CN111671739B - Application of elemene in preparing medicine for treating lysosome storage disease - Google Patents

Abstract

The invention discloses an application of a small molecular compound elemene in preparing a medicament for treating lysosomal storage disease. The invention screens a small molecule library of a natural extract, and the small molecule compound elemene screened from 850 natural small molecules can effectively inhibit the phenotype of lysosomal storage diseases, such as inhibiting increase of lysosomal volume, inhibiting cholesterol storage, remarkably recovering inhibited lysosomal storage, remarkably recovering tolerance to repeated hunger and reducing cell death rate, thereby achieving the purposes of reducing injury and inhibiting disease development. Elemene has the prospect of being developed into a broad-spectrum drug for treating lysosomal storage diseases.

Description

Use of elemene in preparing medicine for treating lysosome storage disease

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of elemene in preparing a medicine for treating lysosomal storage diseases.

Background

Lysosomal Storage Disease (LSD) is a generic term for a class of inherited diseases caused by lysosome-related single gene mutations. There are approximately 50 lysosomal storage diseases that have been found in humans, with an average incidence of less than one ten-thousandth of each, but with a total incidence of between about 1/10000 and 1/5000.

The pathogenesis of LSD varies depending on the mutated gene. The mutated gene may be an enzyme responsible for degradation within the lysosome, a protein responsible for transport of substances on the lysosome membrane, a protein associated with lysosomal membrane trafficking, and an enzyme responsible for post-translational modification of lysosomal associated proteins, among others. Although the pathogenesis varies, the onset of all LSDs is primarily accompanied by the accumulation of some lysosomal associated substance. LSDs can be generally classified into the following broad categories according to their primary storage materials:

1. lipid storage diseases, which are further classified into sphingolipid storage, ganglioside storage, leukodystrophy, and the like;

2. mucopolysaccharide storage disease;

3. glycoprotein storage disease;

4. mucolipidosis.

In addition, there are LSDs such as glycogen storage diseases such as Pompe Disease and cystine storage diseases, which do not belong to the above groups. Because the mutual complex influence of the substances stored in lysosomes and the transport and function of lysosome membranes, the various LSDs can finally cause the secondary storage of various lysosome related metabolites, and a similar metabolite storage effect is caused.

Due to similar material accumulation, LSDs are similar in their main pathological phenotypes, both at the cellular level and at the human body level, except for phenotypes directly related to the function of the mutant gene itself. Among them, the phenotype in the human body is mainly caused by the damage of the terminal differentiated cells (mainly neurons and muscle fibers) with long life, including developmental delay, muscle spasm, insufficient muscle power, mental retardation, visual and auditory injuries, etc. At the cellular level, phenotypes include mainly enlarged lysosomes, accumulation of various lysosome-related metabolites (cholesterol, sphingomyelin, ceramides, various polysaccharides, etc.), reduced lysosomal degradation and transport functions, hindered lysosomal regeneration, and the like. Depending on the severity of the causative mutation, the phenotype of LSD also varies in severity. Even relatively mild mutations can cause morbidity during the juvenile period and death usually before the third decade, and severe mutations can cause patients to develop morbidity and death within a few years from infancy to early childhood.

Because LSD is caused by mutation on the gene level, the current biological and medical technology can not achieve radical cure. Although the CRISPR gene editing technology that has appeared in recent years can directly and accurately edit target gene sequences in living cells and higher animals, it has not been applied to clinical experiments and treatments in a short time because of its unresolved off-target effects and ethical problems. By far, treatment regimens directed at LSD have primarily been to reduce the intake of relevant storage substances in an attempt to alleviate the phenotype. Such regimens and their efforts are directed to the patient and family members, and are only applicable to the primary storage of the substance as an externally ingested substance or a direct metabolite thereof. LSDs such as glycoprotein storage disease, mucopolysaccharidosis, etc. caused by storage of substances synthesized in vivo cannot be treated by adjusting the manner of intake of substances.

In addition, the treatment modalities reported at present also include gene therapy and protein replacement therapy, but the average number is rare. The former treatment regimen is to deliver the wild type of the mutant gene into the patient via viral encapsulation and express it in place of the mutant gene to perform its function. The latter treatment regimen is to inject normal protein after synthesis into the patient to directly replace the diseased protein to perform the function. The gene therapy is limited by the transfection efficiency and the expression efficiency of the virus, and the insertion of the virus into the DNA fragment of the chromosome may cause the mutation of other genes, the instability of the chromosome and other problems, easily cause other diseases and increase the canceration risk. Protein replacement therapy is generally only applicable to LSD due to enzymatic mutations within lysosomes, and is extremely ineffective against brain cells due to the presence of the blood brain barrier. And protein replacement therapy requires periodic injection of synthetic protein, which is costly.

In addition to the above-mentioned disadvantages, there is another limitation in the current treatment modalities for LSD, that is, they are directed to LSD of single or same kind of pathogenesis and cannot be used as universal therapy for most LSDs. However, the incidence of LSD alone is extremely low, which results in extremely low efficiency and minimal benefit for further optimization of the above treatment modalities.

Disclosure of Invention

Based on the above problems currently faced with treatment of LSD, the present application provides a drug that can treat LSD over a broad spectrum and at a relatively low cost. The application provides the use of elemene in the manufacture of a medicament for the treatment of lysosomal storage diseases.

The molecular structure of Elemicin (Elemicin) is shown as formula I.

At present, no medicinal record exists in elemene, but some researches show that elemene may participate in antioxidant, antibacterial and other processes, and metabolites of elemene also show certain toxicity in murine experiments. Elemene is abundantly present in some edible and medicinal plants, including nutmeg, celery, etc.

Toxicity studies of elemene have shown that elemene toxicity is mainly caused by metabolism in the liver to 1 '-hydroxyelemene (1' -hydroxyeleemicin) (Wang, Y.K., et al, Role of Metabolic Activation in Elemicin-Induced Cellular sensitivity. J Agric Food Chem,2019.67(29): p.8243-8252.). Toxicity includes mainly the Inhibition of Stearoyl-CoA Desaturase 1(Stearoyl-CoA Desaturase 1) (Yang, X.N., et al, Metabolic Activation of Elemicin Leads to the Inhibition of Stearoyl-CoA Desaturase 1.Chem Res Toxicol,2019.32(10): p.1965-1976.), the binding to cysteine/N-ethylcysteine in cells (Wang, Y.K., et al, le of Metabolic Activation in-Induced Cellular reactivity. J. agricultural Food, 2019.67(29): p.8243-8252.), and certain binding to DNA (van den Berg, S.J., chemical basic) and chemical amplification of protein, and binding to DNA (9. J. chemical modification, chemical nucleotide spectrum, 2012.25. and 11). However, in Cellular experiments (Wang, Y.K., et al, roll of Metabolic Activation in electric-Induced Cellular susceptibility. J.Agric Food Chem,2019.67(29): p.8243-8252.) and in mouse experiments (van den Berg, S.J., et al, physical based kinetic models for the alkenyl benzene electric protein rat and human and porous assays for the risk assessment. Chem Res. 2012.25(11): p.2-67.), concentrations of > 250. mu.M and 2.5mM, respectively, which resulted in decreased Cellular activity/mouse liver injury, were well above the 10 micromolar concentrations used in this application.

The present application provides, in a first aspect, the use of elemene in the manufacture of a medicament for the treatment of a lysosomal storage disease. Preferably, the lysosomal storage disease is: (1) GM2 gangliosidosis (GM2 gangliosidosis), primary storage substance is glycolipid or polysaccharide containing galactose chain; (2) fabry's Disease, primary storage substance is GM2 ganglioside; (3) niemann Pick type C (Niemann-Pick type C) and cholesterol as primary storage substance.

The application also provides a medicine for treating lysosomal storage diseases, and the effective component is elemene. Preferably, the lysosomal storage disease is: (1) GM2 gangliosidosis, the primary storage substance is glycolipid or polysaccharide containing galactose chain; (2) fabry's disease, the primary storage substance is GM2 ganglioside; (3) niemann pick C type disease, the primary storage substance is cholesterol.

Because of the unique pathogenesis of LSD, the main pathological manifestations of LSD are highly similar, all appearing at the cellular level as storage of various substances in the lysosome, obstruction of lysosomal membrane transport and regeneration, and degradation of lysosomal degradation functions. Accumulation of harmful substances in nerve and muscle cells due to the impairment of lysosomal function and lysosomal storage is a major cause of impairment of physiological functions and death of patients. Therefore, at the stage that the pathogeny cannot be directly eradicated by the gene editing means at present, the aims of reducing the injury and inhibiting the disease development can be achieved by inhibiting the pathological phenotype at the cell level for a long time.

The invention screens a small molecule library of a natural extract, and the small molecule compound elemene screened from 850 natural small molecules can effectively inhibit the phenotype of the lysosome storage disease, such as inhibiting the increase of the volume of lysosome, inhibiting cholesterol storage, remarkably recovering the inhibited lysosome tube, remarkably recovering the tolerance to repeated hunger and reducing the cell death rate, thereby achieving the purposes of reducing injury and inhibiting the disease development. Elemene has the prospect of being developed into a broad-spectrum drug for treating lysosomal storage diseases.

Drawings

Fig. 1 is a graph of the results of lysosome total volume detection in three LSD model cell lines, where a: GLAKO model, B: hex ako model, C: NPC1KO model lysosomes were labeled with lysotracker in Wild Type (WT) HeLa cells and GLAKO, HEXAKO, NPC1KO HeLa cells, the total intracellular volume of lysosomes was quantified by flow cytometry and normalized against WT. ***: p-value < 0.001.

Fig. 2 is a graph of the results of the detection of total lysosomal cholesterol in three LSD model cell lines, where a: GLAKO model, B: HEXAKO model, C: NPC1KO model, cholesterol in Wild Type (WT) HeLa cells and GLAKO, HEXAKO, NPC1KO HeLa cells were stained with filipin (cholesterol in cells accumulated in lysosomes), and quantitative analysis was performed by fluorescence confocal irradiation against lysosomal cholesterol. ***: p-value < 0.001.

Fig. 3 is a graph of results of the detection of endolysin tube formation of three LSD model cell lines, wherein a: GLAKO model, B: hex ako model, C: the NPC1KO model was starved for a long time (6 hours) for wild-type (WT) HeLa cells and GLAKO, HEXAKO, NPC1KO HeLa cells, and the number of tubular structures (lysosome vascularization) appearing on lysosomes in the cells was observed and quantified by live cell imaging. The lysosome tube becomes an essential step for lysosome regeneration. ***: p-value < 0.001.

Fig. 4 is a graph of mortality results for three LSD model cell lines under repeated starvation treatments, where a: GLAKO model, B: hex ako model, C: NPC1KO model, cell mortality was quantified by PI staining by repeated starvation (12 hours recovery of normal medium after 12 hours serum starvation, three replicates) of Wild Type (WT) HeLa cells and GLAKO, HEXAKO, NPC1KO HeLa cells. The data show that the mortality of LSD cells was significantly increased compared to wild-type cells. ***: p-value < 0.001.

Fig. 5 is a graph of the results of phenotypic measurements of elemene inhibition of lysosomal volume increase in LSD model cell lines: p-value < 0.001.

Fig. 6 is a graph of the results of phenotypic measurements of cholesterol storage in the elemene-inhibited LSD model cell line: p-value < 0.001.

Fig. 7 is a graph of the results of lysosome formation assays in the elemene-restored LSD model cell line: p-value <0.01,.: p-value < 0.001.

Fig. 8 is a graph of the results of tolerance measurements of the element-restored LSD model cell line to repeated starvation: p-value <0.01,.: p-value < 0.001.

Detailed Description

Example 1: phenotypic identification of three lysosome storage disease model cell lines used in experiment

For small molecule library screening, three gene knockout model cell lines of lysosomal storage diseases, i.e., GLAKO (GLA gene knockout), HEXAKO (HEXA gene knockout), and NPC1KO (NPC1 gene knockout), were constructed in HeLa cells by the CRISPR-Cas9 system. The DNA sequences for transcription of the corresponding grnas at gene knockout were: GLA: GCTCCCCAAAGAGATTCAGA, respectively; HEXA: TTTCCCCGCTTTCCTCACCG; NPC 1: CTGGACACAGTAGCAGCAGG are provided. Wherein, the knockout of GLA leads to 7bp base loss of the 234bp exon of the gene on two chromosomes, which causes frame shift, and WB confirms that the expression of GLA protein is completely lost; the knockout of HEXA leads to the appearance of an additional base at 539bp of the exon of the gene on two chromosomes to cause frame shift, and the complete loss of the expression of HEXA protein is confirmed by WB; the deletion of the NPC1 results in the 1bp base loss of the 36bp exon of the gene on one chromosome, and the additional one base at the site on the other chromosome, which causes frame shift, and confirms that the expression of the NPC1 protein is completely lost through WB.

Among them, deletion of GLA leads to GM2 gangliosidosis (GM2 gangliosidosis), deletion of HEXA leads to Fabry's Disease, and deletion of NPC1 leads to Niemann Pick C type Disease (Niemann-Pick type C) (Platt, F.M., et al, Lysomal storage diseases. nat Rev DismerPris, 2018.4(1): p.27.). The primary storage substances for these three diseases are quite different, with the loss of GLA leading to storage of galacto-chain containing glycolipids or polysaccharides, the loss of HEXA leading to storage of GM2 gangliosides, and the loss of NPC1 leading to storage of cholesterol. Therefore, the three knockout models can effectively test the broad spectrum of the small molecule drug for different LSD diseases.

As mentioned above, all LSDs have some similar phenotypes at the cellular level, including enlarged lysosomes, storage of lysosomal substances, decreased lysosomal function, and impaired lysosomal regeneration. Thus, the LSD phenotypes of these three storage disease model cell lines were first identified. The experimental results confirmed (fig. 1-4) that all the three model cell lines have pathological phenotypes significantly different from wild-type, which are similar but slightly higher and lower in degree. Specifically, all three cell lines had enlarged lysosomes (fig. 1), all had lysosomal cholesterol storage (fig. 2), and lysosomal duct formation (tubular structures appearing on lysosomes, an indicator of lysosomal regeneration) was highly inhibited (fig. 3). At the same time, the mortality rate of all three cell lines increased significantly compared to wild type under severe starvation conditions (fig. 4).

Example 2: small molecule library screening

Through screening a Natural extract small molecule Library (L6000), small molecules with elemene (Elemicin) which has obvious improvement effect on the phenotype of the lysosomal storage disease at the cell level are screened from 850 Natural small molecules.

The specific screening process is as follows:

lysosomes were labeled by Lysotracker (Thermo Fisher, cat # L7528) in WT and three lysosomal storage disease model cell lines, and intracellular Lysotracker fluorescence was measured by flow cytometry 48 hours after treatment of cells with small molecules at a concentration of 10 micromolar, to calculate the total intracellular lysosomal volume. Wherein, the total lysosome volume is reduced by more than 20% in all three cell lines, and the medicines which do not cause obvious cell damage to WT cells enter a second screening. In the second screening, after 48 hours of treatment of the three cell lines with 10 micromolar small molecules, the intracellular cholesterol was stained with Philippine blue and quantified by photography. Finally, small molecules that cause more than 20% reduction in cholesterol storage in all three cell lines were selected.

Example 3: elemene can remarkably inhibit phenotype of cell line of lysosome storage disease

Hela cells of WT, GLAKO, HEXAKO, NPC1KO were treated with elemicin at a concentration of 10 micromolar for 48 hours, lysosomes in the cells were labeled with lysotracker, and lysotracker fluorescence in the cells was analyzed by ImageJ after live cell imaging to quantify the lysosome volume. The results are shown in FIG. 5: elemene did not affect lysosomal volume in WT cells, while it inhibited the increase in lysosomal volume in three LSD cell lines.

In Hela cells of WT, GLAKO, HEXAKO, NPC1KO, elemene was treated at a concentration of 10 micromolar for 48 hours, and then cholesterol in the cells was labeled with filipin blue, and after photographing by live cell imaging, fluorescence amount of filipin blue in the cells was analyzed by ImageJ to quantify the storage of cholesterol. The results are shown in FIG. 6: elemene did not affect the amount of cholesterol in WT cells, but inhibited cholesterol storage in three LSD cell lines.

The lysosome vascularization phenomenon is a lysosomal stress reaction, and is activated to regenerate lysosomes when the lysosome is consumed in large amounts or has a low function. Lamp1 is a lysosomal membrane protein and is a recognized lysosomal membrane marker. In Hela cells of WT, GLAKO, HEXAKO, NPC1KO, lysosomal membrane protein Lamp1-mCherry was transfected to label the lysosomal tubular structures that may appear, and then treated with elemene at a concentration of 10 micromolar for 48 hours, respectively, followed by serum starvation for 6 hours, followed by photographing of intracellular lysosomal tubulogenesis by live cell imaging and quantification. The results are shown in FIG. 7: elemene did not affect lysosomotropic duct formation in WT cells, while the lysosomotropic duct formation inhibited in three LSD cell lines was significantly restored.

In Hela cells of WT, GLAKO, HEXAKO, NPC1KO, were treated with elemicin at a concentration of 10 micromolar for 72 hours, three times in the process for 12 hours serum starvation-12 hours starvation of normal medium, followed by labeling dead cells with PI (propidium iodide), and then cell mortality was photographed and quantified by live cell imaging. The results are shown in FIG. 8: tolerance to repeated starvation was not significantly increased in WT cells, and was significantly restored in three LSD cells, significantly reducing the mortality of the LSD model cell line.

The data show that elemene is effective in inhibiting the lysosomal storage disease phenotype.

Sequence listing

<110> Zhejiang university

Application of <120> elemene in preparing medicine for treating lysosomal storage disease

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gctccccaaa gagattcaga 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tttccccgct ttcctcaccg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctggacacag tagcagcagg 20

Claims (1)

1. Use of elemene in the manufacture of a medicament for the treatment of a lysosomal storage disease, said lysosomal storage disease being one of:

(1) the lysosome storage disease is GM2 gangliosidosis, and the primary storage substance is glycolipid or polysaccharide containing galactose chain;

(2) the lysosomal storage disease is Fabry's disease, and the primary storage substance is GM2 ganglioside;

(3) the lysosome storage disease is a Niemann pick C type disease, and the primary storage substance is cholesterol.

Images