CN111662387A

CN111662387A - Monoclonal antibody of anti-human lipoprotein-associated phospholipase A2 and application thereof

Info

Publication number: CN111662387A
Application number: CN202010671636.4A
Authority: CN
Inventors: 易维京; 蔡方琴; 汤定斌; 张艳军; 张丽华; 罗嘉
Original assignee: Chongqing Zhongyuan Huiji Biotechnology Co Ltd
Current assignee: Chongqing Zhongyuan Huiji Biotechnology Co Ltd
Priority date: 2020-07-14
Filing date: 2020-07-14
Publication date: 2020-09-15

Abstract

The disclosed anti-Lp-PLA 2 monoclonal antibody has good stability and specificity, can be used as a key raw material for preparing an Lp-PLA2 diagnostic reagent, has the capability of resisting interference of lipoprotein and homologous protein, and cannot influence the detection result when being combined with the lipoprotein or mixed with the PLA2 homologous protein. The monoclonal antibody can be used for developing a diagnostic detection kit with good specificity and high accuracy, can successfully detect the difference of Lp-PLA2 in the serum of healthy people and patients with cardiovascular diseases, and can detect a correct result particularly under the condition that the interference of PLA2 homologous protein exists in the serum of patients with Alzheimer's disease.

Description

Monoclonal antibody of anti-human lipoprotein-associated phospholipase A2 and application thereof

Technical Field

The invention relates to the technical field of biological medicines, in particular to an anti-human lipoprotein-associated phospholipase A2 monoclonal antibody and application thereof

Background

Lipoprotein-associated phospholipase A2(Lipoprotein-associated phospholipase A2(Lp-PLA2)), a phospholipase secreted by inflammatory cells and capable of promoting hydrolysis of oxidized phospholipids, is a member of the phospholipase A2(PLA2) superfamily, and Lp-PLA2 has the basic function of catalyzing hydrolysis of the acetate bond at the Sn-2 position of various oxidized phospholipids to produce free fatty acids and lysophospholipids. Besides, Lp-PLA2 can also hydrolyze inflammatory factors such as platelet activating factor. The concentration of Lp-PLA2 can reflect the formation and severity of atherosclerotic plaques, so the method is clinically used for early warning cardiovascular emergencies and evaluating the occurrence and recurrence risks of coronary heart disease and cerebral apoplexy.

At present, the detection kit based on the enzymatic activity of Lp-PLA2 is widely applied clinically. However, the enzyme method specificity is not high enough due to the interference of enzyme activities of Lp-PLA2 and other phospholipases in the same family, the influence of detection environment and the like. Meanwhile, the detection sensitivity of the enzyme method is not high due to the limitation of the enzyme method. The detection method based on protein concentration measurement has higher detection specificity because of the specific interaction based on antigen and antibody. However, in clinical use comparison, the results obtained by the enzyme activity-based detection method and the protein concentration-based detection method are relatively poor. Studies have shown that the protein Lp-PLA2 in blood binds predominantly to lipoproteins rich in apolipoprotein (Apo) B. Lipoproteins that bind to Lp-PLA2 mask the antibody binding epitope on Lp-PLA2, directly interfering with the specific binding of the antibody to Lp-PLA2, thus making the assay result unable to reflect the true concentration of Lp-PLA 2.

In addition, in the case of confirmed diagnosis of alzheimer's disease and schizophrenia, conditions such as oxidative stress and inflammation of the brain occur, and the expression level of PLA2G3 or PLA2G12A increases. Both are members of the phospholipase A2 family, and their elevation can interfere with the diagnostic assay for Lp-PLA 2. And finally results in poor correlation with the results of the enzymatic assay.

Therefore, the specific anti-human Lp-PLA2 monoclonal antibody or antibody pair which can resist lipoprotein and other phospholipase A2 family proteins has important application value for developing more accurate and simpler cardiovascular and cerebrovascular disease detection reagents.

Disclosure of Invention

The purpose of the present invention is to provide an antibody having high affinity for human Lp-PLA2, which is capable of inhibiting interference with lipoproteins and other proteins of the same family.

One of the objects of the present invention is to provide an isolated DNA molecule encoding the variable region or full length amino acids of the heavy and/or light chain of the anti-Lp-PLA 2 human antibody.

An anti-human Lp-PLA2 monoclonal antibody, or an antigen-binding portion thereof, comprising:

a) the heavy chain variable region CDR1 as set forth in SEQ ID NO. 1;

b) the heavy chain variable region CDR2 as set forth in SEQ ID NO. 2;

c) the heavy chain variable region CDR3 as set forth in SEQ ID NO. 3;

d) light chain variable region CDR1 as set forth in SEQ ID NO. 4;

e) light chain variable region CDR2 as set forth in SEQ ID NO. 5;

f) light chain variable region CDR3 as set forth in SEQ ID NO. 6;

the above-mentioned anti-human Lp-PLA2 monoclonal antibody or antigen-binding portion thereof is designated as LP-A

Or

a) Heavy chain variable region CDR1 as set forth in SEQ ID NO. 7;

b) the heavy chain variable region CDR2 as set forth in SEQ ID NO. 8;

c) the heavy chain variable region CDR3 as set forth in SEQ ID NO. 9;

d) light chain variable region CDR1 as set forth in SEQ ID NO. 10;

e) light chain variable region CDR2 as set forth in SEQ ID NO. 11;

f) light chain variable region CDR3 as set forth in SEQ ID NO. 12;

the above-mentioned anti-human Lp-PLA2 monoclonal antibody or antigen-binding portion thereof is designated as LP-B

Preferably, the monoclonal antibody LP-A or LP-B specifically binds to human LP-PLA2 protein, with ｃA binding site located outside the binding region of the PLA2G3 or PLA2G12A protein.

Preferably, the monoclonal antibody LP-A or LP-B binding site is located outside of the lipoprotein binding region.

The invention also provides ｃA detection kit of Lp-PLA2, which contains the monoclonal antibody LP-A or LP-B.

Preferably, the detection kit simultaneously recognizes LP-PLA2 protein by using LP-A and LP-B, and determines the concentration of LP-PLA2 protein.

In another aspect of the invention, there is provided a conjugate comprising the monoclonal antibody described above covalently linked to a chemical or biological marker.

The invention also relates to a conjugate formed by coupling the monoclonal antibody and/or the conjugate with a solid medium or a semi-solid medium.

The invention also relates to the application of the monoclonal antibody, the conjugate or the conjugate in the preparation of products for detecting the expression of LP-A or LP-B.

Has the advantages that:

the monoclonal antibody LP-A or LP-B can resist the interference of lipoprotein and phospholipase A2 congener protein, so that the monoclonal antibody has high affinity to LP-PLA2 and reduces false positive results. High expression in animal cells and can be used for industrial production.

Drawings

FIG. 1: purifying the recombinant protein Lp-PLA 2;

FIG. 2: producing and purifying the monoclonal antibody;

FIG. 3: identifying the stability of the monoclonal antibody;

FIG. 4: labeling the yeast by colloidal gold immunochromatography;

FIG. 5: an anti-lipoprotein interference experiment of Lp-PLA2 content colloidal gold immunochromatography;

FIG. 6: performing anti-homologous protein interference experiments by using Lp-PLA2 content colloidal gold immunochromatography;

FIG. 7: labeling the colloidal gold immunoturbidimetric kit;

FIG. 8: an anti-lipoprotein interference experiment of the Lp-PLA2 content colloidal gold immunoturbidimetry kit;

FIG. 9: anti-homologous protein interference experiments of the Lp-PLA2 content colloidal gold immunoturbidimetry kit.

Detailed Description

The embodiments of the present invention are illustrated below by specific examples, and the scope of the present invention is not limited to the specific embodiments described below. The examples are merely illustrative of the principles of the present invention and its efficacy, and are not to be construed as limiting the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Example 1: expression and purification of recombinant protein Lp-PLA2

Cloning a human Lp-PLA2 gene sequence to a prokaryotic expression vector to construct a prokaryotic expression plasmid, and culturing the expression plasmid by using an LB plate containing antibiotics after transforming escherichia coli BL 21. The single clone was picked and inoculated into LB medium. Culturing until OD value of bacterial liquid reaches 0.6, and adding IPTG to induce protein expression. After 16 hours of induction, the bacterial suspension was collected by centrifugation. And crushing the thalli, centrifuging and collecting supernatant, and purifying by adopting ion exchange and a molecular sieve to obtain the antigen protein.

As shown in fig. 1, lane 1: purchased Lp-PLA2 protein; lane 2: the Lp-PLA2 antigen protein obtained by expression and purification in the research shows that the protein Lp-PLA2 sold in the market has a miscellaneous band and an obvious dragging condition, which indicates that the protein has impurities and is not high in purity, but the protein Lp-PLA2 purified by the invention has correct size of the protein band identified by SDS-PAGE electrophoresis, and compared with the protein sold in the market, the protein band is clean, no dragging and miscellaneous bands are generated, and the purity can reach more than 90 percent, so that the protein can be used for preparing monoclonal antibodies.

Example 2: mouse immunization and antibody detection

5 SPF-grade female BALB/c mice 6-8 weeks old were selected, mixed and emulsified with Freund's complete adjuvant in equal volumes with antigen protein at a concentration of 2 mg/ml. SPF-grade female BALB/c mice 6-8 weeks old are immunized with the emulsified antigen, and 40 mu g of antigen protein is injected into each mouse by foot sole injection or back subcutaneous injection. Primary immunizationTwo weeks later, the antigen protein was emulsified by mixing with Freund's incomplete adjuvant, and 40. mu.g of antigen protein was injected into each mouse again by foot sole injection or back subcutaneous injection. Two weeks later blood was taken via the tail vein, and the supernatant was collected by centrifugation and assayed for serum titer by ELISA. Immunizations were performed every two weeks and serum titers were measured. After 2 immunizations, the serum titer was already up to 2.0 or more after a million-fold dilution (table 1). Screening serum titer 10⁶Lymphocytes from the above mice were isolated and used for cell fusion.

TABLE 1 ELISA assay for serum titers

Example 3: cell fusion and screening and subcloning of positive hybridoma cells

Lymphocytes from the immunized mice were isolated and fused with cultured SP2/0 cells either PEG 1500-mediated or electrofused. Fusion cell culture was screened in HAT-1640 medium containing 20% FBS serum. After one week, the medium was changed and after another 4 days of culture, culture supernatants were taken for positive clone screening. To increase the anti-Lp-PLA 2 antibodies that were screened for non-interference by lipoproteins and the phospholipase a2 family of proteins, positive well screens were performed using Lp-PLA2 that binds lipoproteins, PLA2G3 and PLA2G12A proteins. And selecting the hole with the higher ELISA positive value and cell ratio value for multiple subcloning. ELISA plates were coated with Lp-PLA2 protein that bound to lipoprotein and not lipoprotein, PLA2G3 and PLA2G3, PLA2G12A and PLA2G12A, respectively. And selecting monoclonals which can show the same affinity under the condition of 6 antigen coatings from the culture supernatants of the subclones, selecting monoclonal hybridomｃA cells with the highest affinity, and finally obtaining two hybridomｃA cell strains which can secrete anti-LpPLA 2 monoclonal antibodies resistant to interference of lipoprotein, PLA2G3 and PLA2G12A, wherein the hybridomｃA cell strains are named as LP-A and LP-B.

EXAMPLE 4 production purification of monoclonal antibodies

Two groups of 6-8 week BALB/c mice were selected and injected intraperitoneally with 500. mu.L paraffin oil to suppress the immune response in the mice. One group of small after one week of injectionThe mouse was intraperitoneally injected with 0.5ml of LP-A hybridomｃA cells at ｃA cell density of about 1 × 10⁶The other group of mice was intraperitoneally injected with 0.5ml of LP-B hybridoma cells at a cell density of about 1 × 10⁶The number of the cells. Ascites collection began two weeks later. The collected ascites is treated with ammonium sulfate precipitation and affinity purification of protein A to obtain the target antibody, and the purification effect is identified by PAGE electrophoresis.

The results are shown in FIG. 2, lane 1 is the LP-A antibody reduction treatment; lane 2 is non-reducing treatment with LP-A antibody; lane 3 is LP-B antibody reduction treatment; lane 4 is non-reducing treatment with LP-B antibody. It can be seen from the figure that the purified antibody, after treatment with a reducing agent and elevated temperature, exhibits heavy and light chain bands of approximately 55kDa and 25kDa molecular weight and a single band of approximately 150kDa molecular weight on a non-reducing gel by electrophoretic analysis. This indicates that the monoclonal antibody has a relatively high purity after affinity column chromatography and can be used for further research

Example 5: subtype identification and gene sequence cloning of monoclonal antibody

The subtypes of the heavy and light chains of the monoclonal antibody were identified by the SBA cloning System-HRP kit from southern Biotech according to the protocol of the instruction. The specific operation is as follows:

1. the capture antibody was diluted to 1. mu.g/mL with coating solution (0.05M carbonate and bicarbonate buffer pH 9.5), added to the microplate at 100. mu.L/well, and coated overnight at 4 ℃. The plate was washed 3 times with PBS buffer (wash solution) containing 0.05% Tween-20.

2. The culture supernatant of the hybridoma to be tested was diluted 1:1 with a diluent (1% BSA, 0.1% PBST), 100. mu.L/well of the diluted solution was applied to an ELISA plate, and the plate was incubated at 37 ℃ for 30 minutes. The corresponding enzyme-labeled antibodies (Ig-HRP, IgG1-HRP, IgG2a-HRP, IgG2b-HRP, IgG3-HRP, IgM-HRP, kappa-HRP, lamda-HRP)1:3000 were diluted with the diluent.

3. After washing the plate with the plate washing solution 3 times, 100. mu.L of diluted enzyme-labeled antibody was added to each well, and the mixture was incubated at 37 ℃ for 30 minutes. The plate was washed 3 times again, then the developing solution was added, and after about 5 minutes (depending on the intensity of the reaction), 2M sulfuric acid was added to terminate the reaction, and the OD450 absorbance was read.

The heavy chains of both antibodies were identified as IgG2b, and the light chains as Kappa. According to antibody subtype results, a mature technical route is adopted to clone an antibody gene sequence. The hybridoma cells with good growth state were collected, total RNA of the hybridoma cells was extracted by Trizol of Thermo, mRNA was reverse-transcribed into cDNA according to the protocol of PrimeScript II reverse transcription of Takara, and the cDNA was frozen at-20 ℃ for use.

The specific operation flow of reverse transcription is as follows:

first, 10. mu.L of a total volume of a premixed solution of template RNA/primer DNA was prepared, which contained 1. mu.L of 10. mu.M concentration of specific primers (sequences atgggtgccagtgtctcttagga and gaagcctccaagaccttagaagggaa), 4. mu.L of a mixture of dNTPs at 2.5mM, and 5. mu.L of RNA (total amount less than 5. mu.g). After mixing, the mixture was treated at 65 ℃ for 5 minutes and immediately placed on ice.

mu.L of 5 XPrimeScript II buffer, 20 units of RNase inhibitor and 1. mu.L of LPrimeScript II RTase (200 units) were added to the premix, mixed well, reacted at 42 ℃ for 60 minutes, treated at 70 ℃ for 15 minutes, and then cooled on ice until use.

And (3) respectively and independently carrying out amplification attempts by using cDNA as a template and antibody gene amplification primers reported in the literature, and screening out the primers capable of efficiently amplifying the antibody genes. PCR was performed according to the protocol of the Phanta Max Super-Fidelity DNApolymerase (Nakano Zanza) of the Ltd

The PCR reaction system is as follows:

25μL 2×Phanta

1μL dNTP

4 uL of 10uM primer pair

4 μ L hybridoma cell cDNA

1μL DNA polymerase

15μL dd H2O

The total reaction volume was 50. mu.L. The amplification conditions were: pre-denaturation at 94 deg.C for 3 min; denaturation at 94 ℃ for 30 s; annealing at 56 deg.C for 30 s; extension was 72 ℃ for 2 min. The PCR product was Gel recovered according to the OMEGA Gel Extraction Kit instructions of OMEGA, and the antibody gene sequence was obtained by plasmid sequencing after the amplified product was linked to the T vector.

Example 6: monoclonal antibody stability identification

The purified anti-Lp-PLA 2 monoclonal antibodies LP-A and LP-B are placed in the environment of-20 ℃, 4 ℃ and 37 ℃, the concentration is 100ng/mL, samples are taken every 5 days, and the change of the immunoreactivity of the monoclonal antibodies is detected by indirect ELISA. The results show no difference in titer after 5 days of incubation at-20 deg.C, 4 deg.C and 37 deg.C, and after more than 10 days, the titer at 4 deg.C and 37 deg.C began to decrease, while the titer at-20 deg.C was almost not decreased within the 25-day range of the assay, indicating that the LP-A (FIG. 3A) and LP-B (FIG. 3B) monoclonal antibodies had good stability.

Example 7: application of Lp-A and Lp-B in colloidal gold immunochromatography

1. Preparation of test paper strip

The test paper strip for immunochromatography of human Lp-PLA2 biotin-streptavidin used in this embodiment comprises ｃA bottom plate, wherein ｃA sample pad, ｃA first labeling pad, ｃA second labeling pad, ｃA coating film and an absorption pad are connected to the bottom plate, and is characterized in that the labeling pads comprise ｃA first labeling pad and ｃA second labeling pad, the first labeling pad is coupled with LP-A of colloidal gold, and the second labeling pad is coupled with LP-B of biotin; the coating film is provided with a streptavidin detection line T and a goat anti-mouse polyclonal antibody quality control line C, and the two lines are arranged in parallel.

When Lp-PLA2 exists in the sample, the Lp-PLA2 in the sample is firstly specifically combined with LP-A coupled with colloidal gold in the first labeling pad, chromatography is continued, and then specific combination is carried out with the LP-B coupled with the second labeling pad to form ｃA double-antibody sandwich structure; then, the solution is moved to be combined with streptavidin coated on the nitrocellulose membrane, so that ｃA streptavidin-biotin-LP-A-LP-PLA 2 antigen-colloidal gold LP-B complex is formed.

2. Creation of standard music

6 test strips of the kit prepared in example 8 were taken, 6 concentrations (0ng/ml, 20ng/ml, 100ng/ml, 250ng/ml, 500ng/ml and 1000ng/ml) of calibrator were added to the sample pad of the test strip, three replicates were performed at each concentration point, the amount of sample was 120. mu.l, and after 3 minutes of reaction, the calibrator concentration was measured on Zhonghui Ji Q7, using the calibrator concentration as the X-axis. The mean value of the signal values of 3 obtained in each point test is the Y-axis, and a standard curve is plotted, as shown in FIG. 4.

The experimental results show that the linear regression coefficients of the colloidal gold immunochromatography and the colloidal gold immunoturbidimetry are about 5, the slope of the linear regression line reaches above 0.99, and the correlation is good when different methodologies are used, namely, the antibody is suitable for being used in different methodologies, and the detection effect is good.

3. False positive experiment of Lp-PLA2 content detection kit

Sera without Lp-PLA2 were taken as negative controls, and sera from samples of Lp-PLA2 from different sources were taken as positive controls. 50 samples of each sample are tested, 150 samples (shown in the following table 2) are tested in total, no false positive condition occurs, and the test effect is good.

TABLE 2 false positive test of Lp-PLA2 content detection kit

The experimental result shows that the detection can be carried out no matter the content of the sample containing the Lp-PLA2 is high or low, the positive detection result is shown, the false detection and the false negative result can not occur in the sample without the Lp-PLA2, and the accurate and quick detection is realized by utilizing the immunochromatography.

4. Lipoprotein interference resisting experiment of Lp-PLA2 content detection kit

Uniformly mixing and incubating purified recombinant Lp-PLA2 protein with the concentration of 1mg/ml and oxidized low-density lipoprotein with the concentration of 5mg/ml to prepare Lp-PLA2 protein in a lipoprotein binding state. Serum without containing Lp-PLA2 was used as a diluent to prepare recombinant Lp-PLA2 protein and lipoprotein-bound Lp-PLA2 protein at concentrations of 10ng/ml, 20ng/ml, 50ng/ml, 100ng/ml, 200ng/ml, 400ng/ml, 600ng/ml, 800ng/ml and 1000ng/ml, respectively. The concentration of each diluted sample was measured using the Lp-PLA2 content detection kit prepared as described above, according to the experimental conditions described above. The results show that the linear regression straight-line slope of the concentration (figure 5B) of the Lp-PLA2 protein of the prepared Lp-PLA2 content detection kit for determining the binding state of the purified recombinant Lp-PLA2 protein (figure 5A) and the lipoprotein reaches over 0.99 and the regression coefficients are all about 5.3, which indicates that the Lp-PLA2 detection kit prepared by using the LP-A and LP-B monoclonal antibodies has no difference when determining the Lp-PLA2 protein of the lipoprotein binding state and the non-lipoprotein binding state, and the test strip can tolerate the interference of the lipoprotein binding on the content determination of the Lp-PLA 2.

5. Anti-phospholipase A2 homologous protein interference experiment of Lp-PLA2 content detection kit

The purified recombinant Lp-PLA2 protein at a concentration of 1mg/ml was mixed with PLA2G3 and 2.5mg/ml PLA2G12A at a concentration of 2.5 mg/ml. Serum without Lp-PLA2 was used as a diluent to prepare recombinant Lp-PLA2 protein and mixed solution at concentrations of 10ng/ml, 20ng/ml, 50ng/ml, 100ng/ml, 200ng/ml, 400ng/ml, 600ng/ml, 800ng/ml and 1000ng/ml, respectively. The concentration of each diluted sample was measured using the Lp-PLA2 content detection kit prepared as described above, according to the experimental conditions described above. The results show that the linear regression straight-line slopes of the concentrations of the purified recombinant Lp-PLA2 protein (figure 6A) and the Lp-PLA2 protein (figure 6B) in the lipoprotein binding state determined by the prepared Lp-PLA2 content detection kit reach over 0.99, and the regression coefficients are about 5.3, which indicates that the Lp-PLA2 detection kit prepared by using the LP-A and LP-B monoclonal antibodies has no difference when determining the mixed solution and the pure Lp-PLA2 protein, and the kit can tolerate the interference of the phospholipase A2 homologous protein on the determination of the Lp-PLA2 content.

Example 8: application of Lp-A and Lp-B in latex immunoturbidimetry

1. Preparation of the kit

The kit comprises two reagents of R1 and R2, wherein R1 is latex reaction buffer solution, and R2 is latex particles coated with anti-Lp-PLA 2 monoclonal antibody.

Wherein the R1 reagent is phosphate buffer at pH 7.5, and contains PEG6000 as coagulant at a concentration of 1.6%.

The R2 reagent was prepared by reacting a carboxylated latex having a pore size of 120nm with 1-ethyl-3- (3-dimethylaminopropyl) -3-ethylcarbodiimide in a shaker at room temperature for 30 minutes. After the reaction is finished, dividing the reaction mixed solution into two parts, respectively adding the LP-A antibody and the LP-B antibody, shaking and uniformly mixing, and carrying out rotary reaction for 2 hours at room temperature. After the antibody reaction is finished, simultaneously adding 6-aminocaproic acid and BSA into the two mixed solutions, uniformly mixing, and reacting for 2 hours. Thereafter, the supernatant was removed by centrifugation at 16000g for 30 minutes. The washed latex was resuspended in Tris buffer pH7.2 and centrifuged again. The latex was again re-reselected with Tris buffer, pH7.2, and the LP-A and LP-B coated latexes were mixed in equal volumes. Sonication was used to disperse the latex sufficiently to give the R2 reagent.

2. Creation of standard music

Preparation of lp-PLA2 calibrator: the diluent solvent of the calibrator is human serum matrix, which comprises 1 percent of NaCl, 205 percent of Tween and 2 percent of BSA, and the percentage is the percentage of the volume usage of the human serum matrix. Dissolving Lp-PLA2 recombinant protein in the human serum matrix to prepare calibrators (0ng/ml, 20ng/ml, 100ng/ml, 250ng/ml, 500ng/ml, 1000ng/ml) with different concentrations

b. The analysis method is a two-point end point method, namely the dosage of the reagent R1 and the dosage of the reagent R2 are respectively 40 mul and 10 mul, and the sample size is 2 mul. Curves of the above 6 different levels of Lp-PLA2 standards (fig. 7) using the assay method of the above kit of examples, using a zhongyuan huigi ZS400 biochemical analyzer, each point representing a level of reference standard, wherein the X-axis represents the level of Lp-PLA2 (ng/ml); the Y-axis represents absorbance.

3. Clinical experiment of Lp-PLA2 content detection kit

Respectively selecting 10 cases of healthy human serum, 10 cases of serum of clinically confirmed Alzheimer patients and 10 cases of serum of patients suffering from atheroma and Alzheimer, and respectively determining the content of Lp-PLA2 protein in each serum by using the prepared Lp-PLA2 content detection kit according to the conditions. The result shows that the Lp-PLA2 content detection kit prepared by the method can obviously distinguish normal group samples from pathological group samples (Table 3), and the Lp-PLA2 content detection kit prepared based on the LP-A and LP-B monoclonal antibodies can accurately detect the Lp-PLA2 in the bodies of patients, meets the requirement of clinical detection, and cannot detect due to interference in the serums of atheromatous patients and Alzheimer patients.

The scope of the risk is currently judged: Lp-PLA2 is less than 200ng/ml, which is a normal healthy population, Lp-PLA2 is less than 223ng/ml, which is a moderate risk, and Lp-PLA2 is more than 223 high risk. As can be seen from the table, the concentration of Lp-PLA2 in the serum of most patients in Alzheimer's disease patients is increased, because mental diseases are accompanied by some inflammatory reactions, so that the rise of Lp-PLA2 is caused, but the range of high risk is not reached, but the Lp-PLA2 is proved to be a marker of atheroma when the content in the body of patients with atheroma is more than 223.

Table 3: concentration of Lp-PLA2 in serum of different samples (ng/ml)

The method is the same as the 5 th experiment in example 7, and the result shows that the linear regression straight line slope of the concentration (figure 8B) of the Lp-PLA2 protein of the prepared Lp-PLA2 content detection kit for determining the purified recombinant Lp-PLA2 protein (figure 8A) and the lipoprotein binding state (figure 8B) reaches more than 0.99, and the regression coefficients are all about 5.1, which indicates that the Lp-PLA2 detection kit prepared by using LP-A and LP-B monoclonal antibodies has no difference when determining the Lp-PLA2 protein of the lipoprotein binding state and the non-lipoprotein binding state, and the kit can resist the interference of lipoprotein binding on the determination of the content of the Lp-PLA 2.

The experimental method is the same as that in example 7, and the results show that the linear regression straight-line slopes of the concentrations of the purified recombinant Lp-PLA2 protein (figure 9A) and the lipoprotein-bound Lp-PLA2 protein (figure 9B) measured by the prepared Lp-PLA2 content detection kit reach above 0.99, and the regression coefficients are all about 5.1, which indicates that the Lp-PLA2 detection kit prepared by using the LP-A and LP-B monoclonal antibodies has no difference when measuring the mixed solution and the pure Lp-PLA2 protein, and the kit can tolerate the interference of the phospholipase A2 homologous protein on the Lp-PLA2 content measurement.

Sequence listing

<110> Yuanhui Biotechnology Ltd in Chongqing

<120> anti-human lipoprotein-associated phospholipase A2 monoclonal antibody and application thereof

<130>2020

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>9

<212>PRT

<213>Mus musculus

<400>1

Gly Asn Ser Asn Thr Arg Asp Cys Ala

1 5

<210>2

<211>7

<212>PRT

<213>Mus musculus

<400>2

Ile Cys Tyr Asn Asp Ser Ser

1 5

<210>3

<211>11

<212>PRT

<213>Mus musculus

<400>3

Val Thr Ser Leu Leu Arg Pro Ser Leu Asp Asn

1 5 10

<210>4

<211>6

<212>PRT

<213>Mus musculus

<400>4

His Val Asp Thr Ser Pro

1 5

<210>5

<211>4

<212>PRT

<213>Mus musculus

<400>5

Ser Pro Cys Thr

1

<210>6

<211>9

<212>PRT

<213>Mus musculus

<400>6

Leu His His Tyr Ser Thr Ala Tyr Ser

1 5

<210>7

<211>8

<212>PRT

<213>MUS MUSCULUS

<400>7

Ala Tyr Ser Tyr Thr Glu Tyr Ser

1 5

<210>8

<211>8

<212>PRT

<213>MUS MUSCULUS

<400>8

Asn Lys Ala Tyr Ile Gly Arg Pro

1 5

<210>9

<211>16

<212>PRT

<213>MUS MUSCULUS

<400>9

Ala Arg Ala Arg Tyr Asn Tyr Ala Ser Cys Asn Tyr Gly Met His Phe

1 5 10 15

<210>10

<211>6

<212>PRT

<213>MUS MUSCULUS

<400>10

Leu Glu Ile Gly Lys Pro

1 5

<210>11

<211>4

<212>PRT

<213>MUS MUSCULUS

<400>11

Leu Thr Ser Arg

1

<210>12

<211>9

<212>PRT

<213>MUS MUSCULUS

<400>12

His Gln Arg Ile Thr His Arg Cys Thr

1 5

Claims

1. An anti-human Lp-PLA2 monoclonal antibody, or an antigen-binding portion thereof, comprising:

a) the heavy chain variable region CDR1 as set forth in SEQ ID NO. 1;

b) the heavy chain variable region CDR2 as set forth in SEQ ID NO. 2;

c) the heavy chain variable region CDR3 as set forth in SEQ ID NO. 3;

d) light chain variable region CDR1 as set forth in SEQ ID NO. 4;

e) light chain variable region CDR2 as set forth in SEQ ID NO. 5;

f) light chain variable region CDR3 as set forth in SEQ ID NO. 6;

Or

a) Heavy chain variable region CDR1 as set forth in SEQ ID NO. 7;

b) the heavy chain variable region CDR2 as set forth in SEQ ID NO. 8;

c) the heavy chain variable region CDR3 as set forth in SEQ ID NO. 9;

d) light chain variable region CDR1 as set forth in SEQ ID NO. 10;

e) light chain variable region CDR2 as set forth in SEQ ID NO. 11;

f) light chain variable region CDR3 as set forth in SEQ ID NO. 12;

the above-mentioned anti-human Lp-PLA2 monoclonal antibody or an antigen-binding portion thereof was designated as LP-B.

2. The monoclonal antibody LP- ｃA or LP-B of claim 1, wherein the monoclonal antibody LP- ｃA or LP-B specifically binds to human LP-plｃA2 protein, which recognizes LP-plｃA2 protein is not interfered with by plｃA2G3 and plｃA2G12A proteins.

3. The monoclonal antibody LP-A or LP-B according to claim 1 or 2, characterized in that the monoclonal antibody LP-A or LP-B binding site is located outside the lipoprotein binding region.

4.ｃA test kit comprising LP-plｃA2 of the monoclonal antibody LP- ｃA or LP-B of any one of claims 1-3.

5. The detection kit according to claim 4, wherein the kit is used for determining the concentration of LP-PLA2 protein by simultaneously recognizing LP-PLA2 protein through LP-A and LP-B.

6. A conjugate comprising the monoclonal antibody of any one of claims 1-3 covalently linked to a chemical or biological label.

7. A conjugate formed by coupling the monoclonal antibody of claim 1, and/or the conjugate of claim 6 to a solid or semi-solid medium.

8. Use of ｃA monoclonal antibody according to claim 1 and/or ｃA conjugate according to claim 6 and/or ｃA conjugate according to claim 7 for the preparation of ｃA product for detecting LP- ｃA or LP-B expression.