CN111658636B - Application of andrographolide and dexamethasone in preparation of compound medicine for resisting acute lymphocytic leukemia - Google Patents
Application of andrographolide and dexamethasone in preparation of compound medicine for resisting acute lymphocytic leukemia Download PDFInfo
- Publication number
- CN111658636B CN111658636B CN202010550895.1A CN202010550895A CN111658636B CN 111658636 B CN111658636 B CN 111658636B CN 202010550895 A CN202010550895 A CN 202010550895A CN 111658636 B CN111658636 B CN 111658636B
- Authority
- CN
- China
- Prior art keywords
- dexamethasone
- andrographolide
- lymphocytic leukemia
- acute lymphocytic
- compound medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/365—Lactones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
- A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses an application of andrographolide and dexamethasone in preparation of a compound medicine for resisting acute lymphocytic leukemia, and belongs to the technical field of medicines. The andrographolide and dexamethasone are used together, and can be used for preparing a compound medicine for resisting acute lymphocytic leukemia, and the expression of a glucocorticoid receptor, which is an action target of dexamethasone, is up-regulated through inhibiting an autophagy process, so that the sensitivity of an organism to dexamethasone is increased. The invention opens up a new application field of andrographolide and dexamethasone and a new compound medicine for resisting acute lymphocytic leukemia, and has positive pharmaceutical value and wide social significance. The invention also discloses a compound medicine for resisting acute lymphocytic leukemia. The compound medicine for resisting acute lymphocytic leukemia can effectively treat acute lymphocytic leukemia, has obvious treatment effect and small toxic and side effects, and is not easy to generate drug resistance.
Description
Technical Field
The invention relates to an application of andrographolide and dexamethasone in preparation of a compound medicine for resisting acute lymphocytic leukemia, and belongs to the technical field of medicines.
Background
Acute Lymphoblastic Leukemia (ALL) is a clonal disease characterized by a B or T lineage. ALL is a high-grade hematologic malignancy and is one of the most common malignancies of hematologic diseases worldwide. The diagnosis of acute lymphocytic leukemia is characterized by: there are a large number of lymphoblasts or lymphocytes in bone marrow and peripheral blood that can spread to lymph nodes, spleen, liver, central nervous system and other organs.
Glucocorticoid (glucocorticoids, GCs) drugs, such as Dexamethasone (Dexamethasone), are among the first choice drugs for chemotherapy of ALL. Dexamethasone is a basic chemotherapeutic drug for clinically treating acute lymphoblastic leukemia, is also an important component of combined chemotherapy, and mainly inhibits or reduces the number of ALL cells by activating a Glucocorticoid Receptor (GR) so as to achieve the effect of resisting ALL. According to the suggestion of the diagnosis and treatment guidelines for acute lymphoblastic leukemia of adults in China (2016 th edition), the maintenance dose of dexamethasone for treating acute lymphoblastic leukemia of adults is 0.75 mg/day. The existing medicine for treating acute lymphoblastic leukemia, which takes dexamethasone as the main stream, is not only easy to cause adverse reactions such as hypertension, osteoporosis and the like, but also poor in curative effect and easy to cause drug resistance due to long-term and large-dose use, so that the prognosis becomes worse. Therefore, there is a need to provide a new drug for treating acute lymphoblastic leukemia, so as to reduce the dosage of dexamethasone as much as possible, thereby reducing the above adverse reactions, improving drug resistance, and solving the deficiencies of the prior art.
Disclosure of Invention
The invention aims to provide the application of andrographolide and dexamethasone in preparing a compound medicine for resisting acute lymphocytic leukemia. Through a large number of experiments, the inventor of the application discovers that andrographolide and dexamethasone are combined, and the transcription of a dexamethasone action Receptor Glucocorticoid Receptor (GR for short) is increased, the degradation of Glucocorticoid Receptor protein is inhibited, the expression of the Glucocorticoid Receptor is increased, the sensitivity of cells to medicines is increased, the inhibition effect of dexamethasone on acute lymphocytic leukemia cells is obviously increased, the effect of resisting acute lymphocytic leukemia is exerted finally, and the dosage of dexamethasone, toxic and side effects thereof and the generation of drug resistance are effectively reduced by inhibiting cell lysosome autophagy. Therefore, the andrographolide and dexamethasone are combined for use, so that the andrographolide and dexamethasone can be used for preparing a compound medicine for resisting acute lymphocytic leukemia, a new application field of andrographolide and dexamethasone is developed, a new compound medicine for resisting acute lymphocytic leukemia is developed, and the andrographolide and dexamethasone compound preparation has positive pharmaceutical value and wide social significance.
The technical scheme for solving the technical problems is as follows: the application of andrographolide and dexamethasone in preparing compound medicine for resisting acute lymphocytic leukemia is provided.
The principle of the invention is as follows:
andrographolide (ANDROGRAPHOlide, abbreviated as AND) with molecular formula C20H30O5The chemical structural formula is as follows:
in the prior art, andrographolide is mainly used for bacillary dysentery, acute gastroenteritis, epidemic parotitis, tonsillitis, pharyngolaryngitis, upper respiratory tract infection and urinary tract infection. However, at present, there is no report that andrographolide can be used for preparing drug-resistant acute lymphocytic leukemia resisting drugs, and there is no report that andrographolide and dexamethasone can be used together for preparing acute lymphocytic leukemia resisting drugs.
The andrographolide is commercially available, such as from Sigma-Aldrich, Inc., USA, CAS number: 5508-58-7, cat no: 365645, analytical standard substance, HPLC is more than or equal to 99%.
The dexamethasone can be purchased commercially, e.g., from alfa aesar (tianjin) chemical limited, CAS No.: 50-02-2, cargo number: a17590, analytical standard, HPLC ≥ 99%.
The inventors of the present application paid much inventive work and conducted the following tests, respectively:
firstly, an experiment for detecting the influence of the combination of andrographolide and dexamethasone on cell viability by a CCK-8 method is carried out, and the conclusion is that: the combination of andrographolide and dexamethasone has effect in inhibiting proliferation of human acute lymphoblastic leukemia cells.
Secondly, a lysosome Red fluorescent probe (Lyso-Tracker Red for short) is used for detecting the pH value of lysosome, and the conclusion is that: andrographolide can alkalify lysosome cavity, increase lysosome pH value, and inhibit lysosome function.
Thirdly, a test of PCR detection of the expression of glucocorticoid receptor GR and autophagy gene Beclin-1 on RNA level is carried out, and the conclusion is that: the cells treated by the 50 mu M dexamethasone single-use group and the cells treated by the 5 mu M andrographolide and 50 mu M dexamethasone combined group have obviously increased glucocorticoid receptor GR expression level, and the glucocorticoid receptor GR expression level of the 5 mu M andrographolide and 50 mu M dexamethasone combined group is higher than that of the 50 mu M dexamethasone single-use group.
Fourth, WB experiments were performed to detect the expression of glucocorticoid receptor GR, autophagy gene LC3 ═ and autophagy gene Beclin-1 at the protein level, leading to the conclusion that: at the protein expression level, the expression of Beclin-1 of the cells treated by the combination group of 5 mu M andrographolide and 50 mu M dexamethasone was significantly reduced. The autophagy gene LC3 was up-regulated in cells treated with 50 μ M dexamethasone alone, 5 μ M andrographolide alone, and 5 μ M andrographolide plus 50 μ M dexamethasone in combination, which was self-protected by autophagy under drug pressure, but decreased LC3 expression in cells treated with 5 μ M andrographolide plus 50 μ M dexamethasone in combination compared to 50 μ M dexamethasone alone. Expression of GR was significantly upregulated in cells treated with the 5 μ M andrographolide plus 50 μ M dexamethasone combination group.
In conclusion, a large number of experiments show that andrographolide and dexamethasone are combined, and lysosome autophagy of cells is inhibited, so that the transcription of a Glucocorticoid Receptor (GR) serving as a dexamethasone action target is increased, the degradation of Glucocorticoid Receptor protein is inhibited, the expression of the Glucocorticoid Receptor is increased, the sensitivity of cells to drugs is increased, the inhibition effect of dexamethasone on acute lymphocytic leukemia cells is obviously increased, the effect of resisting acute lymphocytic leukemia is exerted finally, the dosage of dexamethasone (reduced from 0.75 mg/day to 0.05mg/kg) is effectively reduced, and toxic and side effects and drug resistance are generated. Therefore, the andrographolide and dexamethasone are combined for use, so that the andrographolide and dexamethasone can be used for preparing a compound medicine for resisting acute lymphocytic leukemia, a new application field of andrographolide and dexamethasone is developed, a new compound medicine for resisting acute lymphocytic leukemia is developed, and the andrographolide and dexamethasone compound preparation has positive pharmaceutical value and wide social significance.
The application of the andrographolide and dexamethasone in preparing the compound medicine for resisting acute lymphoblastic leukemia has the beneficial effects that:
the andrographolide and dexamethasone are used together, so that the compound anti-acute lymphocytic leukemia drug can be prepared, a new application field of the dexamethasone and the andrographolide is opened up, a new compound anti-acute lymphocytic leukemia drug is also opened up, and the compound anti-acute lymphocytic leukemia drug has positive pharmaceutical value and wide social significance.
On the basis of the technical scheme, the invention can be further improved as follows.
Further, the dosage of the andrographolide is 0.0026mg/kg, and the dosage of the dexamethasone is 0.05 mg/kg.
The adoption of the further beneficial effects is as follows: experiments show that in the compound medicine for resisting acute lymphocytic leukemia, the andrographolide and dexamethasone adopt the dosage to achieve the optimal drug effect. In addition, in the prior art, according to the suggestion of diagnosis and treatment guidelines for acute lymphocytic leukemia of Chinese adults (2016 edition), the maintenance dose of dexamethasone is 0.75 mg/day, while the dose of dexamethasone in the invention is 0.05mg/kg, which reduces 0.7 mg/day, greatly reduces the generation of toxic and side effects and drug resistance of dexamethasone, and has positive significance for patients with acute lymphocytic leukemia.
The second purpose of the invention is to provide a compound medicine for resisting acute lymphocytic leukemia. The compound medicine for resisting acute lymphocytic leukemia can effectively treat acute lymphocytic leukemia, has obvious treatment effect and small toxic and side effects, and is not easy to generate drug resistance.
The technical scheme for solving the technical problems is as follows: a compound medicine for resisting acute lymphocytic leukemia is characterized by comprising andrographolide, dexamethasone and a pharmaceutically acceptable carrier.
The compound medicine for resisting acute lymphocytic leukemia has the beneficial effects that:
the compound medicine for resisting acute lymphocytic leukemia can effectively treat acute lymphocytic leukemia, has obvious treatment effect and small toxic and side effects, and is not easy to generate drug resistance.
On the basis of the technical scheme, the invention can be further improved as follows.
Further, the carrier is any one or a mixture of more than two of a slow release agent, an excipient, a filler, a binder, a wetting agent, a disintegrating agent, an absorption enhancer, an adsorption carrier, a surfactant and a lubricant.
The adoption of the further beneficial effects is as follows: the carrier can change the mode of entering the human body and the distribution of the medicine in the human body, control the release speed of the medicine and deliver the medicine to a system of a target organ. The various drug carrier release and targeting systems can reduce the degradation and loss of the drug, reduce the side effect, improve the bioavailability, control the drug release speed, reduce or avoid the peak-valley fluctuation of the blood concentration, and ensure that the drug can stably and continuously exert the curative effect.
Further, the compound medicine for resisting acute lymphocytic leukemia is any one of an external preparation, an oral preparation and an injection preparation.
The adoption of the further beneficial effects is as follows: the compound medicine for resisting acute lymphoblastic leukemia can be prepared into medicines of various dosage forms, is suitable for various administration routes, such as external preparations, oral preparations or injection preparations, and the injection administration can be intradermal, subcutaneous, intramuscular, local or intravenous administration.
Further, the external preparation is a spray or an aerosol.
The further beneficial effects of the adoption are as follows: the external preparation is spray or aerosol, is convenient to use and has quick effect; can keep the medicine clean and sterile state and improve the stability of the medicine. Because the medicine is filled in the closed container, the medicine can be prevented from contacting with air, moisture and light, thereby reducing the possibility of pollution and deterioration; it can also reduce pain (such as burn and sensitive skin disease) and infection caused by topical application; the sprayed fog particles are tiny and can directly reach the action part or the absorption part, and are uniformly distributed, the administration dosage is small, and the side effect is small.
Further, the oral preparation is any one of granules, capsules, tablets and vesicant agents.
The further beneficial effects of the adoption are as follows: oral formulations are the most common route and are of great advantage in terms of safety, convenience and economy. The oral preparation can be granule, capsule, tablet, and capsule.
Furthermore, the injection preparation consists of andrographolide, dexamethasone, a cosolvent and 0.9% sodium chloride solution or water for injection.
The further beneficial effects of the adoption are as follows: the medicine effect is rapid, the dosage is accurate, and the effect is reliable; can be suitable for patients who are not suitable for oral administration and medicines which are not suitable for oral administration; can play a local positioning role.
Still further, the cosolvent is selected from any one or more of tween-80, propylene glycol, glycerol, ethanol and PEG-400.
Drawings
Fig. 1 shows the effect of andrographolide on the viability of human acute lymphoblastic leukemia cells measured by CCK-8 in example 1 of the present invention, where n is 3, P <0.001, and P <0.001, compared to the blank control group.
Fig. 2 shows the effect of dexamethasone on the viability of human acute lymphoblastic leukemia cells, n-3, P <0.001, compared to the blank control, as measured by CCK-8 in example 1 of the present invention.
Fig. 3 shows the effect of andrographolide and dexamethasone on the viability of human acute lymphoblastic leukemia cells in combination in example 1 of the present invention, where n is 3, P <0.001, and P <0.001, compared to the control group.
FIG. 4 is a graph showing the results of staining human acute lymphocytic leukemia cells of an empty control group with a lysosomal red fluorescent probe, at 200-fold magnification, in example 2 of the present invention.
FIG. 5 is a graph showing the results of staining human acute lymphocytic leukemia cells of the 5 μ M andrographolide group with a lysosomal red fluorescent probe, at 200-fold magnification, in example 2 of the present invention.
FIG. 6 is a graph showing the results of staining human acute lymphoblastic leukemia cells in the 50. mu.M dexamethasone group with a lysosome red fluorescent probe, at 200-fold magnification, in example 2 of the present invention.
FIG. 7 is a graph showing the results of staining human acute lymphocytic leukemia cells in the combination group of 5. mu.M andrographolide and 50. mu.M dexamethasone with a lysosomal red fluorescent probe, at 200-fold magnification, in example 2 of the present invention.
FIG. 8 is a fluorescent quantitative PCR map of the autophagy gene Beclin-1 from total RNA extracted 24h after drug intervention.
FIG. 9 is a fluorescent quantitative PCR map of glucocorticoid receptor GR extracted from total RNA after 24h of drug intervention.
FIG. 10 is a graph showing the effect of 5. mu.M andrographolide plus 50. mu.M dexamethasone on the expression of the Beclin-1 protein, an autophagy gene, in example 4 of the present invention. Compared with a blank control group and a 50 mu M dexamethasone single-use group, in a combined group of 5 mu M andrographolide and 50 mu M dexamethasone, the expression of Beclin-1 of the human acute lymphoblastic leukemia cells is obviously up-regulated.
FIG. 11 is a graph showing the quantitative analysis of the gray scale value of the expression of the Beclin-1 protein in the autophagy gene in example 4 by using 5. mu.M andrographolide and 50. mu.M dexamethasone. N-3, P <0.01 compared to placebo; p < 0.001; # P <0.05 compared to 50 μ M dexamethasone alone; # #, P < 0.001.
FIG. 12 is a graph showing the effect of 5. mu.M andrographolide plus 50. mu.M dexamethasone on the expression of autophagy gene LC3 protein in example 4 of the present invention. The autophagy gene LC3 of the administration group was up-regulated compared with the blank control group; the expression of autophagy gene LC3 was reduced in the combination group of 5. mu.M andrographolide plus 50. mu.M dexamethasone compared to the group of 50. mu.M dexamethasone alone.
FIG. 13 is a graph showing the gray scale value quantitative analysis of the autophagy gene LC3 protein expression in the combination of 5. mu.M andrographolide and 50. mu.M dexamethasone in example 4 of the present invention. N-3, P <0.01 compared to placebo; p < 0.001; # P <0.05 compared to 50 μ M dexamethasone alone; # #, P < 0.001.
FIG. 14 is a graph showing the effect of 5. mu.M andrographolide plus 50. mu.M dexamethasone on the expression of the glucocorticoid receptor GR protein in the combination of example 4 of the present invention. Compared with a blank control group and a 50 mu M dexamethasone single-use group, the expression of GR of the human acute lymphoblastic leukemia cells is obviously up-regulated in a 5 mu M andrographolide and 50 mu M dexamethasone combined group.
FIG. 15 is a graph of gray scale value quantitative analysis of glucocorticoid receptor GR protein expression in the combination of 5 μ M andrographolide and 50 μ M dexamethasone in example 4 of the present invention. N-3, P <0.01 compared to placebo; p < 0.001; # P <0.05 compared to 50 μ M dexamethasone alone; # #, P < 0.001.
Detailed Description
The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.
Example 1: the combination of andrographolide and dexamethasone has effect in inhibiting proliferation of human acute lymphocytic leukemia cells
Taking human acute lymphoblastic leukemia cells (CEM/C1 cells) in logarithmic growth phase, and culturing at 1 × 105cell/mL, using 1640 complete medium to make single cell suspension. Wherein the 1640 complete culture medium is prepared according to the following volume ratio: 1640 medium (Gibco,500 ml): fetal bovine serum (yerba mate longera, 500 ml): penicillin streptomycin mixed solution (Hyclone, 100ml) is 89:10: 1.
The experiment was set up with an addition group, a blank control group and a solvent control group. The method comprises the following specific steps:
taking the single cell suspension, inoculating the single cell suspension into a 96-well plate according to 100 mu l/well, setting 3 multiple wells for each experimental group, and adding the medicines according to the following groups after 24 hours:
1. adding a medicine group: andrographolide at different concentrations (1.25 μ M, 2.5 μ M, 5 μ M, 10 μ M, 20 μ M and 40 μ M);
different concentrations of dexamethasone (12.5. mu.M, 25. mu.M, 50. mu.M, 100. mu.M, 200. mu.M and 400. mu.M);
andrographolide and dexamethasone were combined at different concentrations (1.25 μ M andrographolide plus 12.5 μ M dexamethasone, 2.5 μ M andrographolide plus 25 μ M dexamethasone, 5 μ M andrographolide plus 50 μ M dexamethasone, 10 μ M andrographolide plus 100 μ M dexamethasone).
2. Blank control (control): only an equal amount of 1640 complete medium was added.
3. Solvent control group (vehicle): dimethyl sulfoxide (DMSO) was added at a concentration corresponding to the highest dose of andrographolide (40. mu.M).
After 24h of drug intervention, CCK-8(DOJINDO, 3000tests) was added, after which cell viability was measured using a microplate reader and the absorbance value A of the cells was measured at 450 nm.
The human acute lymphoblastic leukemia cell growth rate (%) was calculated according to the following formula:
human acute lymphoblastic leukemia cell growth rate (%) (mean a value in dosing/mean a value in blank control) x 100%.
CompuSyn software was used to calculate the Combination Index (CI) of andrographolide and dexamethasone. If CI is less than 1, the combination of the two medicines is considered as a synergistic effect; if CI is 1, the two drugs are considered to be combined to have additive effect; if CI is more than 1, the combination of the two medicines is considered as antagonism.
The results are shown in FIGS. 1-3 and tables 1-4.
TABLE 1 CCK-8 method for detecting the effect of andrographolide on the cell viability of human acute lymphoblastic leukemia
| Andrographolide concentration (. mu.M) | Human acute lymphoblastic leukemia cell growth rate (%) |
| Blank control group | 100.00±0.00 |
| 1.25 | 95.39±1.78 |
| 2.5 | 85.83±3.01 |
| 5 | 63.35±3.01 |
| 10 | 35.32±4.12 |
| 20 | 25.65±4.34 |
| 40 | 24.00±4.81 |
TABLE 2 CCK-8 method for detecting the effect of dexamethasone on the cell viability of human acute lymphoblastic leukemia
| Dexamethasone concentration (μ M) | Human acute lymphoblastic leukemia cell growth rate (%) |
| Blank control group | 100.00±0.00 |
| 12.5 | 84.45±2.92 |
| 25 | 81.87±2.43 |
| 50 | 81.32±3.02 |
| 100 | 77.57±2.90 |
| 200 | 75.02±1.97 |
| 400 | 70.80±2.17 |
TABLE 3 CCK-8 method for detecting the effect of andrographolide and dexamethasone on the activity of human acute lymphoblastic leukemia cells
| Dexamethasone/andrographolide concentration (μ M) | Human acute lymphoblastic leukemia cell growth rate (%) |
| Blank control group | 100.00±0.00 |
| Solvent control group | 109.80±9.76 |
| 12.5/1.25 | 78.30±6.02 |
| 25/2.5 | 67.42±5.05 |
| 50/5 | 49.32±2.81 |
| 100/10 | 26.82±2.28 |
TABLE 4 results of index analysis in combination
| Andrographolide (mu M) | Dexamethasone (. mu.M) | Inhibition ratio (%) | Combination index CI |
| 1.25 | 12.5 | 22 | 0.48571 |
| 2.5 | 25 | 33 | 0.55178 |
| 5 | 50 | 51 | 0.70298 |
| 10 | 100 | 73 | 0.80868 |
The results in figures 1-2 and tables 1-2 show that the drug acts on human acute lymphocytic leukemia cells for 24h, and compared with a blank control group, the andrographolide alone or dexamethasone alone decreases the cell viability with the increase of the drug concentration.
The results in fig. 3 and table 3 show that the cell viability decreased with increasing drug concentration in the combination group compared to the blank control group, and the results were statistically significant.
The results in Table 4 show that the combination index CI is the mean of the combination index for 4 dose combinations of andrographolide and dexamethasone at a volume concentration of 1:10<1, the combination of the two medicines has a synergistic effect. Considering half inhibition rate (IC for short)50) Therefore, the drug concentration with 51% inhibition was chosen for the subsequent experiments (i.e. 5 μ M andrographolide plus 50 μ M dexamethasone).
Example 2: test for detecting pH value of lysosome by lysosome Red fluorescent probe (Lyso-Tracker Red for short)
Four groups were set up for the experiment, as follows:
1. blank Control (Control).
2.5 μ M andrographolide group alone.
3. 50 μ M dexamethasone alone.
4. 5 μ M andrographolide plus 50 μ M dexamethasone.
Taking human acute lymphoblastic leukemia cells in the logarithmic phase of growth, transferring the cells into a 15mL centrifuge tube, centrifuging at 1000rpm/min for 5min, firstly adding 2mL 1640 complete culture medium for resuspending the cells, and then using the 1640 complete culture medium to adjust the cell density to be 5 multiplied by 104cell/mL, seeded in 6-well plates, 2mL cell suspension per well, and drug at the corresponding concentration was added to interfere with the cells. After the 6-well plate is placed in a cell culture box for culturing for 24h, the plate is respectively transferred into 15mL centrifuge tubes and centrifuged at 1000rpm for 5 min. During this period, it was protected from light and lysosome red fluorescent probe by volume: lysosome red fluorescent probe dye is configured in a 1640 complete culture medium preheated at 37 ℃ in a ratio of 1: 15000.
The supernatant medium was discarded and the cells were washed once with 2mL each of sterile PBS. After centrifugation, the supernatant was discarded, and each group was resuspended in 2mL of the above diluted lysosomal red fluorescent probe dye, incubated in an incubator at 37 ℃ for 20min, then centrifuged at 1000rpm/min for 5min, the supernatant was discarded, and each group was washed once with 2mL of sterile PBS, and this step was repeated 3 times.
The results are shown in FIGS. 4-7 and Table 5.
TABLE 5 real-time quantitative PCR detection of expression of the autophagy gene Beclin-1
| Group of | Related expression of Beclin1 |
| Blank control group | 1.00±0.00 |
| Andrographolide 5 μ M | 1.11±0.06 |
| |
1.66±0.07 |
| Andrographolide 5 μ M + |
1.33±0.06 |
TABLE 6 expression results of GR detected by real-time quantitative PCR
| Group of | Expression of GR |
| Blank control group | 1.00±0.00 |
| Andrographolide 5 μ M | 1.11±0.07 |
| |
4.60±0.67 |
| Andrographolide 5 μ M + |
5.38±0.48 |
TABLE 7 results of quantitative analysis of the grey values of Beclin 1/beta-actin protein expression
| Group of | Relative gray scale value of |
| Blank control group | 1.04±0.06 |
| Andrographolide 5 μ M + |
0.87±0.01 |
| Andrographolide 5 μ M | 1.03±0.05 |
| |
1.00±0.02 |
TABLE 8 results of grey value quantitative analysis of LC3 protein expression
| Group of | Relative gray scale value of LC 3/beta-actin |
| Blank control group | 0.77±0.22 |
| Andrographolide + dexamethasone | 0.69±0.13 |
| Andrographolide 5 μ M | 1.13±0.46 |
| |
1.19±0.19 |
TABLE 9 quantitative analysis results of grey scale values for GR/beta-actin protein expression
| Group of | Relative gray scale value of GR/beta-actin |
| Blank control group | 0.84±0.02 |
| Andrographolide 5 μ M + |
1.21±0.04 |
| Andrographolide 5 μ M | 0.90±0.10 |
| |
0.90±0.03 |
As can be seen from FIGS. 4-7, the lysosomal red fluorescent probe was used to stain the human acute lymphoblastic leukemia cells in the blank control group, the 5 μ M andrographolide single-use group, the 50 μ M dexamethasone single-use group, and the 5 μ M andrographolide plus 50 μ M dexamethasone combined group, and all of the human acute lymphoblastic leukemia cells exhibited red fluorescence.
Therefore, after the human acute lymphoblastic leukemia cells are treated by different factors for 24 hours, compared with a single-use group of 50 mu M dexamethasone, the red fluorescence intensity of a combined group of 5 mu M andrographolide and 50 mu M dexamethasone is obviously weakened, which indicates that andrographolide can alkalify a lysosome cavity, improve the pH value of a lysosome and further inhibit the function of the lysosome.
Example 3: test for detecting expression of glucocorticoid receptor GR and autophagy gene Beclin-1 on RNA level by real-time quantitative PCR
1. Experimental methods
1.1 extraction and concentration determination of RNA from human acute lymphocytic leukemia cells
The experiment was divided into four groups, specifically as follows:
(1) blank Control (Control).
(2)5 μ M andrographolide group alone.
(3)50 μ M dexamethasone alone.
(4)5 μ M andrographolide plus 50 μ M dexamethasone.
Taking human acute lymphoblastic leukemia cells in the logarithmic phase of growth, transferring the cells into a 15mL centrifuge tube, centrifuging at 1000rpm/min for 5min, firstly adding 2mL 1640 complete culture medium for resuspending the cells, and then using the 1640 complete culture medium to adjust the cell density to be 5 multiplied by 104cell/mL, seeded in 6-well plates, 2mL cell suspension per well, and drug at the corresponding concentration was added to interfere with the cells. Placing the 6-hole plate in a cell culture box for culturing for 24h, transferring the 6-hole plate into 15mL centrifuge tubes respectively, centrifuging the 6-hole plate at 1000rpm/min for 5min, discarding a supernatant culture medium, adding 2mL sterile PBS to wash the cells once respectively, blowing the cells lightly, fully washing, centrifuging the cells at 1000rpm/min for 5min, discarding supernatant PBS, repeating the step for 2 times, and discarding the supernatant PBS. 1mL of TRIZOL reagent was added, and after repeated pipetting, the mixture was transferred to a 2mL enzyme-removed EP tube, and allowed to stand at room temperature for 5min, followed by addition of 200. mu.L of chloroform, vortexing for 15s, and allowed to stand at room temperature for 3min, and the above EP tube was centrifuged at 12000rpm/min for 15min in a refrigerated centrifuge at 4 ℃. Gently take the EP tube, carefully suck 350 μ L of supernatant (avoiding sucking in middle layer protein) into a new enzyme-removed EP tube by using a pipette, add 500 μ L of precooled isopropanol, fully mix, place on a test tube rack, stand for 10min at room temperature, continue to centrifuge at 4 ℃ for 10min at 12000rpm/min, gently discard the supernatant, add 1mL of 75% ethanol, vortex and resuspend the RNA precipitate, fully wash it, centrifuge at 7500rpm/min in a 4 ℃ refrigerated centrifuge for 5min, discard the supernatant, place on clean paper and air dry to be semitransparent, add 20 μ L of RNase-free water by using a pipette to dissolve the RNA precipitate, and measure the concentration of RNA extracted from each group by using a NANODROPP 2000 ultramicro spectrophotometer after dissolution.
1.2 RNA reverse transcription
A commercially available Kit "RevertAID First Strand cDNA Synthesis Kit" (Thermofisher). And (3) placing the reagent in the kit on ice, dissolving the reagent by a program, placing the RNA with the detected concentration in the step 1.1 on the ice, and preparing a system according to the kit specification to perform an RNA reverse transcription experiment. The first sample addition of reverse transcription was carried out in 0.2mL of labeled EP tubes without enzyme, respectively, as follows: RNA 2. mu.g, oligo-thymine primer (oligo (dT)), 1. mu.L; RNase-Free Water (DNase/RNase-Free Water) was supplemented to 12. mu.L. After the sample application, flick the bottom of the tube and instantly separate for 30s, react for 5min at 65 ℃ on a gradient PCR instrument, and after the reaction is finished, place on ice for 2 min.
Then, the sample is added in the second step of reverse transcription, and the system is as follows: 5 × Reaction Buffer 4 μ L; 20U/. mu.L of ribonuclease inhibitor, 1. mu.L; 10mM dNTP Mix, 2. mu.L; 200U/. mu.L reverse transcriptase, 1. mu.L, total volume 20. mu.L.
After the sample is added, the bottom of the tube is flicked and separated instantly for 30s, and then reverse transcription reaction is carried out, wherein the reaction program is as follows: 60min at 42 ℃; 5min at 70 ℃; 4 ℃ and infinity. The product cDNA of the reverse transcription reaction is stored at-80 ℃ for later use.
1.3 PCR detection of glucocorticoid receptor GR and expression of autophagy gene Beclin-1 at RNA level
The primer sequences are specifically as follows:
GAPDH as internal control, forward primer: caggaggcattgctgatgat (SEQ ID NO.1), reverse primer: gaaggctggggctcattt (SEQ ID NO. 2).
GR, forward primer: aggaccacctcccaaactct (SEQ ID NO.3), reverse primer: atctaaggagctgccgttatac (SEQ ID NO. 4).
Beclin-1, forward primer: atctaaggagctgccgttatac (SEQ ID NO.5), reverse primer: ctcctcagagttaaactgggtt (SEQ ID NO. 6).
According to the primer specification, before uncovering, the tube filled with the primer is centrifuged at 4000rpm/min for 30-60 s, the cover is slowly opened, quantitative enzyme-removed water is added to prepare 100 mu M storage solution, the cover is covered, the storage solution is fully shaken and uniformly mixed, and the mixture is placed at the temperature of minus 20 ℃ for storage for later use.
And (3) carrying out qPCR detection on the product cDNA obtained by the reverse transcription reaction in the step 1.2 to determine the influence of four experimental groups on the mRNA expression levels of glucocorticoid receptor GR and autophagy gene Beclin-1 in the human acute lymphoblastic leukemia cells.
The PCR reaction system is as follows: 2 × SYBR, 10 μ L; 10 μ M cDNA, 5 μ L; forward primer, 1 μ L; reverse primer, 1 μ L; RNase free water, 3. mu.L; total volume, 20 μ L.
After the sample is added, the bottom of the tube is flicked and separated instantly for 30s, and then qPCR reaction is carried out, wherein the program is as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 10s, extension at 60 ℃ for 20s, and annealing at 72 ℃ for 20s for 40 cycles.
After the reaction was completed, the cycle number (Cq value) and the dissolution curve at which the fluorescence threshold value was reached were recorded for each sample. Experiments are provided with 3 multiple holes, the difference of Cq between the multiple holes is less than 0.5, and the experiments are repeated for 3 times. The standard amplification curve should be sigmoidal, with Cq values between 20 and 30, and the quantitative analysis is most accurate by default. A single peak of the dissolution curve shows that non-specific amplification is avoided, the specificity is good, and the result can be quantitatively analyzed.
2. Results of the experiment
As shown in fig. 8-9.
As can be seen from FIG. 8, the cells treated with 50 μ M dexamethasone alone and 5 μ M andrographolide plus 50 μ M dexamethasone in combination showed significantly higher levels of expression of the autophagy gene Beclin-1, but the 5 μ M andrographolide plus 50 μ M dexamethasone in combination was significantly lower than the 50 μ M dexamethasone alone (# P < 0.001).
As can be seen from FIG. 9, the GR expression levels were significantly increased in the cells treated with 50 μ M dexamethasone alone and the 5 μ M andrographolide plus 50 μ M dexamethasone in combination, compared to the blank control, and the GR expression levels were higher in the 5 μ M andrographolide plus 50 μ M dexamethasone combination than in the 50 μ M dexamethasone alone.
Example 4: WB test for detecting the expression of glucocorticoid receptor GR, autophagy gene LC3 and autophagy gene Beclin-1 at protein level
After the four experimental groups respectively treat the human acute lymphoblastic leukemia cells for 24 hours, the cells are collected into a centrifuge tube, the centrifuge tube is centrifuged at 1000rpm/min for 3min to collect the cells through precipitation, the supernatant is discarded and washed by precooled PBS, the cells are centrifuged and precipitated again, the cells are lysed by RIPA lysate, and then the protein concentration is detected by a BCA kit (500T, Shanghai Yazyme Biotechnology Co., Ltd.). Adding 5 Xloading buffer, mixing, and boiling for 5 min. SDS-PAGE was performed, and the resulting mixture was transferred onto a PVDF-immobilized carrier. Sealing with 5% of skimmed milk powder for 2h, and mixing the PVDF membrane with the skimmed milk powder at 4 ℃ in a volume ratio of 1: 1000 GR, LC3, Beclin-1, beta-actin were incubated overnight to allow the antibodies to bind to the antigenic proteins on the PVDF membrane. The following day, the PVDF membrane was washed 3 times with 1 XTSST for 10 min/time, after which the GR-, LC 3-, Beclin-1-incubated PVDF membrane was incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (H + L) for 2H at room temperature, and the β -actin-incubated PVDF membrane was incubated with horseradish peroxidase-labeled goat anti-mouse IgG (H + L) for 2H at room temperature. After that, the plates were rinsed 3 times with 1 × TBST for 10min each. In dark place, ECL color developing solution is dripped on the PVDF membrane, and reaction is carried out for 1-3 min. The gel imaging system collected the Image and the results were grey scale analyzed for bands using Image J software.
The results are shown in FIGS. 10-15.
As can be seen from FIGS. 10 and 11, the expression of the autophagy gene Beclin-1 was significantly reduced in the 5. mu.M andrographolide plus 50. mu.M dexamethasone combination group (P <0.01) compared to the blank control group. The level of decrease in the autophagy gene Beclin-1 was statistically significant in the 5 μ M andrographolide plus 50 μ M dexamethasone combination group compared to the 50 μ M dexamethasone alone group (P < 0.05).
As can be seen from fig. 12 and 13, autophagy gene LC3 was up-regulated in the 5 μ M andrographolide alone group, the 50 μ M dexamethasone alone group, and the 5 μ M andrographolide plus 50 μ M dexamethasone combination group, compared to the blank control group. This is because, under drug stress, cells self-protect by autophagy. However, the expression of autophagy gene LC3 was reduced and statistically significant in the combined 5 μ M andrographolide plus 50 μ M dexamethasone group compared to the 50 μ M dexamethasone alone group (P < 0.05).
As can be seen from FIGS. 14 and 15, the expression of glucocorticoid receptor GR in human acute lymphoblastic leukemia cells was significantly increased in the combined 5 μ M andrographolide and 50 μ M dexamethasone group (P <0.001) compared to the placebo group, the 5 μ M andrographolide alone group, and the 50 μ M dexamethasone alone group.
Therefore, when the combination of 5 mu M andrographolide and 50 mu M dexamethasone is used, the degradation of autophagy genes LC3 and Beclin-1 can be reduced by down-regulating the expression of autophagy lysosomes to GR, the expression level of GR receptors can be up-regulated, the glucocorticoid resistance of human acute lymphoblastic leukemia cells can be reversed, and the effect of anti-ALL can be achieved. Compared with the growth inhibition rate of 20 mu M chloroquine combined with 100 mu M dexamethasone to 48.6 percent of human acute lymphoblastic leukemia cells, the growth inhibition rate of 5 mu M andrographolide with lower concentration and 50 mu M dexamethasone to the same cell strain reaches 51 percent.
In conclusion, the inventor of the present application finds, through the above tests, that andrographolide and dexamethasone are used together, and cell lysosome autophagy is inhibited, so that transcription of a Glucocorticoid Receptor (GR) serving as a target of dexamethasone action is increased, degradation of Glucocorticoid Receptor protein is inhibited, and expression of the Glucocorticoid Receptor is increased, so that sensitivity of cells to drugs is increased, inhibition of dexamethasone to acute lymphocytic leukemia cells is significantly increased, an acute lymphocytic leukemia resisting effect is finally exerted, and consumption of dexamethasone, toxic and side effects thereof and generation of drug resistance are effectively reduced. Therefore, the andrographolide and dexamethasone are combined for use, so that the compound anti-acute lymphocytic leukemia drug can be prepared, a new application field of the dexamethasone and the andrographolide is opened up, a new compound anti-acute lymphocytic leukemia drug is also opened up, and the compound anti-acute lymphocytic leukemia drug has positive pharmaceutical value and wide social significance.
According to the dose of andrographolide (5 μ M) and dexamethasone (50 μ M) in the cell experiment, the dose of andrographolide in the compound anti-acute lymphoblastic leukemia medicine is 0.0026mg/kg and the dose of dexamethasone is 0.05mg/kg, which are converted into the dose for human use according to pharmacological experimental methodology (third edition) (Xutert-cloud master catalog, people health Press, 2002).
The invention also provides a compound medicine for resisting acute lymphocytic leukemia, which comprises andrographolide, dexamethasone and a pharmaceutically acceptable carrier.
The carrier is any one or a mixture of more than two of a sustained release agent, an excipient, a filler, an adhesive, a wetting agent, a disintegrating agent, an absorption enhancer, an adsorption carrier, a surfactant and a lubricant.
The compound medicine for resisting acute lymphocytic leukemia is any one of external preparation, oral preparation and injection preparation.
The external preparation is a spray or an aerosol.
The oral preparation is any one of granules, capsules, tablets and vesicular agents.
The injection preparation consists of andrographolide, dexamethasone, a cosolvent and 0.9% sodium chloride solution or water for injection.
The cosolvent is selected from any one or more of tween-80, propylene glycol, glycerol, ethanol and PEG-400.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Guilin medical college
Application of andrographolide and dexamethasone in preparation of compound medicine for resisting acute lymphocytic leukemia
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gaaggctggg gctcattt 18
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atctaaggag ctgccgttat ac 22
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atctaaggag ctgccgttat ac 22
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctcctcagag ttaaactggg tt 22
Claims (9)
1. The application of andrographolide and dexamethasone in preparing compound medicine for resisting acute lymphocytic leukemia is provided.
2. The use of claim 1, wherein the andrographolide is administered at a dose of 0.0026mg/kg and the dexamethasone is administered at a dose of 0.05 mg/kg.
3. The use of claim 1, wherein the compound anti-acute lymphocytic leukemia drug comprises andrographolide, dexamethasone, and a pharmaceutically acceptable carrier.
4. The use according to claim 3, wherein the carrier is any one or a mixture of two or more of a sustained-release agent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption enhancer, an adsorption carrier, a surfactant and a lubricant.
5. The use of claim 3, wherein the compound anti-acute lymphoblastic leukemia drug is any one of an external preparation, an oral preparation and an injection preparation.
6. The use according to claim 5, wherein the external preparation is a spray or an aerosol.
7. The use according to claim 5, wherein the oral preparation is any one of granules, capsules, tablets and caplets.
8. The use of claim 5, wherein the injectable formulation consists of andrographolide, dexamethasone, a cosolvent, and 0.9% sodium chloride solution or water for injection.
9. The use according to claim 8, wherein the cosolvent is selected from any one or more of tween-80, propylene glycol, glycerol, ethanol and PEG-400.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2020105335238 | 2020-06-12 | ||
| CN202010533523 | 2020-06-12 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111658636A CN111658636A (en) | 2020-09-15 |
| CN111658636B true CN111658636B (en) | 2021-04-13 |
Family
ID=72388157
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010550895.1A Active CN111658636B (en) | 2020-06-12 | 2020-06-16 | Application of andrographolide and dexamethasone in preparation of compound medicine for resisting acute lymphocytic leukemia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111658636B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112315907A (en) * | 2020-12-18 | 2021-02-05 | 河南牧翔动物药业有限公司 | Andrographolide oral liquid and preparation method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006020618A8 (en) * | 2004-08-10 | 2006-11-02 | Inex Pharmaceuticals Corp | Compositions and methods for treating leukemia |
| CN102481284A (en) * | 2009-03-24 | 2012-05-30 | 新加坡国立大学 | Use of andrographolide compounds for treating inflammation and airway disorders |
| CN102657846A (en) * | 2012-06-02 | 2012-09-12 | 哈尔滨工业大学 | Compound traditional Chinese medicine active ingredient preparation used for treating leukemia and production method thereof |
| US8575216B2 (en) * | 2009-08-04 | 2013-11-05 | Rutgers, The State University Of New Jersey | Method of treatment for acute myelogenous leukemia |
| CN104042618A (en) * | 2008-11-13 | 2014-09-17 | 吉里德卡利斯托加公司 | Therapies For Hematologic Malignancies |
-
2020
- 2020-06-16 CN CN202010550895.1A patent/CN111658636B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006020618A8 (en) * | 2004-08-10 | 2006-11-02 | Inex Pharmaceuticals Corp | Compositions and methods for treating leukemia |
| CN104042618A (en) * | 2008-11-13 | 2014-09-17 | 吉里德卡利斯托加公司 | Therapies For Hematologic Malignancies |
| CN102481284A (en) * | 2009-03-24 | 2012-05-30 | 新加坡国立大学 | Use of andrographolide compounds for treating inflammation and airway disorders |
| US8575216B2 (en) * | 2009-08-04 | 2013-11-05 | Rutgers, The State University Of New Jersey | Method of treatment for acute myelogenous leukemia |
| CN102657846A (en) * | 2012-06-02 | 2012-09-12 | 哈尔滨工业大学 | Compound traditional Chinese medicine active ingredient preparation used for treating leukemia and production method thereof |
Non-Patent Citations (1)
| Title |
|---|
| Andrographolide Restores Steroid Sensitivity To Block Lipopolysaccharide/IFN- g-Induced IL-27 and Airway Hyperresponsiveness in Mice;Wupeng Liao et al.;《The Journal of Immunology》;20160502;第196卷;第4706-4712页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111658636A (en) | 2020-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chapple et al. | Randomized double-blind, active-controlled phase 3 study to assess 12-month safety and efficacy of mirabegron, a β3-adrenoceptor agonist, in overactive bladder | |
| TWI620565B (en) | Methods of treating and preventing graft versus host disease | |
| Frank et al. | IL-1RA blocks E. coli-induced suppression of Arc and long-term memory in aged F344× BN F1 rats | |
| EP3247375B1 (en) | Anti-senescence compounds and uses thereof | |
| TW200306825A (en) | New use | |
| EP2978439B1 (en) | A combination of a cxcr4 antagonist and cytarabine for use in treating myeloid leukemia | |
| CN110478353B (en) | Methods of treating and preventing alloantibody-driven chronic graft-versus-host disease | |
| JP6900358B2 (en) | Cell-free composition for cell restoration and method of preparation and use of the same composition | |
| CN111467345B (en) | Application of dexamethasone, rosiglitazone and 3-isobutyl-1-methylxanthine composition in preparing medicine for inhibiting growth and metastasis of ovarian cancer cells induced by cobalt chloride | |
| EP3807410A1 (en) | Combination therapies comprising c/ebp alpha sarna | |
| CN111658636B (en) | Application of andrographolide and dexamethasone in preparation of compound medicine for resisting acute lymphocytic leukemia | |
| Yirmiya et al. | The role of brain cytokines in mediating the behavioral and neuroendocrine effects of intracerebral mycoplasma fermentans | |
| US10123997B2 (en) | Target for treating hepatitis B virus | |
| Kumar et al. | Oxalate disrupts monocyte and macrophage cellular function via Interleukin-10 and mitochondrial reactive oxygen species (ROS) signaling | |
| CN112656808A (en) | Application of heparin oligosaccharide in preparation of antitumor drugs | |
| CN117298121A (en) | Application of dandelionsterol in helicobacter pylori induced gastritis or gastric cancer | |
| CN108078987A (en) | Purposes of the albendazole in the drug for preparing treatment glioblastoma | |
| Wang et al. | CCR2 improves homing and engraftment of adipose-derived stem cells in dystrophic mice | |
| CN113995753A (en) | Application of Chinese medicinal molecular sophocarpine in preparing medicament for treating glioblastoma | |
| Gao et al. | Qiyusanlong Formula Induces Autophagy in Non‐Small‐Cell Lung Cancer Cells and Xenografts through the mTOR Signaling Pathway | |
| CN116440272B (en) | Application of GPVI inhibitor in preparation of medicine for treating fever with thrombocytopenia syndrome | |
| CN112553342B (en) | Biomarker for diagnosing lung adenocarcinoma and application thereof | |
| Du et al. | Hastatoside attenuatescarbon tetrachloride-induced liver fibrosis by targeting glycogen synthase kinase-3β | |
| US11617729B2 (en) | Uses of guanidine hydrochloride as a drug for treating cancers/tumors | |
| CN111588710B (en) | Combined drug for EGFR drug-resistant mutation C797S and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |