CN111647081A - Recombinant mouse anti-human interleukin 19 monoclonal antibody, preparation method and application - Google Patents
Recombinant mouse anti-human interleukin 19 monoclonal antibody, preparation method and application Download PDFInfo
- Publication number
- CN111647081A CN111647081A CN202010350291.2A CN202010350291A CN111647081A CN 111647081 A CN111647081 A CN 111647081A CN 202010350291 A CN202010350291 A CN 202010350291A CN 111647081 A CN111647081 A CN 111647081A
- Authority
- CN
- China
- Prior art keywords
- variable region
- chain variable
- human interleukin
- heavy chain
- light chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 102000001933 Interleukin-19 Human genes 0.000 title claims abstract description 47
- 108050009288 Interleukin-19 Proteins 0.000 title claims abstract description 47
- 238000002360 preparation method Methods 0.000 title abstract description 11
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 66
- 125000003275 alpha amino acid group Chemical group 0.000 claims abstract description 10
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 5
- 238000000338 in vitro Methods 0.000 claims abstract description 4
- 101000960946 Homo sapiens Interleukin-19 Proteins 0.000 claims description 39
- 230000003321 amplification Effects 0.000 claims description 15
- 238000000034 method Methods 0.000 claims description 15
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 15
- 239000002299 complementary DNA Substances 0.000 claims description 14
- 239000013612 plasmid Substances 0.000 claims description 14
- 210000004027 cell Anatomy 0.000 claims description 13
- 238000012163 sequencing technique Methods 0.000 claims description 13
- 102000050317 human IL19 Human genes 0.000 claims description 12
- 210000004408 hybridoma Anatomy 0.000 claims description 10
- 239000013604 expression vector Substances 0.000 claims description 8
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 7
- 239000000427 antigen Substances 0.000 claims description 7
- 102000036639 antigens Human genes 0.000 claims description 7
- 108091007433 antigens Proteins 0.000 claims description 7
- 238000013461 design Methods 0.000 claims description 7
- 239000012634 fragment Substances 0.000 claims description 7
- 230000003053 immunization Effects 0.000 claims description 6
- 238000010839 reverse transcription Methods 0.000 claims description 6
- 239000000047 product Substances 0.000 claims description 4
- 238000001742 protein purification Methods 0.000 claims description 4
- 210000004988 splenocyte Anatomy 0.000 claims description 4
- 241000894006 Bacteria Species 0.000 claims description 3
- 238000012408 PCR amplification Methods 0.000 claims description 3
- 108010076504 Protein Sorting Signals Proteins 0.000 claims description 3
- 230000001580 bacterial effect Effects 0.000 claims description 3
- 239000000499 gel Substances 0.000 claims description 3
- 239000007788 liquid Substances 0.000 claims description 3
- 238000002887 multiple sequence alignment Methods 0.000 claims description 3
- 238000003752 polymerase chain reaction Methods 0.000 claims description 3
- 238000005215 recombination Methods 0.000 claims description 3
- 230000006798 recombination Effects 0.000 claims description 3
- 238000011084 recovery Methods 0.000 claims description 3
- 239000006228 supernatant Substances 0.000 claims description 3
- 210000004748 cultured cell Anatomy 0.000 claims description 2
- 210000004962 mammalian cell Anatomy 0.000 claims description 2
- 230000001131 transforming effect Effects 0.000 claims description 2
- 238000004519 manufacturing process Methods 0.000 abstract description 6
- 238000001514 detection method Methods 0.000 abstract description 4
- 230000035945 sensitivity Effects 0.000 abstract description 3
- 102100039879 Interleukin-19 Human genes 0.000 description 27
- 238000010586 diagram Methods 0.000 description 8
- 102000004169 proteins and genes Human genes 0.000 description 8
- 241001465754 Metazoa Species 0.000 description 6
- 210000004989 spleen cell Anatomy 0.000 description 6
- 239000013598 vector Substances 0.000 description 5
- 238000001962 electrophoresis Methods 0.000 description 4
- 230000009471 action Effects 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000002415 sodium dodecyl sulfate polyacrylamide gel electrophoresis Methods 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 239000012620 biological material Substances 0.000 description 2
- 239000013599 cloning vector Substances 0.000 description 2
- 230000014509 gene expression Effects 0.000 description 2
- 210000004251 human milk Anatomy 0.000 description 2
- 235000020256 human milk Nutrition 0.000 description 2
- 230000002163 immunogen Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 241000283707 Capra Species 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 241000124008 Mammalia Species 0.000 description 1
- 101100370002 Mus musculus Tnfsf14 gene Proteins 0.000 description 1
- 206010035226 Plasma cell myeloma Diseases 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 102000007056 Recombinant Fusion Proteins Human genes 0.000 description 1
- 108010008281 Recombinant Fusion Proteins Proteins 0.000 description 1
- 238000001042 affinity chromatography Methods 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 210000003719 b-lymphocyte Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000011248 coating agent Substances 0.000 description 1
- 238000000576 coating method Methods 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 210000003527 eukaryotic cell Anatomy 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 108020004445 glyceraldehyde-3-phosphate dehydrogenase Proteins 0.000 description 1
- 238000002649 immunization Methods 0.000 description 1
- 230000016784 immunoglobulin production Effects 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 201000000050 myeloid neoplasm Diseases 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 210000001236 prokaryotic cell Anatomy 0.000 description 1
- 230000009465 prokaryotic expression Effects 0.000 description 1
- 230000002062 proliferating effect Effects 0.000 description 1
- 230000031877 prophase Effects 0.000 description 1
- 108091008146 restriction endonucleases Proteins 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000007789 sealing Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/244—Interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
- G01N33/6869—Interleukin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/52—Assays involving cytokines
- G01N2333/54—Interleukins [IL]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant mouse anti-human interleukin 19 monoclonal antibody, a preparation method and application, comprising a heavy chain constant region, a heavy chain variable region, a light chain constant region and a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2 and CDR3, the coding gene sequence of the light chain variable region is sequentially shown in SEQ ID NO.1-3, the translated amino acid sequence of the light chain variable region is sequentially shown in SEQ ID NO.4-6, the heavy chain variable region comprises CDR1, CDR2 and CDR3, the coding gene sequence of the heavy chain variable region is sequentially shown in SEQ ID NO.7-9, and the translated amino acid sequence of the heavy chain variable region is sequentially shown in SEQ ID NO. 10-12. The recombinant mouse anti-human interleukin 19 monoclonal antibody has the advantages of clear structure, strong specificity, better stability, high sensitivity in various detection methods, suitability for application in-vitro diagnostic reagents, small batch difference, high antibody titer, high antibody yield and low unit production cost.
Description
Technical Field
The invention relates to the technical field of preparation of monoclonal antibodies in genetic engineering, in particular to a recombinant mouse anti-human interleukin 19 monoclonal antibody, a preparation method and application.
Background
Antibodies are one of the most important scientific tools in the field of life sciences, and the traditional antibody production is to obtain monoclonal or polyclonal antibodies by immunizing animals. For example, in the production of an anti-human interleukin 19(IL19) antibody, a polyclonal antibody is prepared by obtaining serum after immunization by injecting human interleukin 19(IL19) protein as an immunogen into an animal, and theoretically, the antibody can be continuously obtained as long as the animal does not die. The monoclonal antibody is obtained by immunizing host animal with human interleukin 19(IL19) protein, extracting B cell capable of recognizing the immunogen, fusing it with myeloma cell, and screening to culture hybridoma capable of permanently proliferating and producing antibody.
In contrast, the production of recombinant antibodies only requires a prophase immune animal, or even does not require an immune animal, the sequence of the anti-human interleukin 19(IL19) antibody is obtained only by a certain way (the target gene in hybridoma cells can be fished or the gene sequence can be set artificially, and the later stage is performed by detecting whether the expressed protein recognizes the target protein), then the target sequence is inserted into a cloning vector, and after a large amount of amplification, the cloning vector is transferred into eukaryotic cells or prokaryotic cells for culture and expression to produce the antibody. Since the antibody gene is clear, even if the cell dies halfway, a recombinant antibody with stable performance can be obtained again by retransferring the gene sequence.
Therefore, based on the above principles and different production processes, the recombinant anti-human interleukin 19(IL19) antibody has obvious advantages in the aspects of specificity, sensitivity and inter-batch difference compared with the antibody obtained in the traditional manner, so that the success rate of scientific research experiments is improved to a great extent, and the repeatability is good. In summary, the manpower and material resources of scientific research projects are greatly saved.
Disclosure of Invention
Technical problem to be solved
Aiming at the defects of the prior art, the invention provides a recombinant mouse anti-human interleukin 19 monoclonal antibody, a preparation method and application, and the recombinant antibody has the advantages of definite gene structure, strong specificity, high titer and good stability, shows high sensitivity in various detection methods, and is suitable for being applied to in vitro diagnostic reagents.
(II) technical scheme
In order to achieve the purpose, the invention is realized by the following technical scheme: a recombinant mouse anti-human interleukin 19 monoclonal antibody, a preparation method and an application thereof comprise a heavy chain constant region, a heavy chain variable region, a light chain constant region and a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2 and CDR3, the coding gene sequence of the light chain variable region is sequentially shown in SEQ ID NO.1-3, the translated amino acid sequence of the light chain variable region is sequentially shown in SEQ ID NO.4-6, the heavy chain variable region comprises CDR1, CDR2 and CDR3, the coding gene sequence of the heavy chain variable region is sequentially shown in SEQ ID NO.7-9, and the translated amino acid sequence of the heavy chain variable region is sequentially shown in SEQ ID NO. 10-12.
The invention also discloses an expression vector containing the heavy chain variable region CDR1, CDR2 and CDR3 encoding genes.
The invention also discloses an expression vector containing the light chain variable region CDR1, CDR2 and CDR3 encoding genes.
The invention also discloses a preparation method of the recombinant mouse anti-human interleukin 19 monoclonal antibody, which is characterized by comprising the following steps: the method specifically comprises the following steps:
s1, immunizing a mouse with human interleukin 19 antigen to obtain a mouse splenocyte, fusing the mouse splenocyte with SP20 cells to obtain a hybridoma cell, extracting total RNA, and performing reverse transcription to obtain cDNA;
s2, using cDNA as a template to carry out primer design and amplify coding genes of a heavy chain variable region and a light chain variable region of a corresponding antibody;
s3, transferring the heavy chain variable region coding gene into an expression vector containing a heavy chain constant region gene, transferring the light chain variable region coding gene into an expression vector containing a light chain constant region gene, completing plasmid recombination, transferring the recombined plasmid into a competent cell, performing PCR amplification identification, and then arranging sequencing.
S4, carrying out amplification culture on the bacterial liquid corresponding to the plasmid with correct identification and sequencing, extracting the plasmid, co-transfecting the plasmid carrying heavy chain and light chain genes to mammalian cells, collecting the cultured cell supernatant, and carrying out protein purification to obtain the recombinant mouse anti-human interleukin 19 antibody.
Preferably, the specific steps of primer design in the amplification of the recombinant mouse anti-human interleukin 19 antibody variable region in step S3 are as follows: through multiple sequence alignment and degenerate primer design, primers capable of amplifying variable region genes of the recombinant mouse anti-human interleukin 19 antibody are designed in the relative constant regions of the leader peptide and the variable region.
Preferably, the sequence amplification in the amplification of the variable region of the recombinant mouse anti-human interleukin 19 antibody in step S3 specifically comprises the following steps: using cDNA as template, amplifying variable region gene by polymerase chain reaction, and identifying by agarose gel electrophoresis.
Preferably, the protein purification in step S4 specifically includes the following steps:
e1, purifying PCR products through a gel recovery kit, respectively connecting the heavy chain and light chain variable region gene segments with a seamless carrier, and transforming DH5 alpha competence;
e2, selecting four monoclonals for each adaptor, carrying out colony PCR by using universal primers, carrying out the size of a target fragment of 400-600, and selecting a positive clone bacterium with a bright band to send to a gene company for sequencing.
The invention also discloses an application of the recombinant mouse anti-human interleukin 19 monoclonal antibody in an in vitro diagnostic reagent.
(III) advantageous effects
The invention provides a recombinant mouse anti-human interleukin 19 monoclonal antibody, a preparation method and application. Compared with the prior art, the method has the following beneficial effects:
(1) the recombinant mouse anti-human interleukin 19 monoclonal antibody comprises a heavy chain constant region, a heavy chain variable region, a light chain constant region and a light chain variable region, wherein the light chain variable region contains CDR1, CDR2 and CDR3, the coding gene sequence of the light chain variable region is sequentially shown in SEQ ID NO.1-3, the translated amino acid sequence of the light chain variable region is sequentially shown in SEQ ID NO.4-6, the heavy chain variable region contains CDR1, CDR2 and CDR3, the coding gene sequence of the heavy chain variable region is sequentially shown in SEQ ID NO.7-9, and the translated amino acid sequence of the heavy chain variable region is sequentially shown in SEQ ID NO. 10-12. The unit production cost is low.
(2) The recombinant mouse anti-human interleukin 19 monoclonal antibody, the preparation method and the application have high recognition rate and good specificity on the epitope of human interleukin 19(IL19), and can well recognize natural antigens and recombinant antigens in tissues.
Drawings
FIG. 1 is a schematic diagram of total RNA electrophoresis of hybridoma cells fused by mouse spleen cells and SP20 according to the present invention;
FIG. 2 is a schematic diagram of the electrophoresis of the cDNA reference amplification of the hybridoma fused by mouse spleen cells and SP 20;
FIG. 3 is a schematic diagram of light chain variable region amplification agarose gel electrophoresis of the present invention;
FIG. 4 is a schematic diagram of heavy chain variable region amplification agarose gel electrophoresis of the present invention;
FIG. 5 is a schematic diagram of agarose gel electrophoresis of the variable region gene fragment of the present invention;
FIG. 6 is a diagram showing the SDS-PAGE electrophoretic analysis of the purified antibody of the present invention;
FIG. 7 is a schematic diagram showing the fitting result of the ELISA titer determination curve for the mouse anti-human interleukin 19 monoclonal antibody according to the present invention;
FIG. 8 is a schematic diagram showing the results of detecting the activity of the mouse anti-human interleukin 19 monoclonal antibody of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to fig. 1 to 8, an embodiment of the present invention provides a technical solution: a recombinant mouse anti-human interleukin 19 monoclonal antibody, a preparation method and an application thereof, the source of biological materials is as follows: mouse spleen cells (Wuhan Baijiekang Biotechnology Co., Ltd.), SP2/0 (Wuhan Baijiekang Biotechnology Co., Ltd.), a mouse heavy chain constant region vector pBE27 (Wuhan Baijiekang Biotechnology Co., Ltd.), a vector pET28a (+) (Hunanfenghui Biotechnology Co., Ltd.), a mouse light chain constant region vector pBE28 (Wuhan Baijiekang Biotechnology Co., Ltd.), and other biological materials and reagents are all directly purchasable commodities.
Recombinant mouse anti-human interleukin 19(IL19) antibody variable region gene fishing
1. RNA extraction and reverse transcription of hybridoma cells to obtain cDNA
Firstly, immunizing a mouse by using human interleukin 19(IL19) antigen to obtain mouse spleen cells, fusing the mouse spleen cells with SP20 to obtain hybridoma cells, extracting hybridoma cell RNA by using a Triz1 method, and obtaining clear 28 and 18S bands through agarose gel electrophoresis, wherein the result of RNA integrity is better, the result of RNA concentration and purity measurement is D (260nm)/D (280nm) ═ 1.90, the requirement of the experiment can be met, reverse transcription is performed by using RNA as a template to synthesize cDNA, cDNA is used as a template, and a reference gene GAPDH in the mouse is used as a primer for PCR amplification to obtain a target band with the length of 320bp, and the reverse transcription cDNA can be used for subsequent experiments, and the reference figures 1-2 show that the reverse transcription cDNA can be used for the total RNA (A) and the cDNA amplification gel electrophoresis (B) of the hybridoma cells fused with the mouse spleen cells and SP 20.
2. Recombinant mouse anti-human interleukin 19(IL19) antibody variable region amplification
Designing a primer: through multiple sequence alignment and degenerate primer design, primers capable of amplifying variable region genes of the recombinant mouse anti-human interleukin 19(IL19) antibody are designed in the relative constant regions of the leader peptide and the variable region.
And (3) sequence amplification: using cDNA as template, amplifying variable region gene by polymerase chain reaction, and identifying by agarose gel electrophoresis, the result is shown in figure 3 and figure 4: the length of the heavy chain variable region gene is 336bp, the length of the light chain variable region gene is about 633bp, and the length of the heavy chain variable region gene is consistent with that of a target fragment.
3. Purification of variable region Gene fragment and ligation with pET28a (+) vector
PCR products are purified by a gel recovery kit, heavy chain and light chain variable region gene fragments are respectively connected with a seamless vector to transform DH5 alpha competence, 4 single clones are selected from each connector, colony PCR is carried out by using a universal primer, the size of a target fragment is about 400-600 (figure 5), and 1 positive clone bacterium with bright bands is selected and sent to a gene company for sequencing.
4. Sequencing result of variable region sequence of recombinant mouse anti-human interleukin 19(IL19) antibody
4.1 sequencing of the light chain variable region is shown below.
Gacattgtgctgacccagtctccagcttctttggctgtgtctctagggcagagggccaccatctcctgcaaggccagccaaagtgatgattatgctgtttatagttatatgaactggtaccaacagaaaccaggacagccacccaaactcctcatctatgctgcagccaatctagaatctgggatcccagccaggtttagtggcagtgggtctgggacagacttcatcctcaacatccatcctgtggaggaggaggatgttgcaacctattactgtcagcaaagtcatgaggatccgtacgcgttcggaggggggaccaagctggaaataaaac
The light chain genes were compared for homology using IMGT/QUEST online analysis software and the effective sequences are shown in Table 1 below:
TABLE 1 efficient sequence Listing for homology comparison of light chain genes
The encoding genes of the recombinant mouse anti-human interleukin 19(IL19) antibody and the light chain variable region CDR1, CDR2 and CDR3 are shown as SEQ ID NO: 1-3.
CDR1:caaagtgatgattatgctgtttatagttat
CDR2:gctgcagcc
CDR3:cagcaaagtcatgaggatccgtacgcg
The coding genes of the light chain variable region CDR1, CDR2 and CDR3 are translated into amino acid sequences which are sequentially shown as SEQ ID NO: 4-6.
CDR1:QSDDYAVYSY
CDR2:AAA
CDR3:QQSHEDPYA
4.2 heavy chain variable region sequencing results are shown below:
Caggtccagctgcaggagtctggacctgagctggtgaagcctggggcttcagtgaagatatcctgcaaggcttctggttactccatcactggctactacgtgcactgggtgaagcaaagccatgtaaggagccttgagtggattggacgtattaatccttaccatggcgctactaactacaaccagaatttcagggacaaggccagcttgactgtagataagtcctccaacacagcctacatggagctccacagcctgacatctgaggactctgcagtctattactgtgtctattgtaactactggggccaagggaccacggtcaagggcaattcc
the homology comparison of the heavy chain gene is carried out by using IMGT/QUEST online analysis software, and the effective sequence is shown in the following table 2:
TABLE 2 efficient sequence Listing for homology comparison of heavy chain genes
·(a)Other possibilities:Musmus_IGHJ3*01(highest number ofconsecutive identical nucleotides)。
The recombinant mouse anti-human interleukin 19(IL19) antibody has the coding genes of heavy chain variable region CDR1, CDR2 and CDR3 shown in sequence as SEQ ID NO: 7-9.
CDR1:ggttactccatcactggctactac
CDR2:attaatccttaccatggcgctact
CDR3:gtctattgtaactac
The coding genes of the heavy chain variable region CDR1, CDR2 and CDR3 are translated into amino acid sequences which are sequentially shown as SEQ ID NO: 10-12.
CDR1:GYSITGYY
CDR2:INPYHGAT
CDR3:VYCNY
Secondly, eukaryotic expression purification of recombinant mouse anti-human interleukin 19(IL19) antibody
Analyzing the sequenced sequence, selecting correct and functional heavy chain and light chain variable region genes, designing a second set of primers according to the sequencing result, carrying out 2 times of PCR by taking the previously sequenced genes as a template, using restriction enzymes, enzyme digestion PCR products, pBE27 and pBE28 to complete plasmid recombination, transferring into DH5 alpha competent cells, selecting positive clones and sequencing. Amplifying and culturing a bacterial liquid corresponding to the plasmid with correct sequencing, extracting the plasmid, co-transfecting the plasmid carrying heavy chain and light chain genes into 293F cells or CHO-S cells of mammal cells according to a certain proportion, collecting culture cell supernatant for 4-5 days, and purifying by protein A/G affinity chromatography, wherein the result of SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoretic analysis of the purified antibody is shown in figure 6, and the purified antibody is the recombinant mouse anti-human interleukin 19(IL19) antibody.
Application of recombinant mouse anti-human interleukin 19(IL19) antibody activity detection
3.1Western blot detection: the result of using a recombinant mouse anti-human interleukin 19(IL19) antibody with a final concentration of 2ug/ml as a primary antibody and a secondary antibody as goat anti-mouse IgG (using a concentration of 0.1ug/ml) and detecting the sample as human milk and recombinant human interleukin 19(IL19) protein is shown in fig. 8, wherein lane a is human milk and lane B is recombinant human interleukin 19(IL19) protein, and the result shows that the recombinant mouse anti-human interleukin 19(IL19) antibody can well identify a natural sample (25kd) and a prokaryotic expression recombinant protein (20 kd).
3.2ELISA Titers assay: the recombinant human interleukin 19(IL19) (2 mu g/ml) is used for coating the enzyme label plate, after 1% BSA is used for sealing and incubation, the recombinant mouse anti-human interleukin 19(IL19) monoclonal antibody is diluted from 1 mu g/ml according to 2 times of gradient to form 13 gradients, the diluted recombinant antibody is added into the coated enzyme label plate, and the result shows that the recombinant mouse anti-human interleukin 19(IL19) monoclonal antibody and the recombinant human interleukin 19(IL19) can be specifically combined and have better dose-effect relationship, the result is shown in Table 2, and the EC50 value of the recombinant mouse anti-human interleukin 19(IL19) monoclonal antibody is 0.021 mu g/ml by curve fitting in figure 7.
Table 2ELISA test the binding potency of recombinant mouse anti-human interleukin 19(IL19) monoclonal antibody to recombinant human interleukin 19(IL 19).
Sequence listing
Light chain sequence
CTAACACTCATTCCTGTTGAAGCTCCTGACAATGGGTGAAGTTGATGTCTTGTGAGTGGCCTCACAGGTATAGCTGTTATGTCGTTCATACTCGTCCTTGGTCAACGTGAGGGTGCTGCTCATGCTGTAGGTGCTGTCTTTGCTGTCCTGATCAGTCCAACTGTTCAGGACGCCATTTTGTCGTTCACTGCCATCAATCTTCCACTTGACATTGATGTCTTTGGGGTAGAAGTTGTTCAAGAAGCACACGACTGAGGCACCTCCAGATGTTAACTGCTCACTGGATGGTGGGAAGATGGATACAGTTGGTGCAGCATCAGCCCGCTTGATTTCCAGCTTGGTGCCTCCACCGAACGTCGGAGGAATACCATAATGATGTTGACAGTGATAATTCCCAAAATCTTCAGGCTTCAGGTTGTTGATCTTCAGAGAAAACTGTGTGCCTGATCCACTGCCACTGAACCTTGATGGCACACCTTCTGTTAAGGTTTTTGCATTATAGACCAGGAGCTGAGGAGATTTTCCCTGCTTCTGCTGATACCATGCTAAATAACTGTAAATATTCTCACTTGTTCGACATGTGATGGTGACAGTTTCTCCCACAGATGCAGATAGGGAGGCTGGAGACTGAGTCAGCTGGATGTC
Heavy chain sequence
AGAGTTCCAGGTCACTGTCACTGGCTCAGGGAAATAGCCCTTGACCAGGCATCCCAGGGTCACCATGGAGTTAGTTTGGGCAGCAGATCCAGGGGCCAGTGGATAGACAGATGGGGGTGTCGTTTTGGCTGAGGAGACGGTGACTGAGGTTCCTTGACCCCAGTAGTCCATAGTATAGTCGTAGCGACTACCGTAGTGAGACCATCTTGCACAGAAATAGATTGCAGAGTCCTCAGATGTCAGGCTGCTGAGCTGCATGTAGGCTGTGCTGGAGGATGTGTCTGAAGTCAGTGTGGCCTTGCCCTTGAACTTCTCATTGTATTCAGGATAACCATTTCCAATATAAATATATCCAATCCATTCCAGGCCCTGTCCAGGCCTCTGTTTCACCCAGTTTATACCGTAGCTTGTGAATGTATATCCAGAAGTCTTGCAGGACATCTTCACTGAGGACCCAGGCCTCACCAGCTCAGCTCCAGACTGCTTCAGCTGCACCTG。
Compared with the prior art, the antibody has definite protein and gene structures and good stability, can prepare a new cell strain capable of expressing the antibody again even if a cell strain expressing the antibody does not exist, has small batch difference, high antibody titer, high antibody yield and low unit production cost, has high recognition rate and good specificity on the epitope of the human interleukin 19(IL19), and can well recognize both natural antigen and recombinant antigen in tissues.
And those not described in detail in this specification are well within the skill of those in the art.
It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (8)
1. A recombinant mouse anti-human interleukin 19 monoclonal antibody is characterized in that: the light chain variable region comprises CDR1, CDR2 and CDR3, the light chain variable region coding gene sequence is shown in sequence as SEQ ID NO.1-3, the light chain variable region translated amino acid sequence is shown in sequence as SEQ ID NO.4-6, the heavy chain variable region comprises CDR1, CDR2 and CDR3, the heavy chain variable region coding gene sequence is shown in sequence as SEQ ID NO.7-9, and the heavy chain variable region translated amino acid sequence is shown in sequence as SEQ ID NO. 10-12.
2. An expression vector comprising the genes encoding CDR1, CDR2 and CDR3 of the heavy chain variable region of claim 1.
3. An expression vector comprising the light chain variable region CDR1, CDR2 and CDR3 encoding genes of claim 1.
4. A method for preparing the recombinant mouse anti-human interleukin 19 monoclonal antibody of claim 1, which comprises the following steps: the method specifically comprises the following steps:
s1, immunizing a mouse with human interleukin 19 antigen to obtain a mouse splenocyte, fusing the mouse splenocyte with SP20 cells to obtain a hybridoma cell, extracting total RNA, and performing reverse transcription to obtain cDNA;
s2, using cDNA as a template to carry out primer design and amplify coding genes of a heavy chain variable region and a light chain variable region of a corresponding antibody;
s3, transferring the heavy chain variable region coding gene into an expression vector containing a heavy chain constant region gene, transferring the light chain variable region coding gene into an expression vector containing a light chain constant region gene, completing plasmid recombination, transferring the recombined plasmid into a competent cell, performing PCR amplification identification, and then arranging sequencing.
S4, carrying out amplification culture on the bacterial liquid corresponding to the plasmid with correct identification and sequencing, extracting the plasmid, co-transfecting the plasmid carrying heavy chain and light chain genes to mammalian cells, collecting the cultured cell supernatant, and carrying out protein purification to obtain the recombinant mouse anti-human interleukin 19 antibody.
5. The method for preparing the recombinant mouse anti-human interleukin 19 monoclonal antibody according to claim 4, wherein the method comprises the following steps: the specific steps of the primer design in the recombinant mouse anti-human interleukin 19 antibody variable region amplification in the step S3 are as follows: through multiple sequence alignment and degenerate primer design, primers capable of amplifying variable region genes of the recombinant mouse anti-human interleukin 19 antibody are designed in the relative constant regions of the leader peptide and the variable region.
6. The method for preparing the recombinant mouse anti-human interleukin 19 monoclonal antibody according to claim 4, wherein the method comprises the following steps: the specific steps of sequence amplification in the recombinant mouse anti-human interleukin 19 antibody variable region amplification in the step S3 are as follows: using cDNA as template, amplifying variable region gene by polymerase chain reaction, and identifying by agarose gel electrophoresis.
7. The method for preparing the recombinant mouse anti-human interleukin 19 monoclonal antibody according to claim 4, wherein the method comprises the following steps: the protein purification in step S4 specifically includes the following steps:
e1, purifying PCR products through a gel recovery kit, respectively connecting the heavy chain and light chain variable region gene segments with a seamless carrier, and transforming DH5 alpha competence;
e2, selecting four monoclonals for each adaptor, carrying out colony PCR by using universal primers, carrying out the size of a target fragment of 400-600, and selecting a positive clone bacterium with a bright band to send to a gene company for sequencing.
8. The use of the recombinant mouse anti-human interleukin 19 monoclonal antibody of claim 1 in an in vitro diagnostic reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010350291.2A CN111647081B (en) | 2020-04-28 | 2020-04-28 | Recombinant mouse anti-human interleukin 19 monoclonal antibody, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010350291.2A CN111647081B (en) | 2020-04-28 | 2020-04-28 | Recombinant mouse anti-human interleukin 19 monoclonal antibody, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111647081A true CN111647081A (en) | 2020-09-11 |
| CN111647081B CN111647081B (en) | 2022-06-03 |
Family
ID=72340513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010350291.2A Active CN111647081B (en) | 2020-04-28 | 2020-04-28 | Recombinant mouse anti-human interleukin 19 monoclonal antibody, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111647081B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116355094A (en) * | 2023-02-21 | 2023-06-30 | 武汉爱博泰克生物科技有限公司 | Monoclonal antibody against interleukin 12 of mouse and preparation method |
| WO2023205617A1 (en) * | 2022-04-20 | 2023-10-26 | Eli Lilly And Company | Antibodies and methods targeting interleukin-19 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2065396A1 (en) * | 1996-08-30 | 2009-06-03 | Human Genome Sciences, Inc. | Interleukin-19 |
| WO2010000721A1 (en) * | 2008-06-30 | 2010-01-07 | Novo Nordisk A/S | Anti-human interleukin-20 antibodies |
| US20110020273A1 (en) * | 2005-04-06 | 2011-01-27 | Ibc Pharmaceuticals, Inc. | Bispecific Immunocytokine Dock-and-Lock (DNL) Complexes and Therapeutic Use Thereof |
| CN102343089A (en) * | 2010-08-03 | 2012-02-08 | 张明熙 | A medical composition for treating breast cancer |
| US20120034225A1 (en) * | 2010-08-03 | 2012-02-09 | National Cheng Kung University | Suppressing Bone Loss with Anti-IL-19 Antibody |
-
2020
- 2020-04-28 CN CN202010350291.2A patent/CN111647081B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2065396A1 (en) * | 1996-08-30 | 2009-06-03 | Human Genome Sciences, Inc. | Interleukin-19 |
| US20110020273A1 (en) * | 2005-04-06 | 2011-01-27 | Ibc Pharmaceuticals, Inc. | Bispecific Immunocytokine Dock-and-Lock (DNL) Complexes and Therapeutic Use Thereof |
| WO2010000721A1 (en) * | 2008-06-30 | 2010-01-07 | Novo Nordisk A/S | Anti-human interleukin-20 antibodies |
| CN102343089A (en) * | 2010-08-03 | 2012-02-08 | 张明熙 | A medical composition for treating breast cancer |
| US20120034225A1 (en) * | 2010-08-03 | 2012-02-09 | National Cheng Kung University | Suppressing Bone Loss with Anti-IL-19 Antibody |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023205617A1 (en) * | 2022-04-20 | 2023-10-26 | Eli Lilly And Company | Antibodies and methods targeting interleukin-19 |
| CN116355094A (en) * | 2023-02-21 | 2023-06-30 | 武汉爱博泰克生物科技有限公司 | Monoclonal antibody against interleukin 12 of mouse and preparation method |
| CN116355094B (en) * | 2023-02-21 | 2023-10-20 | 武汉爱博泰克生物科技有限公司 | Monoclonal antibody against interleukin 12 of mouse and preparation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111647081B (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113150136B (en) | Preparation of novel coronavirus N protein monoclonal antibody | |
| WO2020125120A1 (en) | Antibody library construction method and application thereof | |
| CN111647081B (en) | Recombinant mouse anti-human interleukin 19 monoclonal antibody, preparation method and application | |
| CN105112375A (en) | Hybridoma cell strain ZJED0-02, anti-Ebola virus GP (glycoprotein) monoclonal antibody and their preparation and application | |
| CN112111006B (en) | Antibody for resisting bovine sarcoidosis virus, detection test paper and kit | |
| CN110950960B (en) | Preparation method of small molecule compound antibody based on high-throughput sequencing and hybrid hybridoma technology | |
| CN111057148B (en) | Single-domain antibody aiming at bovine serum albumin BSA and derivative protein thereof | |
| CN111018985B (en) | Application of single-domain antibody aiming at bovine serum albumin BSA | |
| KR20140118979A (en) | Identification of antigen-specific adaptive immune responses using arm-pcr and high-throughput sequencing | |
| CN105524173B (en) | Nano antibody aiming at humanized antibody Fc fragment and application thereof | |
| CN111647086B (en) | Recombinant mouse anti-human creatine kinase monoclonal antibody, preparation method and application | |
| CN114276445A (en) | Rotavirus recombinant protein specific antibody, plasmid vector and method | |
| CN110872354B (en) | Chicken-derived monoclonal antibody and single-chain antibody of mammal cell recombinant anti-human TK1, and preparation method and application thereof | |
| CN111647083B (en) | Recombinant mouse anti-human hemojulin monoclonal antibody, preparation method and application | |
| CN108484770B (en) | Recombinant rat anti-mouse CD4 monoclonal antibody, preparation method and application | |
| CN112679607B (en) | Preparation method of troponin I E13 single-chain antibody | |
| CN105646712B (en) | Monoclonal antibody and its application | |
| CN105646713B (en) | A kind of monoclonal antibody and its application | |
| CN117003880B (en) | Anti-thiocyanate fluorescein monoclonal antibody and application thereof | |
| CN114539403B (en) | Rabbit recombinant monoclonal antibody targeting human BCMA protein and application thereof | |
| WO2022121899A1 (en) | Antibody specifically binding to strep-tag ii tag and use thereof | |
| CN114773462B (en) | Recombinant single-chain antibody for detecting bovine CRP protein and application thereof | |
| CN113201069B (en) | mCherry or mEOS nano antibody and preparation method and application thereof | |
| CN112094350B (en) | Monoclonal antibody of mouse anti-cell surface glycoprotein CD326 applicable to tumor cell capture | |
| CN112094345B (en) | Mouse anti-immunoglobulin associated beta CD79b monoclonal antibody applicable to tumor cell capture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20240402 Address after: 430000 west of 3 / F, 21 / F (zone a), R & D building, No. 666, shendun Fourth Road, Donghu New Technology Development Zone, Wuhan, Hubei (Wuhan area of free trade zone) Patentee after: Wuhan Biyu Biotechnology Co.,Ltd. Country or region after: China Address before: Room 103, Building 1-4, Building C2, Phase 1.2, Guanggu Enterprise Mansion, No. 1 Guanshan Avenue, Donghu New Technology Development Zone, Wuhan City, Hubei Province, 430000 (178 #) Patentee before: Wuhan baijiekang Biotechnology Co.,Ltd. Country or region before: China |
|
| TR01 | Transfer of patent right |