidraco to prevent or reduce the invasion of the isolated cells of the pelteobagrus fulvidraco by the algae toxin.

Drawings

FIG. 1 is a statistical chart of the relative level of PfHMGB1 gene mRNA in the 11 middle tissues of healthy pelteobagrus fulvidraco, leveled by taking 18S rRNA as a housekeeping gene;

fig. 2 is a statistical graph of the relative levels of PfHMGB1 gene mRNA in the liver of pelteobagrus fulvidraco injected with 200 μ L PBS or PBS containing MC-LR, P <0.05, P <0.01, and leveled with 18S rRNA as a housekeeping gene;

FIG. 3 is a photograph of SDS-PAGE electrophoresis of rPfHMGB1 protein expressed by E.coli after purification and desalting;

FIG. 4 is an immunoblot photograph of detecting the level of PfHMGB1 protein in the liver of Pelteobagrus fulvidraco injected with PBS, MC-LR or MC-LR + anti-PfHMGB 1 antibody using anti-PfHMGB 1 antibody, leveled with beta-actin as an internal standard;

FIG. 5 is an immunoblot photograph of the use of anti-PfHMGB 1 antibody to detect the level of PfHMGB1 protein in the peripheral blood of Pelteobagrus fulvidraco injected with PBS, MC-LR or MC-LR + anti-PfHMGB 1 antibody, leveled with total protein as internal standard;

fig. 6 is a statistical graph of the viability of primary pelteobagrus fulvidraco hepatocytes incubated with PBS, MC-LR at different concentrations, or MC-LR + anti-PfHMGB 1 antibody at different concentrations for 24h, where P <0.05 and P < 0.01;

FIG. 7 is an electron micrograph of liver sections of Pelteobagrus fulvidraco injected with PBS, MC-LR or MC-LR + anti-PfHMGB 1 antibody;

FIG. 8 is a statistical graph of AST and ALT of Pelteobagrus fulvidraco injected with PBS, MC-LR or MC-LR + anti-PfHMGB 1 antibodies.

Detailed Description

The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.

1. Domestication of pelteobagrus fulvidraco

Catching pelteobagrus fulvidraco juvenile fish with the weight of about 25g from the flat-topped flat west lake, and domesticating the pelteobagrus fulvidraco juvenile fish in a laboratory for at least 10 days. Culturing Pelteobagrus fulvidraco in a 300L aerated aquarium, maintaining the ambient temperature of 28 deg.C, and feeding once a day. The water in the aquarium was changed in half every 12 hours.

2. cloning and analysis of cDNA

Sequencing the Pelteobagrus fulvidraco kidney cDNA library constructed by the experiment to obtain a 5' terminal cDNA sequence of the PfHMGB1 gene. The 3 'terminal sequence was obtained by 3' -RACE. The nucleic acid sequence of the obtained pelteobagrus fulvidraco PfHMGB1 gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2.

3. Expression distribution of PfHMGB1 gene in different tissues

Healthy pseudobagrus fulvidraco was anesthetized with tricaine mesylate to harvest tissue, 11 tissues including body kidney, intestine, blood, spleen, muscle, skin, liver, head kidney, fin, gill and heart were harvested. Total RNA was extracted using Trizol, reverse-transcribed into cDNA using PrimeScriptRT kit, and then the expression of PfHMGB1 was detected using 18S rRNA as internal standard and primers as shown in Table 1.

TABLE 1 primers used for qPCR reactions

Primer and method for producing the same	Sequence of	Serial number
			qHMGB1-F	ggattgtctattggtgatgtggcta	SEQ ID NO:3
qHMGB1-R	atcatctgctttgtctggtttggt	SEQ ID NO:4
			q18S-F	ggacacggaaaggattgacaga	SEQ ID NO:5
q18S-R	gttcgctatcggaattaaccaga	SEQ ID NO:6

SYBR Premix Ex-Taq was added to the reaction system, and PCR was performed on an ECO real-time PCR system (Illumina, USA) with relative fold calculated as 2- Δ CT.

The qPCR result is shown in figure 1, and in healthy pelteobagrus fulvidraco, the expression level of the PfHMGB1 gene in heart, muscle and liver is high.

4. PfHMGB1 gene mRNA level in pelteobagrus fulvidraco liver before and after MC-LR stimulation

200 mu L of PBS solution containing MC-LR (50 mu g/kg) is injected into the pelteobagrus fulvidraco in an abdominal cavity, the liver is collected after 24h, total RNA is extracted for quantitatively detecting the expression quantity of the PfHMGB1 gene, and the pelteobagrus fulvidraco injected with the PBS solution is used as a reference. The result is shown in fig. 2, the expression level of the PfHMGB1 gene in the liver of the pelteobagrus fulvidraco injected with MC-LR is about 2 times that of the pelteobagrus fulvidraco injected with PBS, and the expression level is significant.

5. Protein expression purification and polyclonal antibody preparation

The ORF of the amplified PfHMGB1 gene is connected to pMD18-T, and after the sequencing is correct, the amplified ORF is inserted into a pET-28a vector to obtain an expression plasmid PfHMGB1, and the expression plasmid is transferred into E.coli BL21(DE 3). The transformant was cultured in LB medium at 37 ℃ to OD₆₀₀PfHMGB1 protein (rPfHMGB1) was then expressed under induction with 0.4mM IPTG at 28 ℃. Total protein was extracted, purified using a nickel column and desalted by dialysis against PBS. The desalted protein was slowly mixed with a high-performance endotoxin affinity chromatography resin FF to remove endotoxin, and endotoxin was detected by limulus reagent to confirm that the protein was free of endotoxin. Finally, quantification was performed using the Bradford protein assay kit. The SDS-PAGE electrophorogram after purification and desalting is shown in FIG. 3, and the band is in the vicinity of 25kDa and conforms to the predicted rPfHMGB1 size.

To prepare polyclonal antibodies, 100. mu.L of rPfHMGB1 protein (1. mu.g/. mu.L) was mixed in equal volumes with Freund's complete adjuvant, and then 5 BALA/c female mice were injected subcutaneously. 4 boosters were then administered, each with 100. mu.L of rPfHMGB1 protein (1. mu.g/. mu.l) mixed in equal volumes with Freund's incomplete adjuvant once a week. After 10 days of the last immunization, mouse sera were collected and cryopreserved at-80 ℃.

6. Protein levels of PfHMGB1 in liver and peripheral blood of pelteobagrus fulvidraco before and after MC-LR stimulation

Collecting fish liver, adding into high efficiency RIPA lysate containing protease inhibitor PMSF, and pulping into homogenate. The amount of total protein was determined using the BCA kit. PfHMGB1 protein levels detected by Western blotting using PfHMGB1 antibody were then used. Beta-actin was used as an internal standard and was detected using murine anti-beta-actin antibody and goat anti-mouse IgG.

Meanwhile, PfHMGB1 protein was also detected in peripheral blood plasma. Plasma was diluted 10-fold with PBS for electrophoresis. Since β -actin could not be detected in the diluted plasma, we used the BCA kit to quantify the total protein amount of plasma and verified by SDS-PAGE. PfHMGB1 protein levels were then detected by Western blotting.

As a result, as shown in fig. 4 and 5, when MC-LR was used for stimulation, the levels of PfHMGB1 protein were significantly increased in both liver and peripheral blood, and if an anti-PfHMGB 1 antibody was contained in the MC-LR solution used, the levels of PfHMGB1 protein in liver and peripheral blood were significantly decreased, and thus it was found that the prepared antibody could neutralize the PfHMGB1 protein in vivo.

7. Separation of primary hepatocytes of pelteobagrus fulvidraco

Collecting liver from Pelteobagrus fulvidraco and separating primary hepatocytes. Firstly, soaking 12 anesthetized pelteobagrus fulvidraco into 75% alcohol, and then cutting off gill arches to exsanguinate the pelteobagrus fulvidraco; then, the liver was harvested, washed twice with pre-chilled PBS (pH 7.4) containing 100U/mL ampicillin and 100U/mL streptomycin, cut into pieces as small as possible, and digested with fresh digestion buffer (0.25% trypsin + 0.02% EDTA) on a shaker at room temperature for 25 min; the digestion system was stopped with L-15 medium containing 5% FBS. Hepatocytes were collected every 5 min. The hepatocytes collected for the first time are poor in uniformity and are discarded without use. Other cell samples were screened through a 200 mesh screen and then treated with red blood cell digest to remove red blood cells. Finally, the cells were washed twice with L-15 medium and separated by low speed centrifugation (100g, 5min) to obtain hepatocytes. Hepatocytes were cultured in L-15 medium supplemented with 5% FBS, 10U/mL ampicillin, and 10U/mL streptomycin. Trypan Blue (Trypan Blue) exclusion assay showed that 99% of the cells were viable and the primary hepatocytes obtained were available for subsequent experiments.

8. Cytotoxicity test

isolation of Primary hepatocytes (100. mu.L) at 4X 10⁵Density seeding of cells/mLIn 96-well plates, in a wet box at 28 degrees C stationary 24 h. Different concentrations of MC-LR, anti-PfHMGB 1 antibody (1:100) with or without anti-PfHMGB 1 antibody were then added separately and incubated for 24 h. The cells were separated, incubated with 10. mu.L of CCK-8 for 3h, and the absorbance at 450nm was measured using a microplate reader.

As shown in FIG. 6, the use of 30 and 50 μ M MC-LR significantly affected the viability of the hepatocytes, especially in the 50 μ M concentration treated group, which was only about 1/3 of that of the PBS treated group, and the toxicity of MC-LR to hepatocytes was greatly reduced if the anti-PfHMGB 1 antibody was added in the incubation environment.

9. Histopathological experiments

Healthy Pelteobagrus fulvidraco is injected with 200 μ L PBS and MC-LR (50 μ g/kg) with or without anti-PfHMGB 1(1 μ L) antibody into the abdominal cavity respectively. The liver was harvested 24h later, immediately placed in Bouin fixative and fixed for 24 h. Trimming tissue block to 3-5mm³After the treatment, the specimen was cut into a section having a thickness of about 5 μm, HE-stained, and the micrograph was observed.

The results are shown in FIG. 7, where the MC-LR treated group had severe liver cavitation, swelling of nuclei, or shrinkage, chromatin condensation, and destruction of mitochondrial structure. The liver tissues in the MC-LR + anti-PfHMGB 1 treated group are ordered, and the morphology of the liver cells is basically normal. Therefore, the PfHMGB resistant 1 can counteract the effect of MC-LR and prevent cells from being invaded by the algal toxin.

10. AST/ALT analysis

The treated pelteobagrus fulvidraco is used for extracting peripheral blood by using a 1ml syringe and is used for AST/ALT analysis. Adding plasma into 96-well plate containing 20 μ L GPT matrix solution or GOT matrix solution, incubating at 37 deg.C for 30min, incubating with 2 '-4' -dinitrophenylhydrazine at 37 deg.C for 30min, adding 0.4M NaOH, mixing, standing for 15min, and measuring absorbance at 510 nm.

As shown in fig. 8, the glutamic-oxaloacetic transaminase concentration of the pelteobagrus fulvidraco treated by MC-LR was increased by about 3 times, the glutamic-pyruvic transaminase concentration was greatly increased by more than 10 times, and the pelteobagrus fulvidraco co-treated by the anti-PfHMGB 1 antibody and MC-LR also had a higher AST and ALT, but was greatly reduced compared with the pelteobagrus fulvidraco treated by MC-LR.

The experiments show that the phycotoxin can generate serious toxicity to in vitro liver cells and in vivo liver tissues. However, when the environment contains anti-PfHMGB 1 antibodies, the toxicity of the algal toxin to both ex vivo hepatocytes and in vivo hepatic tissue is greatly reduced. Therefore, the anti-PfHMGB 1 antibody has a great inhibiting effect on the cytotoxicity of the in vitro liver cells of the pelteobagrus fulvidraco with the algae toxin and the tissue toxicity of the liver, and can be used for preventing the toxicity of the algae toxin in the environment to the pelteobagrus fulvidraco or the in vitro liver cells of the pelteobagrus fulvidraco.

It should be noted that although the example herein uses a polyclonal antibody of murine anti-pelteobagrus fulvidraco PfHMGB1, after finishing the disclosure herein, those skilled in the art may substitute the polyclonal antibody or monoclonal antibody of other species, as long as the antibody can specifically bind to the pelteobagrus fulvidraco PfHMGB1 protein. Thus, the methods, primers, antibodies recited in the specific examples herein are for illustrative purposes only and are not intended to be limiting.

The present invention is not limited to the above-described preferred embodiments, but rather, the present invention is intended to cover all modifications, equivalents, improvements, and equivalents included within the spirit and scope of the present invention.

Sequence listing

<110> university of Jianghan

<120> application of anti-PfHMGB 1 antibody in anti-algal toxin reagent and anti-algal toxin reagent

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>203

<212>PRT

<213> Pelteobagrus fulvidraco (Pelteobagrus fulvidraco)

<400>1

Met Gly Lys Asp Pro Thr Lys Pro Arg Gly Lys Met Ser Ser Tyr Ala

1 5 10 15

Tyr Phe Val Gln Thr Cys Arg Glu Glu His Lys Lys Lys His Pro Asp

20 25 30

Thr Ser Val Asn Phe Ser Glu Phe Ser Lys Lys Cys Ser Glu Arg Trp

35 40 45

Lys Thr Met Ser Ala Lys Glu Lys Gly Lys Phe Gly Asp Met Ala Arg

50 55 60

Leu Asp Lys Ala Arg Tyr Glu Arg Glu Met Lys Asn Tyr Val Pro Pro

6570 75 80

Arg Gly Glu Lys Lys Lys Arg Phe Lys Asp Pro Asn Ala Pro Lys Arg

85 90 95

Pro Pro Ser Ala Phe Phe Ile Phe Cys Ala Glu Tyr Arg Pro Lys Val

100 105 110

Lys Glu Glu Thr Pro Gly Leu Ser Ile Gly Asp Val Ala Lys Lys Leu

115 120 125

Gly Glu Met Trp Asn Lys Thr Ser Ala Glu Glu Lys Gln Pro Tyr Glu

130 135 140

Lys Lys Ala Ala Lys Leu Lys Glu Lys Tyr Glu Lys Asp Ile Ala Ala

145 150 155 160

Tyr Arg Lys Gly Lys Val Val Gly Gly Ala Ala Lys Ala Pro Thr Lys

165 170 175

Pro Asp Lys Ala Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp

180 185 190

Asp Asp Asp Asp Asp Glu Asp Asp Asp Asp Glu

195 200

<210>2

<211>612

<212>DNA

<213> Pelteobagrus fulvidraco (Pelteobagrus fulvidraco)

<400>2

atggggaaag acccaacaaa gccaaggggc aaaatgtcctcttatgccta ttttgtccag 60

acctgcagag aggaacataa gaagaaacat cctgacacat cagtcaattt ctcagaattc 120

tctaaaaagt gctctgagcg gtggaagact atgtccgcta aggaaaaggg caagtttgaa 180

gacatggcca gacttgataa ggcccgttat gaacgggaga tgaagaacta tgtacctccc 240

agaggtgaaa agaagaagag gtttaaggac cccaatgctc ctaagagacc cccgtcagcc 300

tttttcattt tttgtgcgga atatcggccc aaggtgaaag aggagacccc aggattgtct 360

attggtgatg tggctaagaa gcttggggaa atgtggaaca agacctctgc tgaagagaag 420

cagccttatg agaagaaggc agccaagctg aaggagaaat atgagaagga cattgcagca 480

tatcgaaagg gaaaagttgt cgggggtgct gcgaaagccc ccaccaaacc agacaaagca 540

gatgatgatg atgacgacga tgacgatgat gacgacgacg atgacgatga tgaagatgac 600

gatgatgagt aa 612

<210>3

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggattgtcta ttggtgatgt ggcta 25

<210>4

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atcatctgct ttgtctggtt tggt 24

<210>5

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggacacggaa aggattgaca ga 22

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gttcgctatc ggaattaacc aga 23

Claims

1. Application of anti-pelteobagrus fulvidraco PfHMGB1 antibody in preparation of reagent for relieving cell invasion of pelteobagrus fulvidraco or in-vitro pelteobagrus fulvidraco by algal toxins.

2. The use according to claim 1, wherein the amino acid sequence of PfHMGB1 is shown in SEQ ID NO 2.

3. The use of claim 1, wherein the isolated Pelteobagrus fulvidraco cell is a hepatocyte.

4. The use according to claim 1, wherein the algal toxin is a microcystin.

5. The use of claim 4, wherein the algal toxin is MC-LR.

6. A reagent for reducing the invasion of pelteobagrus fulvidraco or in-vitro pelteobagrus fulvidraco cells by algal toxins is characterized by comprising an anti-pelteobagrus fulvidraco PfHMGB1 antibody.

7. A method for reducing invasion of in vitro pelteobagrus fulvidraco cells by algal toxins is characterized by comprising the step of adding an anti-pelteobagrus fulvidraco PfHMGB1 antibody into the culture environment of in vitro pelteobagrus fulvidraco cells.

8. The method according to claim 7, wherein the isolated Pelteobagrus fulvidraco cell is a hepatocyte.