CN111635879B

CN111635879B - L-lysine high-producing strain and construction method and application thereof

Info

Publication number: CN111635879B
Application number: CN201910157625.1A
Authority: CN
Inventors: 孙际宾; 李庆刚; 周文娟; 郑平; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2019-03-01
Filing date: 2019-03-01
Publication date: 2022-04-22
Anticipated expiration: 2039-03-01
Also published as: CN111635879A

Abstract

The invention discloses a method for constructing an L-lysine production strain, which comprises the step of ensuring that one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase in the lysine production strain can not normally function in cells. The invention also discloses the L-lysine producing strain constructed by the method and a method for preparing L-lysine by using the strain. The L-lysine production strain constructed by the invention has the advantages that the lysine yield is obviously improved, and the cost can be obviously reduced.

Description

L-lysine high-producing strain and construction method and application thereof

Technical Field

The invention relates to the field of biotechnology. In particular, the present invention relates to an L-lysine-producing strain, a method for constructing the same, and use thereof.

Background

L-lysine is an important essential amino acid in human and animal nutrition, and plays a very important role in the industries of medicine, health, food, animal feed, cosmetics and the like. Global Industrial Analysis (GIA) corporation "amino acids: the global strategic business report shows that by 2018, the market size of global lysine will reach $ 60 billion. L-lysine is produced mainly by fermentation using microorganisms, and known amino acid-producing microorganisms include Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium), and the like. In recent years, improvements in raw material treatment, fermentation process and separation and extraction process have been made to reduce the cost of amino acid fermentation production to some extent, and as the core of the fermentation industry, the technology for improving the fermentation strain has been developed. For example, the release of substrate feedback inhibition of key enzymes in the amino acid synthesis pathway improves yield (WO1995016042, WO1995006114), attenuation or knockout of genes related to amino acid degradation (WO1996017930), overexpression of transportan (WO2005073390), enhancement of activity of proteins related to substrate uptake (WO2002029080), and the combination of these modification strategies to produce amino acids, etc. Therefore, a great deal of improvement and development has been carried out in various aspects related to the publicly known lysine metabolism, and the acid-producing ability of the current industrial lysine-producing strains has reached a high level.

As is known, a cell is a complex metabolic network aggregate, and in the synthesis process of a certain compound, people usually modify pathways directly related to metabolism (including substrate transport, metabolic pathway, product transport, and the like) without modifying other unrelated pathways in the cell, because the influence of the change of the unrelated pathways on strains is unknown, and the metabolic pathways in the cell are numerous, so that it is very difficult to dig out modifiable points related to lysine production from the numerous pathways, and especially when the current lysine industrial strains reach a high level, it is very difficult to further promote the lysine industrial strains, even to slightly promote the lysine industrial strains.

Therefore, there is a strong need in the art for a novel method for constructing L-lysine-producing strains in order to further improve the production of L-lysine.

Disclosure of Invention

The invention aims to provide a brand-new construction method of an L-lysine producing strain, the L-lysine producing strain constructed by the construction method and a method for producing L-lysine by using the constructed L-lysine producing strain.

In a first aspect, the present invention provides a method for constructing an L-lysine-producing strain, wherein one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase are modified in cells of the L-lysine-producing strain so as not to function normally in cells.

In a specific embodiment, the L-lysine production by said L-lysine producing strain is increased by at least 8%, preferably by at least 15%, more preferably by at least 20%, more preferably by at least 25%, more preferably by at least 30%, most preferably by at least 35% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

In a preferred embodiment, said rendering the imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase in the cell not function normally intracellularly can be effected by one or a combination of the following methods: partially or completely knocking out one or more encoding genes of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase; amino acid residue change is caused by mutation of one or more coding genes of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase; modifying one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase coding gene promoter, translation regulating region or coding region codon to weaken the transcription or translation; changing one or more encoding gene sequences of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase to ensure that the mRNA stability is weakened or the enzyme structure is unstable; introducing a new mutant with reduced activity without changing the gene sequence encoding one or more of the original imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase, resulting in reduced overall activity of the intracellular enzyme; or any other mode which can not normally function in cells by modifying the coding regions of genes of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase which are introduced from endogenous or exogenous sources in the cells and the adjacent upstream and downstream regions thereof, and the like.

In a further preferred embodiment, the gene coding sequence for one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase is subjected to frame shift mutation, deletion, start codon alteration, etc.

In a preferred embodiment, the imidazole glycerol phosphate dehydratase is:

1) polypeptide with the amino acid sequence coded by the nucleotide shown in SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 6; or

2) Has homology of more than 80%, 85%, 90%, 95%, 96%, 97%, 98% and 99% with the amino acid sequence coded by the nucleotide shown in SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 6, and has the function of catalyzing D-erythro-imidazole-glycerol-phosphate to generate imidazole acetone-phosphate or the polypeptide with the activity of imidazole glycerol phosphate dehydratase.

In a further preferred embodiment, the polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homology with the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 6, and having the function of catalyzing D-erythro-imidazole-glycerol-phosphate to produce imidazoleacetone-phosphate or having the activity of imidazoleacrylate phosphate dehydratase is derived from Escherichia coli or Corynebacterium glutamicum.

In a preferred embodiment, the histidinol phosphorylase is a histidinol phosphorylase comprising:

1) polypeptide with the amino acid sequence coded by the nucleotide shown in SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 7; or

2) Has homology of more than 80%, 85%, 90%, 95%, 96%, 97%, 98% and 99% with the amino acid sequence coded by the nucleotide shown in SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 7, and has the function of catalyzing histidine phosphate to generate histidinol or has the activity of histidinol phosphorylase.

In a further preferred embodiment, the polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homology with the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO. 1, SEQ ID NO. 4, SEQ ID NO. 7 and having the function of catalyzing histidine phosphate to generate histidinol or having the activity of histidinol phosphorylase is derived from Escherichia coli or Corynebacterium glutamicum.

In a preferred embodiment, the histidine aldehyde/histidine alcohol dehydrogenase is:

1) polypeptide with the amino acid sequence coded by the nucleotide sequence shown in SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 8; or

2) Has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homology with the amino acid sequence coded by the nucleotide sequence shown in SEQ ID NO 2, SEQ ID NO 5, SEQ ID NO 8, and has the function of catalyzing histidinol to generate histidinol or catalyzing histidinol to generate histidine or has the activity of histidinol/histidinol dehydrogenase.

In a further preferred embodiment, the polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homology with the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO 2, SEQ ID NO 5, SEQ ID NO 8, and having the function of catalyzing the production of histidine by histidine alcohol or the production of histidine by histidine aldehyde or the activity of histidine aldehyde/histidine dehydrogenase is derived from Escherichia coli or Corynebacterium glutamicum.

In a preferred embodiment, the gene encoding the imidazole glycerol phosphate dehydratase is as shown in SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 6, or a nucleotide hybridizable to the nucleotide sequence depicted in SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 6, or a nucleotide hybridizable to a probe prepared from the nucleotide sequence depicted in SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 6, wherein the hybridization occurs under stringent conditions, and wherein the nucleotide encodes a protein having imidazole glycerol phosphate dehydratase activity;

the coding gene of the histidinol phosphorylase is shown as SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 7, or a nucleotide which can be hybridized with the nucleotide sequence shown as SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 7, or a nucleotide which can be hybridized with a probe prepared by the nucleotide sequence shown as SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 7, wherein the hybridization is carried out under strict conditions, and the nucleotide codes protein with the histidinol phosphorylase activity;

the coding gene of the histidine aldehyde/histidine alcohol dehydrogenase is shown as SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 8, or a nucleotide which can be hybridized with the nucleotide sequence shown as SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 8, or a nucleotide which can be hybridized with a probe prepared by the nucleotide sequence shown as SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 8, wherein the hybridization is carried out under strict conditions, and the nucleotide codes protein with the activity of the histidine aldehyde/histidine alcohol dehydrogenase.

In specific embodiments, the strain is from the genus Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium sp), Bacillus (Bacillus), Serratia (Serratia), or Vibrio (Vibrio); more preferably, the strain is escherichia coli (e.coli) or Corynebacterium glutamicum (Corynebacterium glutamicum).

In a second aspect, the present invention provides an L-lysine-producing strain that is not normally functional in a cell by one or more of modified imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

In a specific embodiment, the L-lysine production of the L-lysine high producing strain is increased by at least 8%, preferably at least 15%, more preferably at least 20%, more preferably at least 25%, more preferably at least 30%, most preferably at least 35% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

In a preferred embodiment, the imidazole glycerol phosphate dehydratase is:

2) Has homology of more than 95 percent with the amino acid sequences coded by the nucleotides shown in SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 7, and has the function of catalyzing histidine phosphate to generate histidinol or has the activity of histidinol phosphorylase.

In a further preferred embodiment, the polypeptide has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homology with the amino acid sequence encoded by the nucleotide shown in SEQ ID NO. 1, SEQ ID NO. 4, SEQ ID NO. 7, and has the function of catalyzing histidine phosphate to generate histidinol or the activity of histidinol phosphorylase, and is derived from Escherichia coli or Corynebacterium glutamicum.

In a third aspect, the present invention provides an expression vector comprising the nucleotide encoding one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase according to the first aspect, which do not normally function intracellularly.

In a fourth aspect, the present invention provides a method for producing L-lysine, characterized in that the method comprises:

1) culturing the L-lysine-producing strain of the first aspect to produce L-lysine; and

2) optionally isolating L-lysine from the culture broth obtained in step 1).

In the fifth aspect, the invention provides the L-lysine producing strain constructed by the construction method of the first aspect, the L-lysine producing strain of the second aspect, and the use of the expression vector of the third aspect for producing L-lysine.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Detailed Description

In the metabolic network of bacteria, the histidine metabolic pathway and the lysine metabolic pathway are far from each other, and the overexpression of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydratase has been reported in the literature to enhance the histidine yield of strains, while the attenuation of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydratase leads to the reduction of the histidine yield of strains. At present, no report exists for improving the lysine yield of the strain by weakening or knocking out genes encoding imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydratase.

After extensive and intensive studies by the inventors, the comprehensive analysis of the obtained novel lysine-producing strain unexpectedly found that weakening the activities of histidine metabolism-related enzymes, i.e., imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase in the lysine-producing strain can significantly improve the yield of lysine, thereby reducing the production cost. The present invention has been completed based on this finding.

Imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase

Imidazole glycerol phosphate dehydratase (imidazole glycerol phosphate dehydratase), histidinol phosphorylase (histidinol-phosphate) are enzymes in the histidine metabolic pathway, imidazole glycerol phosphate dehydratase catalyzes the sixth reaction in the histidine synthetic pathway, i.e. catalyzes the production of imidazole acetone phosphate (imidazole acetate phosphate) from D-erythro-imidazole glycerol phosphate (D-erythro-imidazole-glycerol phosphate), histidinol phosphorylase catalyzes the eighth reaction in the histidine synthetic pathway, i.e. catalyzes the production of histidinol (histidinol) from histidine phosphate (L-histidinol phosphate), both enzymes being encoded by the hisB gene in escherichia coli, whereas imidazole glycerol phosphate dehydratase is encoded by the hisB gene in corynebacterium glutamicum and histidinol phosphorylase is encoded by the hisN gene.

Histidinol/histidinol dehydrogenase (hisD) encoded by the hisD gene, also an enzyme in the histidine metabolic pathway, catalyzes the last two steps of histidine biosynthesis, namely the catalysis of histidinol (histadinol) to histidine and then histidine (histadine).

For the purposes of the present invention, the imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase can be derived from Escherichia coli or Corynebacterium glutamicum. Furthermore, it is apparent that any sequence having activity equivalent to the activity of the polypeptide encoded by the nucleotides shown in SEQ ID NOS: 1 to 8, although it is not derived from Escherichia coli or Corynebacterium glutamicum, is also included in the scope of the present invention. For example, an amino acid sequence which may include the amino acid sequence encoded by the nucleotides shown in SEQ ID Nos. 1 to 8, or a conservative sequence of the polypeptide encoded by the nucleotides shown in SEQ ID Nos. 1 to 8, and a substitution, deletion, insertion, addition or inversion of an amino acid or several amino acids at one or more positions (which may vary depending on the position and type of amino acid residues in the three-dimensional structure of the protein, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 6 amino acid residues), as long as it has an activity of catalyzing a reaction; also included are polypeptides having more than 80%, preferably 90%, more preferably 95% or more homology to the polypeptides encoded by the nucleotides shown in SEQ ID NO 1-8 and having imidazole glycerol phosphate dehydratase, histidinol phosphorylase or histidinol/histidinol dehydrogenase activity, and amino acid substitutions, deletions, insertions, additions or inversions also including mutated or artificially modified sequences naturally occurring in microorganisms having imidazole glycerol phosphate dehydratase, histidinol phosphorylase or histidinol/histidinol dehydrogenase activity.

Definition of terms

Polynucleotide, generally referred to as polyribonucleotides and polydeoxyribonucleotides, can be unmodified RNA or DNA or modified RNA or DNA. The nucleotide of the present invention may be the nucleotide sequence of SEQ ID NO. 1-8, or the nucleotide that hybridizes to the nucleotide sequence of SEQ ID NO. 1-8 under stringent conditions, or the nucleotide that hybridizes to the probe prepared from SEQ ID NO. 1-8 and encodes a protein having imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase activity. As used herein, "stringent conditions" refers to conditions under which specific hybridization can occur but non-specific hybridization does not occur. For example, washing in a saline solution at a concentration of 1, preferably 2 or 3 times, corresponding to a concentration of 1 XSSC, 0.1% SDS, preferably 0.1 XSSC, 0.1% SDS at 60 ℃, more preferably 0.1 XSSC, 0.1% SDS at 68 ℃, the probe length being chosen according to the hybridization conditions, and generally ranging from 100bp to 1 kb.

The term "endogenous" as used herein refers to an activity of a polypeptide in a microorganism in an unmodified state, i.e., an activity in the natural state.

A polypeptide is understood to be a peptide or protein comprising two or more amino acids joined by peptide bonds. The polypeptide of the invention is a polypeptide with an amino acid sequence coded by the nucleotide shown in SEQ ID NO. 1-8. Those skilled in the art know that polypeptides in organisms, such as microorganisms, have the phenomenon of natural mutation, but those polypeptides comprising natural mutation can have the same or similar activity as the original polypeptide; alternatively, one skilled in the art, based on the knowledge of the prior art, can also prepare a polypeptide having a mutation, which can still have the same or similar activity as the original polypeptide; alternatively, one skilled in the art will also appreciate that polypeptides having a certain function may differ in sequence, i.e., have some homology, between different species, but that the polypeptides can have the same or similar function. Thus, the polypeptides of the invention also include mutant polypeptides having variants of the amino acid sequences encoded by the nucleotides set forth in SEQ ID Nos. 1-8. It is easy for those skilled in the art to prepare a polypeptide, such as an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO. 1-8, which has been substituted, deleted, inserted or added with one or several amino acid residues and has the same or similar activity as the polypeptide encoded by the amino acid sequence shown in SEQ ID NO. 1-8. As used herein, "a plurality" means 2 to 20, preferably 2 to 10, and more preferably 2 to 5. The substitution, deletion, insertion or addition referred to herein can be obtained by a publicly known conservative mutation.

Based on the teachings of the present invention, it will be appreciated by those skilled in the art that the present invention improves L-lysine production in an L-lysine producing strain by reducing, or even completely inactivating, the activity of one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase in the cells of the L-lysine producing strain. Thus, the phrase "making one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase function abnormally in the cell of the L-lysine-producing strain" as used herein means that the intracellular activity of one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase is reduced, weakened, or even completely eliminated, or the function of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase is eliminated, by a technical means such as genetic modification or the like.

The term "modification" as used herein refers to any genetic manipulation of a wild-type strain or parent strain, including but not limited to various means of molecular biology.

The term "attenuation or inactivation of gene expression" in the present invention refers to a reduction or elimination of the intracellular activity of one or more enzymes or proteins encoded by DNA in a microorganism, including, but not limited to, by deletion of part or all of the encoding gene, frame shift mutation of the gene, attenuation of the strength of transcription or translation, or use of a gene or allele encoding the corresponding enzyme or protein with lower activity, or inactivation of the corresponding gene or enzyme, and optionally combined use of these methods. The reduction of gene expression can be achieved by suitable cultivation methods or genetic modification (mutation) of the signal structures of gene expression, for example repressor genes, active genes, operators, promoters, attenuators, ribosome binding sites, the start codon and terminators.

Based on the teachings of the present invention, one of skill in the art will recognize that "attenuation" as described herein refers to a reduction in the activity of the mutated polypeptide as compared to the original polypeptide. For example, the activity of a mutant imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% compared to the endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase; or even completely inactivated.

Based on the teachings of the present invention, one skilled in the art knows that the production of L-lysine can be increased by weakening the activity of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase, or rendering imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase unable to function normally in a cell. The skilled person can, by means of techniques known in the art, render imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase unable to function normally in the cell. For example, the term "modified to render an imidazole glycerol phosphate dehydratase not normally functional in a cell" as used herein means that the bacterium has been modified such that the function of the imidazole glycerol phosphate dehydratase has been removed, or the imidazole glycerol phosphate dehydratase activity has been reduced or attenuated compared to an unmodified strain, such as a wild-type strain/parent strain. The case where the imidazole glycerol phosphate dehydratase does not function normally may be, for example, a case where transcription or translation of the gene encoding the enzyme is inhibited, and thus the gene product imidazole glycerol phosphate dehydratase cannot be produced or the yield is reduced; or the imidazole glycerol phosphate dehydratase encoding gene on the bacterial chromosome is mutated and/or the expression regulatory sequence of the gene is mutated, whereby the imidazole glycerol phosphate dehydratase activity is reduced or attenuated; it may also mean that the number of imidazole glycerol phosphate dehydratase molecules per cell is reduced and the activity of each enzyme molecule is attenuated, specifically, by making the enzyme-encoding gene on the chromosome defective, or by modifying an expression control sequence such as a promoter or an SD sequence; it can also be achieved by introducing amino acid substitutions into the coding region (missense mutations), a stop codon (nonsense mutations), or by introducing insertions or deletions of one or two bases into the coding region (frameshift mutations) or deletion of parts of the gene (Journal of Biological Chemistry 1997, 272: 8611-8617).

Also, the "modified to prevent the histidinol phosphorylase from functioning normally in the cell" may be a case where transcription or translation of the gene encoding the enzyme is inhibited, and thus the product of the gene, the histidinol phosphorylase, is not produced or is produced in a reduced amount; or a gene encoding said histidinol phosphorylase on a bacterial chromosome and/or an expression control sequence for said gene is mutated, whereby the histidinol phosphorylase activity is reduced or attenuated; it may also mean reducing the number of and activity of each molecule of a histidinol phosphorylase per cell, in particular, by making the enzyme-encoding gene on the chromosome defective, or by modifying an expression control sequence such as a promoter or an SD sequence; it can also be achieved by introducing amino acid substitutions into the coding region (missense mutations), a stop codon (nonsense mutations), or by introducing insertions or deletions of one or two bases into the coding region (frameshift mutations) or deletion of parts of the gene (Journal of Biological Chemistry 1997, 272: 8611-8617).

Similarly, the phrase "modified such that the histidine aldehyde/histidine alcohol dehydratase does not function normally in a cell" as used herein means that the bacterium has been modified such that the function of the histidine aldehyde/histidine alcohol dehydratase has been removed, or the activity of the histidine aldehyde/histidine alcohol dehydratase has been reduced or attenuated compared to an unmodified strain, such as a wild-type strain/parent strain. The case where the histidine aldehyde/histidine alcohol dehydratase does not function normally may be, for example, a case where transcription or translation of the gene encoding the enzyme is inhibited, and thus the product of the gene, the histidine aldehyde/histidine alcohol dehydratase, is not produced or the yield is reduced; or a gene encoding said histidine aldehyde/histidine alcohol dehydratase on the bacterial chromosome and/or an expression control sequence of said gene is mutated, whereby the histidine aldehyde/histidine alcohol dehydratase activity is reduced or attenuated; it may also mean reducing the number of and reducing the activity of each enzyme molecule per cell, in particular, by making the enzyme-encoding gene on the chromosome defective, or by modifying an expression control sequence such as a promoter or SD sequence; it can also be achieved by introducing amino acid substitutions into the coding region (missense mutations), a stop codon (nonsense mutations), or by introducing insertions or deletions of one or two bases into the coding region (frameshift mutations) or deletion of parts of the gene (Journal of Biological Chemistry 1997, 272: 8611-8617). "attenuation" as used herein includes, but is not limited to, complete abolition of activity, it being sufficient for the purposes of the present invention for the activity of the imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase to be reduced compared to the activity of the parent strain or unmodified strain, but preferably the activity is completely abolition.

The term "host cell" or "production strain" as used herein is a cell which has the meaning generally understood by a person skilled in the art, i.e., one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase, which has been modified so as not to function normally and which is capable of producing L-lysine. In other words, the present invention can utilize any host cell as long as one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase in the cell do not function normally and can produce L-lysine. The host cell may be from the genera Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium sp), Bacillus (Bacillus), Serratia (Serratia) or Vibrio (Vibrio). For example, in particular embodiments, the invention utilizes a host cell comprising the aspartate kinase lysC gene. However, it will be appreciated by those of ordinary skill in the art that the present invention is not limited to host cells containing an exogenously encoded gene. For example, the gene encoding aspartokinase contained in the host cell of the present invention may be not only a recombinant vector or a plasmid, but also a gene encoding the enzyme integrated on the genome, that is, the gene encoding the enzyme integrated on the genome may be obtained by homologous recombination by transferring into a plasmid, or may be obtained by site-directed mutagenesis of a corresponding site on the genome.

As used herein, the term "lysine-producing strain" refers to a strain which can produce L-lysine and can accumulate L-lysine when the bacterium is cultured in culture, or can secrete L-lysine into a medium, that is, can obtain extracellular free lysine. For example, it may be a naturally occurring lysine-producing strain, or it may be a genetically engineered lysine-producing strain, including but not limited to, in which one or more genes selected from the group consisting of:

a. a gene encoding aspartokinase lysC which relieves feedback inhibition by lysine;

b. the dapA gene encoding dihydrodipicolinate synthase which relieves feedback inhibition by lysine;

c. a dapB gene encoding dihydrodipicolinate reductase;

d. a ddh gene encoding diaminopimelate dehydratase;

e. dapD encoding a tetrahydropyridyldicarboxylate succinylase and dapE encoding a succinyldiaminopimelate deacylase;

f. an asd gene encoding aspartate-semialdehyde dehydratase;

g. the ppc gene encoding phosphoenolpyruvate carboxylase; or

h. The pntAB gene encoding nicotinamide adenine dinucleotide transhydrogenase.

Furthermore, one or several genes selected from the group consisting of:

a. the adhE gene encoding ethanol dehydratase;

b. the ackA gene encoding acetate kinase;

c. a pta gene encoding a phosphate acetyltransferase;

d. an ldhA gene encoding lactate dehydratase;

e. the focA gene encoding a formate transporter;

f. the pflB gene encoding pyruvate formate lyase;

g. a poxB gene encoding pyruvate oxidase;

h. a thrA gene encoding an aspartokinase I/homoserine dehydratase I bifunctional enzyme;

i. the thrB gene encoding homoserine kinase;

j. an ldcC gene encoding lysine decarboxylase; and

h. the cadA gene which codes for lysine decarboxylase.

The invention has the advantages that:

1. the invention provides a brand new method for constructing L-lysine production strains, thereby opening up a new idea for constructing the L-lysine high-yield strains;

2. the lysine yield of the L-lysine production strain constructed by the invention is obviously improved; and

3. the cost of producing L-lysine by the method of the invention can be significantly reduced.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the methods and materials described herein are preferred.

Examples

Example 1 attenuation and inactivation of the hisB Gene in E.coli BW25113

Coli genome rapid manipulation techniques using CRISPR/Cas9 [ Zhao, d., et al. (2017).Sci Rep16624, using the primers HisB-F and HisB-Ra in Table 1, with chloramphenicol resistance gene plus N20PAM fragment [ ZHao, D., et al. (2017).Sci Rep7 (1: 16624.) As a template, a recombinant fragment hisBgtg for replacing atg, the initiation codon of the hisB gene of BW25113 (SEQ ID NO:1), with gtg was obtained by PCR amplification. Plasmid pCAGO [ Zhao, d., et al. (2017).Sci Rep7 (1: 16624.) into BW25113 to obtain the strain BW25113 (pCAGO). BW25113(pCAGO) competent cells for electrotransformation were prepared using the following medium: 10g/L peptone, 10g/L sodium chloride, 5g/L yeast powder, 10g/L glucose, and IPTG at a final concentration of 0.1 mM. The recombinant fragment hisBgtg was transformed into BW25113(pCAGO) competent cells, cultured at 30 ℃ for 2 hours, and colonies capable of growing on LB plates containing 100mg/L ampicillin, 30mg/L chloramphenicol, and 10g/L glucose were selected. The obtained colonies were further cultured at 30 ℃ for 6 hours in LB liquid medium containing 100mg/L ampicillin, 0.1mM IPTG and 2g/L arabinose, and then spread on LB medium plates containing 100mg/L ampicillin, individual colonies were selected, verified by sequencing to obtain a strain in which atg, the initiation codon of the hisB gene, was mutated to gtg, and then cultured at 37 ℃ and the pCAGO plasmid was discarded to obtain a strain named BW 25113-hisBgtg.

The above-mentioned CRISPR/Cas 9-based E.coli genome rapid manipulation technology [ ZHao, D., et al (2017). Sci Rep 7(1):16624 ] was used, and a recombinant fragment [ Delta hisB for knocking out the 15 th base to the 21 st base of the hisB gene (SEQ ID NO:1) was obtained by PCR amplification using the primers HisB-F and HisB-Rn in Table 1, and the chloramphenicol resistance gene plus the N20PAM fragment [ ZHao, D., et al (2017). Sci Rep 7(1):16624 ] as templates. Using the above-mentioned gene recombination procedure, using plasmid pCAGO and the recombinant fragment Δ hisB obtained in this example, gene editing was performed on E.coli BW25113, and the screening procedure mentioned in example 1 was performed to obtain a strain in which bases from 15 th to 21 st of the hisB gene were knocked out, in which the sites 13 to 15 of the hisB gene were TAA, forming a stop codon, and the hisB gene was not normally expressed, thereby inactivating the hisB, which was designated as BW25113 Δ hisB.

TABLE 1 primers for construction of recombinant fragments for attenuation and inactivation of the hisB Gene in E.coli

Example 2 attenuation and inactivation of the hisD Gene in E.coli

The rapid operation technology of the Escherichia coli genome based on CRISPR/Cas9 mentioned in example 1 is utilized to carry out atg-to-gtg replacement on the starting codon of the hisD gene (SEQ ID NO:2) of Escherichia coli BW25113, the primers are HisD-F and HisD-Ra in Table 2, and the constructed strain is named as BW 25113-hisDgtg; in addition, the same genome rapid manipulation technique was used to edit bases 8 to 14 of the hisD gene (SEQ ID NO:2) using HisD-F and HisD-Rn in Table 2, and the sites 7 to 9 of the hisD gene after editing were TAA, forming a stop codon, which resulted in inactivation of hisD due to failure of normal expression of the hisD gene, and the obtained strain was named BW 25113. delta. hisD.

TABLE 2 primers for construction of recombinant fragments for attenuated expression and inactivation of the hisD Gene in E.coli

Example 3 Corynebacterium glutamicum B253(GeneBank access number CP010451) and 13032 (lysC)^T311I) Knockout of middle hisB, hisN, hisD genes

First, a lysine-producing strain 13032 (lysC) was obtained by replacing the threonine codon at position 311 of the aspartokinase (lysC) gene of Corynebacterium glutamicum 13032 with an isoleucine codon [ Ohnishi, J., et al (2002).: Appl Microbiol Biotechnol 58(2):217-^T311I)。

CRISPR/Cas9 and activation-induced cytidine deaminase (AID) reported in the literature were used [ Wang, y., et al (2018).Metab Eng47:200-210 ] for B253 and 13032 (lysC)^T311I) The middle hisB, hisN and hisD genes were inactivated separately.

The hisB genes (SEQ ID NO:3) and 13032 (lysC) used in B253 in Table 3 were synthesized separately^T311I) Primers hisBF and hisBR for mutating the 238 th base C of the hisB gene (SEQ ID NO:6) to T are used for mutating the hisN genes (SEQ ID NO:4) and 13032 (lysC) in B253^T311I) Primers hisNF and hisNR for mutating the 381 nd base G of the middle hisN gene (SEQ ID NO:7) to A, and primers hisD gene (SEQ ID NO:5) and 13032 (lysC) in B253^T311I) Primers hisDF and hisDR in which the 487 th base C of the middle hisD gene (SEQ ID NO:8) is mutated to T. According to the procedure in literature [ Wang, y., et al. (2018).Metab Eng47:200-210 ], annealing each pair of primers respectively, mixing with pgRNA-ccdB plasmid respectively, performing enzyme digestion and ligation to obtain plasmids pgRNA-hisB, pgRNA-hisN and pgRNA-hisD respectively, co-transforming the plasmids and plasmid pnCas9(D10A) -AID with nCas9-AID gene into corynebacterium glutamicum B253 and 13032 (lysC)^T311I) In the method, genes of hisB, hisN and hisD are edited according to the steps in the literature, and finally plasmids are removed to obtain the strain B253-hisB^C238T，B253-hisN^G381A，B253-hisD^C487T，13032(lysC^T311I)-hisB^C238T，13032(lysC^T311I)-hisN^G381AAnd 13032 (lysC)^T311I)-hisD^C487T。hisB^C238T，hisN^G381AAnd hisD^C487TAfter the mutation of the gene, a premature stop codon is formed in each case within the gene, so that the mutation leads to a loss of the corresponding enzyme activity in the strain.

TABLE 3 primers for the construction of the inactivation of the hisB, hisN, hisD genes in C.glutamicum B253

The sequences described in the above examples are as follows:

1, SEQ ID NO: escherichia coli BW25113 hisB, imidazoglycerol-phosphate dehydrogenase/histidinol-phosphate (wherein the start codon atg is underlined and the 15 th to 21 st bases to be knocked out are in italic font)

AtgAGTCAGAAGTATCTTTTTATCGATCGCGATGGAACCCTGATTAGCGAACCGCCGAGTGATTTTCAGGTGGACCGTTTTGATAAACTCGCCTTTGAACCGGGCGTGATCCCGGAACTGCTGAAGCTGCAAAAAGCGGGCTACAAGCTGGTGATGATCACTAATCAGGATGGTCTTGGAACACAAAGTTTCCCACAGGCGGATTTCGATGGCCCGCACAACCTGATGATGCAGATCTTCACCTCGCAAGGCGTACAGTTTGATGAAGTGCTGATTTGTCCGCACCTGCCCGCCGATGAGTGCGACTGCCGTAAGCCGAAAGTAAAACTGGTGGAACGTTATCTGGCTGAGCAAGCGATGGATCGCGCTAACAGTTATGTGATTGGCGATCGCGCGACCGACATTCAACTGGCGGAAAACATGGGCATTACTGGTTTACGCTACGACCGCGAAACCCTGAACTGGCCAATGATTGGCGAGCAACTCACCAGACGTGACCGTTACGCTCACGTAGTGCGTAATACCAAAGAGACGCAGATTGACGTTCAGGTGTGGCTGGATCGTGAAGGTGGCAGCAAGATTAACACCGGCGTTGGCTTCTTTGATCATATGCTGGATCAGATCGCTACCCACGGCGGTTTCCGCATGGAAATCAACGTCAAAGGCGACCTCTATATCGACGATCACCACACCGTCGAAGATACCGGCCTGGCGCTGGGCGAAGCGCTAAAAATCGCCCTCGGAGACAAACGCGGTATTTGCCGCTTTGGTTTTGTGCTACCGATGGACGAATGCCTTGCCCGCTGCGCGCTGGATATCTCTGGTCGCCCGCACCTGGAATATAAAGCCGAGTTTACCTACCAGCGCGTGGGCGATCTCAGCACCGAAATGATCGAGCACTTCTTCCGTTCGCTCTCATACACCATGGGCGTGACGCTACACCTGAAAACCAAAGGTAAAAACGATCATCACCGTGTAGAGAGTCTGTTCAAAGCCTTTGGTCGCACCCTGCGCCAGGCCATCCGCGTGGAAGGCGATACCCTGCCCTCGTCGAAAGGAGTGCTGtaa

2, SEQ ID NO: HisD of Escherichia coli BW25113, histidine dehydrogenase/histidine dehydrogenase (wherein the initiation codon atg is underlined and the 8 th to 14 th bases to be knocked out are in italic)

atgAGCTTTAACACAATCATTGACTGGAATAGCTGTACTGCGGAGCAACAACGCCAGCTGTTAATGCGCCCGGCGATTTCCGCCTCTGAAAGCATTACCCGCACTGTTAACGATATTCTCGATAACGTGAAAGCACGCGGCGATGAGGCCCTGCGGGAATACAGCGCGAAGTTTGATAAAACCACGGTTACCGCGCTGAAGGTGTCTGCAGAGGAGATCGCCGCCGCCAGCGAACGCCTGAGCGACGAGCTAAAACAGGCGATGGCGGTGGCAGTAAAGAATATTGAAACCTTCCACACTGCGCAAAAACTGCCGCCGGTAGATGTAGAAACGCAGCCAGGCGTGCGTTGCCAGCAGGTCACGCGTCCGGTAGCTTCAGTTGGGTTGTATATTCCTGGCGGCTCCGCCCCGCTCTTCTCAACGGTATTAATGCTGGCGACTCCGGCGAGTATTGCGGGCTGTAAAAAAGTGGTGCTGTGCTCACCGCCGCCGATTGCCGATGAGATCCTTTATGCGGCGCAGCTGTGCGGTGTGCAGGACGTGTTTAACGTCGGCGGCGCACAGGCCATTGCCGCACTGGCGTTTGGTACGGAATCTGTGCCAAAAGTGGACAAAATCTTCGGGCCGGGTAACGCCTTTGTCACCGAAGCGAAACGTCAGGTGAGCCAGCGTCTGGACGGTGCGGCGATCGATATGCCCGCAGGCCCGTCGGAAGTGCTGGTGATTGCTGACAGCGGCGCTACGCCGGATTTCGTGGCTTCTGATTTGCTCTCTCAGGCTGAACACGGCCCGGACTCACAGGTGATTTTACTGACGCCCGCTGCTGATATGGCGCGTCGCGTTGCCGAGGCCGTCGAACGCCAACTGGCAGAACTGCCGCGTGCCGAAACCGCCCGCCAGGCACTGAACGCCAGCCGCCTGATCGTGACTAAAGATTTAGCGCAGTGCGTGGAGATCTCCAACCAGTACGGCCCGGAGCACCTGATCATTCAGACCCGCAACGCCCGTGAACTGGTCGATAGCATCACCAGCGCCGGTTCGGTATTTCTTGGTGACTGGTCACCGGAATCGGCAGGTGATTACGCCTCCGGCACCAACCACGTTCTACCGACTTACGGTTACACCGCCACCTGTTCCAGCCTCGGGCTGGCAGATTTCCAGAAGCGCATGACCGTACAGGAACTGTCGAAAGAGGGGTTCTCCGCGCTGGCTTCAACCATAGAAACACTGGCCGCCGCCGAGCGCCTGACCGCCCACAAAAATGCCGTTACTTTGCGTGTTAACGCCCTTAAGGAGCAAGCAtga

3, SEQ ID NO: hisB of Corynebacterium glutamicum B253: imidazolycol-phosphate dehydrogenase (wherein the 238 th base C to be mutated to T is underlined)

ATGACTGTCGCACCAAGAATTGGTACCGCAACCCGCACCACCAGCGAATCCGACATCACCGTCGAGATCAACCTGGACGGCACCGGCAAAGTAGATATCGATACCGGCCTGCCATTTTTCGACCACATGCTCACTGCATTCGGCGTGCACGGCAGTTTTGATCTGAAAGTCCATGCCAAGGGCGACATCGAGATCGACGCACACCACACCGTGGAAGATACCGCCATCGTGCTCGGCCAAGCACTCCTTGACGCTATTGGCGACAAGAAAGGCATCCGCCGTTTCGCATCCTGCCAGCTGCCCATGGATGAGGCATTAGTGGAGTCCGTGGTGGATATCTCCGGTCGCCCATACTTCGTGATCTCCGGCGAACCAGACCACATGATCACCTCCGTGATCGGTGGACACTACGCAACCGTGATCAACGAGCACTTCTTTGAAACCCTCGCGCTCAACTCCCGAATCACCCTCCACGTGATCTGCCACTACGGCCGCGACCCTCACCACATCACCGAAGCAGAATACAAGGCTGTTGCCCGTGCGCTGCGCGGTGCCGTAGAGATGGATCCTCGTCAAACAGGAATCCCATCCACTAAGGGAGCGCTCTAG

4, SEQ ID NO: hisN of C.glutamicum B253: histidine phosphatase (wherein the base G at position 381 to be mutated to A is underlined)

ATGAGCAAATATGCAGACGATTTAGCCTTAGCCCTCGAACTCGCCGAACTTGCCGATTCCATCACCCTCGACCGTTTCGAAGCCTCTGACCTGGAAGTATCCTCCAAGCCAGACATGACTCCCGTCAGCGATGCCGACCTGGCGACCGAAGAAGCACTCCGTGAGAAAATCGCCACCGCCCGCCCCGCCGACTCCATCCTCGGTGAAGAATTCGGTGGCGACGTAGAATTCAGCGGCCGCCAGTGGATCATCGACCCCATCGACGGCACCAAAAACTACGTCCGCGGCGTCCCCGTATGGGCAACCCTGATCGCGCTGCTCGACAACGGCAAGCCCGTCGCAGGTGTCATCTCCGCACCCGCACTGGCTAGGCGTTGGTGGGCATCCGAAGGGGCCGGCGCATGGCGCACCTTCAACGGCAGCTCCCCACGCAAGCTGTCCGTGTCCCAGGTGTCCAAGCTTGACGACGCCTCCCTCTCCTTCTCCTCCCTCTCCGGCTGGGCCGAACGAGATTTGCGCGATCAGTTCGTCTCCCTAACTGATACCACCTGGCGACTCCGCGGCTACGGCGACTTCTTCTCCTACTGCCTCGTTGCTGAAGGTGCCGTCGATATCGCCGCTGAACCAGAAGTCAGTCTCTGGGATCTCGCTCCCCTATCAATTCTGGTTACTGAGGCCGGCGGAAAATTCACCTCGCTAGCGGGTGTCGATGGACCACACGGTGGCGATGCAGTAGCCACCAACGGAATCCTGCACGATGAGACGCTGGATCGTTTAAAATAG

5, SEQ ID NO: HisD of C.glutamicum B253: histidine dehydrogenase (wherein the base C at position 487 to be mutated to T is underlined)

ATGTTGAATGTCACTGACCTGCGAGGTCAAACACCATCCAAGAGCGACATCCGACGTGCTTTGCCACGTGGTGGCACTGACGTGTGGTCTGTGCTTCCCATAGTGCAGCCTGTTGTAGAAGATGTCCAAAACCGCGGCGCTGAAGCTGCTTTGGATTACGGCGAGAAGTTCGACCATATTCGCCCCGCCTCGGTGCGGGTGCCAGCTGAGGTTATTGCTGCAGCAGAAAACACCTTGGATCCGTTGGTGCGTGAATCGATTGAAGAGTCGATTCGTCGCGTCCGCAAGGTTCACGCTGAGCAAAAGCCAGCCGAGCACACCACTGAACTTTCACCAGGTGGCACCGTCACTGAGCGTTTCATGCCGATTGATCGCGTGGGACTGTACGTTCCAGGCGGCAATGCGGTGTACCCATCAAGCGTGATTATGAATACTGTCCCAGCTCAAGAGGCTGGTGTGAACTCCCTTGTGGTTGCGTCGCCTCCTCAGGCTGAGCACGGTGGCTGGCCTCACCCCACCATTTTGGCGGCGTGTTCCATCTTGGGTGTTGATGAGGTGTGGGCTGTCGGCGGCGGTCAGGCCGTGGCGTTGCTGGCTTATGGTGATGACGCTGCAGGTCTCGAGCCTGTGGATATGATCACTGGACCTGGCAATATCTTTGTCACCGCTGCGAAGCGCCTGGTCAGGGGAGTGGTAGGTACTGATTCTGAGGCTGGCCCTACAGAAATCGCTGTGCTTGCTGATGCCTCTGCCAACGCCGTCAACGTTGCCTACGATCTGATCAGCCAAGCAGAACACGATGTCATGGCTGCGTCCGTGCTCATCACTGACTCCGAGCAGCTTGCCAAGGACGTAAACAGGGAAATCGAGGCGCGTTACTCAATCACGCGCAACGCCGAGCGCGTCGCAGAAGCTTTGCGCGGGGCCCAGAGTGGCATCGTGCTTGTCGACGACATTTCCGTGGGTATCCAAGTAGCCGATCAATACGCAGCGGAACACCTGGAAATCCACACTGAGAACGCGCGCGCCGTAGCAGAGCAGATCACCAACGCGGGTGCGATCTTCGTGGGCGATTTCTCACCAGTACCACTGGGTGATTACTCCGCAGGATCCAACCACGTGCTGCCAACCTCTGGATCCGCTCGTTTCTCCGCAGGTCTATCCACGCACACGTTCCTTCGCCCAGTCAACCTCATTGAATACGATGAGGCTGCTCTGAAGGACGTCTCGCAGGTTGTCATCAACTTTGCCAACGCCGAAGATCTTCCAGCGCACGGCGAAGCAATCCGTGCACGCTTTGAAAACCTCCCCACCACCGACGAGGCCTAA

6 of SEQ ID NO: hisB of Corynebacterium glutamicum 13032: imidazolycol-phosphate dehydrogenase (wherein the 238 th base C to be mutated to T is underlined)

ATGACTGTCGCACCAAGAATTGGTACCGCAACCCGCACCACCAGCGAATCCGACATCACCGTCGAGATCAACCTGGACGGCACCGGCAAAGTAGATATCGATACCGGCCTGCCATTTTTCGACCACATGCTCACTGCATTCGGCGTGCACGGCAGTTTTGATCTGAAAGTCCATGCCAAGGGCGACATCGAGATCGACGCACACCACACCGTGGAAGATACCGCCATCGTGCTCGGCCAAGCACTCCTTGACGCTATTGGCGACAAGAAAGGCATCCGCCGTTTCGCATCCTGCCAGCTGCCCATGGATGAGGCATTAGTGGAGTCCGTGGTGGATATCTCCGGTCGCCCATACTTCGTGATCTCCGGCGAACCAGACCACATGATCACCTCCGTGATCGGTGGACACTACGCAACCGTGATCAACGAGCACTTCTTTGAAACCCTCGCGCTCAACTCCCGAATCACCCTCCACGTGATCTGCCACTACGGCCGCGACCCTCACCACATCACCGAAGCAGAGTACAAGGCTGTTGCCCGTGCGCTGCGCGGTGCCGTAGAGATGGATCCTCGTCAAACAGGAATCCCATCCACTAAGGGAGCGCTCTAG

7, SEQ ID NO: hisN of Corynebacterium glutamicum 13032: histidine phosphatase (wherein the base G at position 381 to be mutated to A is underlined)

ATGAGCAAATATGCAGACGATTTAGCCTTAGCCCTCGAACTTGCCGAACTTGCCGATTCCATCACCCTCGACCGCTTCGAAGCCTCTGACCTGGAAGTATCCTCCAAGCCAGACATGACTCCCGTCAGCGATGCCGACCTGGCGACCGAAGAAGCACTCCGTGAGAAAATCGCCACCGCCCGCCCCGCCGACTCCATCCTCGGTGAAGAATTCGGTGGCGACGTAGAATTCAGCGGCCGCCAGTGGATCATCGACCCCATCGACGGCACCAAAAACTACGTCCGCGGCGTCCCCGTATGGGCAACCCTGATCGCGCTGCTCGACAACGGCAAACCCGTCGCAGGTGTCATCTCCGCACCCGCACTGGCTAGGCGTTGGTGGGCATCCGAAGGGGCCGGCGCATGGCGCACCTTCAACGGCAGCTCCCCACGCAAACTGTCCGTGTCCCAGGTGTCCAAGCTTGACGACGCCTCCCTCTCCTTCTCCTCCCTCTCCGGCTGGGCCGAACGAGATTTGCGCGATCAGTTCGTCTCCCTAACTGATACCACCTGGCGACTCCGCGGCTACGGCGACTTCTTCTCCTACTGCCTCGTCGCCGAAGGTGCCGTCGATATCGCCGCTGAACCAGAAGTCAGCCTCTGGGATCTTGCTCCCCTGTCCATCCTGGTCACCGAAGCCGGAGGAAAGTTCACCTCACTGGCTGGCGTCGATGGACCACACGGTGGCGATGCAGTAGCCACCAACGGCATCCTGCACGATGAGACGCTGGATCGTTTAAAATAG

8, SEQ ID NO: HisD of Corynebacterium glutamicum 13032: histidine dehydrogenase (wherein the base C at position 487 to be mutated to T is underlined)

ATGTTGAATGTCACTGACCTGCGAGGTCAAACACCATCCAAGAGCGACATCCGACGTGCTTTGCCACGTGGTGGCACTGACGTGTGGTCTGTGCTTCCCATAGTGCAGCCTGTTGTAGAAGATGTCCAAAACCGCGGCGCTGAAGCTGCTTTGGATTACGGCGAGAAGTTCGACCATATTCGCCCCGCCTCGGTGCGGGTGCCAGCTGAGGTTATTGCTGCAGCAGAAAACACCTTAGATCCGTTGGTGCGTGAATCGATTGAAGAGTCGATTCGTCGCGTCCGCAAGGTTCACGCTGAGCAAAAGCCATCCGAGCACACCACTGAACTTTCACCAGGTGGCACCGTCACTGAGCGTTTCATGCCGATTGATCGCGTGGGACTGTACGTTCCAGGCGGCAATGCGGTGTACCCATCAAGCGTGATTATGAATACTGTCCCAGCTCAAGAGGCTGGTGTGAACTCCCTTGTGGTTGCGTCGCCTCCTCAGGCTGAGCACGGTGGCTGGCCTCACCCCACCATTTTGGCGGCGTGTTCCATCTTGGGTGTTGATGAGGTGTGGGCTGTCGGCGGCGGTCAGGCCGTGGCGTTGCTGGCTTATGGTGATGACGCTGCAGGTCTCGAGCCTGTGGATATGATCACTGGACCTGGCAATATCTTTGTCACCGCTGCGAAGCGCCTGGTCAGGGGAGTGGTAGGTACTGATTCTGAGGCTGGCCCTACAGAAATCGCTGTGCTTGCTGATGCCTCTGCCAACGCCGTCAACGTTGCCTACGATCTGATCAGCCAAGCAGAACACGATGTCATGGCTGCGTCCGTGCTCATCACTGACTCCGAGCAGCTTGCCAAGGACGTAAACAGGGAAATCGAGGCGCGTTACTCAATCACGCGCAACGCCGAGCGCGTCGCAGAAGCTTTGCGCGGGGCCCAGAGTGGCATCGTGCTTGTCGACGACATTTCCGTGGGTATCCAAGTAGCCGATCAATACGCAGCGGAACACCTGGAAATCCACACTGAGAACGCGCGCGCCGTAGCAGAGCAGATCACCAACGCGGGTGCGATCTTCGTGGGCGATTTCTCACCAGTACCACTGGGTGATTACTCCGCAGGATCCAACCACGTGCTGCCAACCTCTGGATCCGCTCGTTTCTCCGCAGGTCTATCCACGCACACGTTCCTTCGCCCAGTCAACCTCATTGAATACGATGAGGCTGCTCTGAAGGACGTCTCGCAGGTTGTCATCAACTTTGCCAACGCCGAAGATCTTCCAGCGCACGGCGAAGCAATCCGTGCACGCTTTGAAAACCTCCCCACCACCGACGAGGCCTAA

Example 4 construction and testing of lysine-producing E.coli

To construct a lysine-producing strain, dapA with feedback inhibition by lysine released^E84TAnd lysC^T253RThe pTrc99A plasmid was introduced into wild-type E.coli to impart lysine-producing ability, and we constructed the plasmid pTrc99A-dapA^E84T-lysC^T253R[Geng,F.,et al.(2013).Appl Microbiol Biotechnol 97(5):1963-1971]The strain BW25113-hisBgtg (pTrc 99A-dapA) was obtained by transforming E.coli BW25113-hisBgtg, BW25113-hisDgtg, BW25113-hisD and BW25113, respectively^E84T-lysC^T253R)、BW25113△hisB(pTrc99A-dapA^E84T-lysC^T253R)、BW25113-hisDgtg(pTrc99A-dapA^E84T-lysC^T253R)、BW25113△hisD(pTrc99A-dapA^E84T-lysC^T253R)、BW25113(pTrc99A-dapA^E84T-lysC^T253R)。

Meanwhile, in order to verify whether inactivation of hisC contributes to lysine production, we used the plasmid pTrc99A-dapA, considering that the reaction catalyzed by the enzyme encoded by the hisC gene in Escherichia coli is the seventh reaction of histidine metabolic pathway, and that the reaction catalyzed by the hisB gene is the sixth and eighth reactions^E84T-lysC^T253RThe strain BW 25113. delta. hisC (pTrc 99A-dapA) was obtained from strain BW 25113. delta. hisC in which one of hisC genes in the single gene knockout library Keio collection [ Baba, T., et al. (2006). Mol Syst Biol,2,20060008 ] was inactivated, which was transformed into BW25113^E84T-lysC^T253R) The fermentation condition of the lysine-producing strain is tested.

The lysine fermentation conditions of the strains are tested by using a lysine fermentation medium, and the fermentation medium comprises the following components in percentage by weight (g/L): glucose, 40; KH (Perkin Elmer)₂PO₄，5；MgSO₄，1；(NH₄)₂SO₄，10；FeSO₄，0.003；MnSO₄0.003; 50 parts of corn steep liquor; KCl, 0.7; 3- (N-morpholinyl) propanesulfonic acid (MOPS), 42. First, the above-mentioned strains were cultured overnight in LB medium, the culture was inoculated as seeds into 96-well deep-well plates containing 200. mu.l of fermentation medium per well in an inoculum size of 5%, cultured at 37 ℃ for 24 hours with a shaker rotation speed of 800rpm, 3 strains each in parallel, and the lysine concentration and the glucose consumption were measured after the end of the fermentation, and the results are shown in Table 4. It can be seen that, compared with the control strain, the lysine yield of the strain in which the hisB and hisD genes are respectively weakened and inactivated is greatly improved, the sugar consumption is reduced, and the conversion rate is correspondingly greatly improved. The hisC gene-inactivated strain has reduced lysine production.

TABLE 4 lysine production by the respective engineered strains

Example 5 fermentation test of lysine-producing Corynebacterium glutamicum

To test the effect of inactivation of the hisB, hisN, hisD genes in C.glutamicum on lysine production by the strain, B253, 13032 (lysC) was added, respectively^T311I) And the strain B253-hisB constructed in example 3^C238T，B253-hisN^G381A，B253-hisD^C487T，13032(lysC^T311I)-hisB^C238T，13032(lysC^T311I)-hisN^G381AAnd 13032 (lysC)^T311I)-hisD^C487TAnd (3) performing fermentation test, wherein the fermentation medium comprises the following components in percentage by weight (g/L): glucose, 80; yeast powder 8; urea, 9; l-histidine, 0.25; k₂HPO₄，1.5；MnSO₄，0.01；MgSO₄，0.6；FeSO₄0.01; MOPS, 42. Firstly, inoculating the strain into LB culture medium containing 10g/L glucose for overnight culture, inoculating the culture as seeds into a 96-hole deep-hole plate containing 200 mul of fermentation culture medium per hole, wherein the inoculation amount is 5%, culturing at 30 ℃ for 24 hours, the rotating speed of a hole plate shaker is 800rpm, each strain is 3 in parallel, and after the fermentation is finished, detectingLysine production and glucose consumption were measured. As shown in Table 5, it can be seen that inactivation of hisB, hisD gene in Corynebacterium glutamicum significantly improved lysine production, and inactivation of hisN gene also improved lysine-producing ability of the strain, as compared to the control strain.

TABLE 5 influence of inactivation of the hisB, hisN, hisD genes in C.glutamicum B253 on lysine production

Bacterial strains	Lysine yield (g/L)	Glucose consumption (g/L)
			B253	5.3±0.12	41.21±0.98
B253-hisB^C238T	7.45±0.44	40.98±1.13
			B253-hisN^G381A	5.5±0.12	40.49±0.47
B253-hisD^C487T	5.88±0.24	40.57±1.16
			13032(lysC^T311I)	4.53±0.11	33.91±1.02
13032(lysC^T311I)-hisB^C238T	6.04±0.17	32.57±0.95
			13032(lysC^T311I)-hisN^G381A	4.79±0.08	33.01±1.27
13032(lysC^T311I)-hisD^C487T	5.16±0.25	33.26±0.68

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> L-lysine high-producing strain and construction method and application thereof

<130> P2018-1786

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 1068

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 1

atgagtcaga agtatctttt tatcgatcgc gatggaaccc tgattagcga accgccgagt 60

gattttcagg tggaccgttt tgataaactc gcctttgaac cgggcgtgat cccggaactg 120

ctgaagctgc aaaaagcggg ctacaagctg gtgatgatca ctaatcagga tggtcttgga 180

acacaaagtt tcccacaggc ggatttcgat ggcccgcaca acctgatgat gcagatcttc 240

acctcgcaag gcgtacagtt tgatgaagtg ctgatttgtc cgcacctgcc cgccgatgag 300

tgcgactgcc gtaagccgaa agtaaaactg gtggaacgtt atctggctga gcaagcgatg 360

gatcgcgcta acagttatgt gattggcgat cgcgcgaccg acattcaact ggcggaaaac 420

atgggcatta ctggtttacg ctacgaccgc gaaaccctga actggccaat gattggcgag 480

caactcacca gacgtgaccg ttacgctcac gtagtgcgta ataccaaaga gacgcagatt 540

gacgttcagg tgtggctgga tcgtgaaggt ggcagcaaga ttaacaccgg cgttggcttc 600

tttgatcata tgctggatca gatcgctacc cacggcggtt tccgcatgga aatcaacgtc 660

aaaggcgacc tctatatcga cgatcaccac accgtcgaag ataccggcct ggcgctgggc 720

gaagcgctaa aaatcgccct cggagacaaa cgcggtattt gccgctttgg ttttgtgcta 780

ccgatggacg aatgccttgc ccgctgcgcg ctggatatct ctggtcgccc gcacctggaa 840

tataaagccg agtttaccta ccagcgcgtg ggcgatctca gcaccgaaat gatcgagcac 900

ttcttccgtt cgctctcata caccatgggc gtgacgctac acctgaaaac caaaggtaaa 960

aacgatcatc accgtgtaga gagtctgttc aaagcctttg gtcgcaccct gcgccaggcc 1020

atccgcgtgg aaggcgatac cctgccctcg tcgaaaggag tgctgtaa 1068

<210> 2

<211> 1305

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 2

atgagcttta acacaatcat tgactggaat agctgtactg cggagcaaca acgccagctg 60

ttaatgcgcc cggcgatttc cgcctctgaa agcattaccc gcactgttaa cgatattctc 120

gataacgtga aagcacgcgg cgatgaggcc ctgcgggaat acagcgcgaa gtttgataaa 180

accacggtta ccgcgctgaa ggtgtctgca gaggagatcg ccgccgccag cgaacgcctg 240

agcgacgagc taaaacaggc gatggcggtg gcagtaaaga atattgaaac cttccacact 300

gcgcaaaaac tgccgccggt agatgtagaa acgcagccag gcgtgcgttg ccagcaggtc 360

acgcgtccgg tagcttcagt tgggttgtat attcctggcg gctccgcccc gctcttctca 420

acggtattaa tgctggcgac tccggcgagt attgcgggct gtaaaaaagt ggtgctgtgc 480

tcaccgccgc cgattgccga tgagatcctt tatgcggcgc agctgtgcgg tgtgcaggac 540

gtgtttaacg tcggcggcgc acaggccatt gccgcactgg cgtttggtac ggaatctgtg 600

ccaaaagtgg acaaaatctt cgggccgggt aacgcctttg tcaccgaagc gaaacgtcag 660

gtgagccagc gtctggacgg tgcggcgatc gatatgcccg caggcccgtc ggaagtgctg 720

gtgattgctg acagcggcgc tacgccggat ttcgtggctt ctgatttgct ctctcaggct 780

gaacacggcc cggactcaca ggtgatttta ctgacgcccg ctgctgatat ggcgcgtcgc 840

gttgccgagg ccgtcgaacg ccaactggca gaactgccgc gtgccgaaac cgcccgccag 900

gcactgaacg ccagccgcct gatcgtgact aaagatttag cgcagtgcgt ggagatctcc 960

aaccagtacg gcccggagca cctgatcatt cagacccgca acgcccgtga actggtcgat 1020

agcatcacca gcgccggttc ggtatttctt ggtgactggt caccggaatc ggcaggtgat 1080

tacgcctccg gcaccaacca cgttctaccg acttacggtt acaccgccac ctgttccagc 1140

ctcgggctgg cagatttcca gaagcgcatg accgtacagg aactgtcgaa agaggggttc 1200

tccgcgctgg cttcaaccat agaaacactg gccgccgccg agcgcctgac cgcccacaaa 1260

aatgccgtta ctttgcgtgt taacgccctt aaggagcaag catga 1305

<210> 3

<211> 609

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 3

atgactgtcg caccaagaat tggtaccgca acccgcacca ccagcgaatc cgacatcacc 60

gtcgagatca acctggacgg caccggcaaa gtagatatcg ataccggcct gccatttttc 120

gaccacatgc tcactgcatt cggcgtgcac ggcagttttg atctgaaagt ccatgccaag 180

ggcgacatcg agatcgacgc acaccacacc gtggaagata ccgccatcgt gctcggccaa 240

gcactccttg acgctattgg cgacaagaaa ggcatccgcc gtttcgcatc ctgccagctg 300

cccatggatg aggcattagt ggagtccgtg gtggatatct ccggtcgccc atacttcgtg 360

atctccggcg aaccagacca catgatcacc tccgtgatcg gtggacacta cgcaaccgtg 420

atcaacgagc acttctttga aaccctcgcg ctcaactccc gaatcaccct ccacgtgatc 480

tgccactacg gccgcgaccc tcaccacatc accgaagcag aatacaaggc tgttgcccgt 540

gcgctgcgcg gtgccgtaga gatggatcct cgtcaaacag gaatcccatc cactaaggga 600

gcgctctag 609

<210> 4

<211> 783

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 4

atgagcaaat atgcagacga tttagcctta gccctcgaac tcgccgaact tgccgattcc 60

atcaccctcg accgtttcga agcctctgac ctggaagtat cctccaagcc agacatgact 120

cccgtcagcg atgccgacct ggcgaccgaa gaagcactcc gtgagaaaat cgccaccgcc 180

cgccccgccg actccatcct cggtgaagaa ttcggtggcg acgtagaatt cagcggccgc 240

cagtggatca tcgaccccat cgacggcacc aaaaactacg tccgcggcgt ccccgtatgg 300

gcaaccctga tcgcgctgct cgacaacggc aagcccgtcg caggtgtcat ctccgcaccc 360

gcactggcta ggcgttggtg ggcatccgaa ggggccggcg catggcgcac cttcaacggc 420

agctccccac gcaagctgtc cgtgtcccag gtgtccaagc ttgacgacgc ctccctctcc 480

ttctcctccc tctccggctg ggccgaacga gatttgcgcg atcagttcgt ctccctaact 540

gataccacct ggcgactccg cggctacggc gacttcttct cctactgcct cgttgctgaa 600

ggtgccgtcg atatcgccgc tgaaccagaa gtcagtctct gggatctcgc tcccctatca 660

attctggtta ctgaggccgg cggaaaattc acctcgctag cgggtgtcga tggaccacac 720

ggtggcgatg cagtagccac caacggaatc ctgcacgatg agacgctgga tcgtttaaaa 780

tag 783

<210> 5

<211> 1329

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 5

atgttgaatg tcactgacct gcgaggtcaa acaccatcca agagcgacat ccgacgtgct 60

ttgccacgtg gtggcactga cgtgtggtct gtgcttccca tagtgcagcc tgttgtagaa 120

gatgtccaaa accgcggcgc tgaagctgct ttggattacg gcgagaagtt cgaccatatt 180

cgccccgcct cggtgcgggt gccagctgag gttattgctg cagcagaaaa caccttggat 240

ccgttggtgc gtgaatcgat tgaagagtcg attcgtcgcg tccgcaaggt tcacgctgag 300

caaaagccag ccgagcacac cactgaactt tcaccaggtg gcaccgtcac tgagcgtttc 360

atgccgattg atcgcgtggg actgtacgtt ccaggcggca atgcggtgta cccatcaagc 420

gtgattatga atactgtccc agctcaagag gctggtgtga actcccttgt ggttgcgtcg 480

cctcctcagg ctgagcacgg tggctggcct caccccacca ttttggcggc gtgttccatc 540

ttgggtgttg atgaggtgtg ggctgtcggc ggcggtcagg ccgtggcgtt gctggcttat 600

ggtgatgacg ctgcaggtct cgagcctgtg gatatgatca ctggacctgg caatatcttt 660

gtcaccgctg cgaagcgcct ggtcagggga gtggtaggta ctgattctga ggctggccct 720

acagaaatcg ctgtgcttgc tgatgcctct gccaacgccg tcaacgttgc ctacgatctg 780

atcagccaag cagaacacga tgtcatggct gcgtccgtgc tcatcactga ctccgagcag 840

cttgccaagg acgtaaacag ggaaatcgag gcgcgttact caatcacgcg caacgccgag 900

cgcgtcgcag aagctttgcg cggggcccag agtggcatcg tgcttgtcga cgacatttcc 960

gtgggtatcc aagtagccga tcaatacgca gcggaacacc tggaaatcca cactgagaac 1020

gcgcgcgccg tagcagagca gatcaccaac gcgggtgcga tcttcgtggg cgatttctca 1080

ccagtaccac tgggtgatta ctccgcagga tccaaccacg tgctgccaac ctctggatcc 1140

gctcgtttct ccgcaggtct atccacgcac acgttccttc gcccagtcaa cctcattgaa 1200

tacgatgagg ctgctctgaa ggacgtctcg caggttgtca tcaactttgc caacgccgaa 1260

gatcttccag cgcacggcga agcaatccgt gcacgctttg aaaacctccc caccaccgac 1320

gaggcctaa 1329

<210> 6

<211> 609

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 6

atgactgtcg caccaagaat tggtaccgca acccgcacca ccagcgaatc cgacatcacc 60

gtcgagatca acctggacgg caccggcaaa gtagatatcg ataccggcct gccatttttc 120

gaccacatgc tcactgcatt cggcgtgcac ggcagttttg atctgaaagt ccatgccaag 180

ggcgacatcg agatcgacgc acaccacacc gtggaagata ccgccatcgt gctcggccaa 240

gcactccttg acgctattgg cgacaagaaa ggcatccgcc gtttcgcatc ctgccagctg 300

cccatggatg aggcattagt ggagtccgtg gtggatatct ccggtcgccc atacttcgtg 360

atctccggcg aaccagacca catgatcacc tccgtgatcg gtggacacta cgcaaccgtg 420

atcaacgagc acttctttga aaccctcgcg ctcaactccc gaatcaccct ccacgtgatc 480

tgccactacg gccgcgaccc tcaccacatc accgaagcag agtacaaggc tgttgcccgt 540

gcgctgcgcg gtgccgtaga gatggatcct cgtcaaacag gaatcccatc cactaaggga 600

gcgctctag 609

<210> 7

<211> 783

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 7

atgagcaaat atgcagacga tttagcctta gccctcgaac ttgccgaact tgccgattcc 60

atcaccctcg accgcttcga agcctctgac ctggaagtat cctccaagcc agacatgact 120

cccgtcagcg atgccgacct ggcgaccgaa gaagcactcc gtgagaaaat cgccaccgcc 180

cgccccgccg actccatcct cggtgaagaa ttcggtggcg acgtagaatt cagcggccgc 240

cagtggatca tcgaccccat cgacggcacc aaaaactacg tccgcggcgt ccccgtatgg 300

gcaaccctga tcgcgctgct cgacaacggc aaacccgtcg caggtgtcat ctccgcaccc 360

gcactggcta ggcgttggtg ggcatccgaa ggggccggcg catggcgcac cttcaacggc 420

agctccccac gcaaactgtc cgtgtcccag gtgtccaagc ttgacgacgc ctccctctcc 480

ttctcctccc tctccggctg ggccgaacga gatttgcgcg atcagttcgt ctccctaact 540

gataccacct ggcgactccg cggctacggc gacttcttct cctactgcct cgtcgccgaa 600

ggtgccgtcg atatcgccgc tgaaccagaa gtcagcctct gggatcttgc tcccctgtcc 660

atcctggtca ccgaagccgg aggaaagttc acctcactgg ctggcgtcga tggaccacac 720

ggtggcgatg cagtagccac caacggcatc ctgcacgatg agacgctgga tcgtttaaaa 780

tag 783

<210> 8

<211> 1329

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 8

atgttgaatg tcactgacct gcgaggtcaa acaccatcca agagcgacat ccgacgtgct 60

ttgccacgtg gtggcactga cgtgtggtct gtgcttccca tagtgcagcc tgttgtagaa 120

gatgtccaaa accgcggcgc tgaagctgct ttggattacg gcgagaagtt cgaccatatt 180

cgccccgcct cggtgcgggt gccagctgag gttattgctg cagcagaaaa caccttagat 240

ccgttggtgc gtgaatcgat tgaagagtcg attcgtcgcg tccgcaaggt tcacgctgag 300

caaaagccat ccgagcacac cactgaactt tcaccaggtg gcaccgtcac tgagcgtttc 360

atgccgattg atcgcgtggg actgtacgtt ccaggcggca atgcggtgta cccatcaagc 420

gtgattatga atactgtccc agctcaagag gctggtgtga actcccttgt ggttgcgtcg 480

cctcctcagg ctgagcacgg tggctggcct caccccacca ttttggcggc gtgttccatc 540

ttgggtgttg atgaggtgtg ggctgtcggc ggcggtcagg ccgtggcgtt gctggcttat 600

ggtgatgacg ctgcaggtct cgagcctgtg gatatgatca ctggacctgg caatatcttt 660

gtcaccgctg cgaagcgcct ggtcagggga gtggtaggta ctgattctga ggctggccct 720

acagaaatcg ctgtgcttgc tgatgcctct gccaacgccg tcaacgttgc ctacgatctg 780

atcagccaag cagaacacga tgtcatggct gcgtccgtgc tcatcactga ctccgagcag 840

cttgccaagg acgtaaacag ggaaatcgag gcgcgttact caatcacgcg caacgccgag 900

cgcgtcgcag aagctttgcg cggggcccag agtggcatcg tgcttgtcga cgacatttcc 960

gtgggtatcc aagtagccga tcaatacgca gcggaacacc tggaaatcca cactgagaac 1020

gcgcgcgccg tagcagagca gatcaccaac gcgggtgcga tcttcgtggg cgatttctca 1080

ccagtaccac tgggtgatta ctccgcagga tccaaccacg tgctgccaac ctctggatcc 1140

gctcgtttct ccgcaggtct atccacgcac acgttccttc gcccagtcaa cctcattgaa 1200

tacgatgagg ctgctctgaa ggacgtctcg caggttgtca tcaactttgc caacgccgaa 1260

gatcttccag cgcacggcga agcaatccgt gcacgctttg aaaacctccc caccaccgac 1320

gaggcctaa 1329

<210> 9

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gccagcgcgt cattgacgcc ttacgtgcgg agcaagtttg gtgagtcaga agttcatgtg 60

cagctccatc ag 72

<210> 10

<211> 96

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gttcgctaat cagggttcca tcgcgatcga taaaaagata cttctgactc accaaacttg 60

ctccgcacgt aaggcgcaac gtcatctcgt tctccg 96

<210> 11

<211> 99

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcactcggcg gttcgctaat cagggttcca tcgcgatcga ttacttctga ctcaccaaac 60

ttgctccgca cgtaaggcgc aacgtcatct cgttctccg 99

<210> 12

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caattctggt cctgccgatt gagaagatga tggagtgatc gccgtgagct tcatgtgcag 60

ctccatcag 69

<210> 13

<211> 98

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gttgctccgc agtacagcta ttccagtcaa tgattgtgtt aaagctcacg gcgatcactc 60

catcatcttc tcaatcggca acgtcatctc gttctccg 98

<210> 14

<211> 96

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcgttgttgc tccgcagtac agctattcca gtcaatgatt agctcacggc gatcactcca 60

tcatcttctc aatcggcaac gtcatctcgt tctccg 96

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttcacaagca ctccttgacg ctat 24

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aaacatagcg tcaaggagtg cttg 24

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ttcaccacca acgcctagcc agtg 24

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaaccactgg ctaggcgttg gtgg 24

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ttcactcagg ctgagcacgg tggc 24

<210> 20

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaacgccacc gtgctcagcc tgag 24

Claims

1. A method for constructing an L-lysine producing strain is characterized in that one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase and histidinol/histidinol dehydrogenase in cells of the L-lysine producing strain are genetically modified to be weakened or inactivated intracellularly; the strain is Escherichia coli (E. coli) Or Corynebacterium glutamicum: (Corynebacterium glutamicum)；

The amino acid sequences of the imidazole glycerol phosphate dehydratase and the histidinol phosphorylase in the escherichia coli are shown as the nucleotide sequences shown in SEQ ID NO. 1 for coding, and the amino acid sequences of the imidazole glycerol phosphate dehydratase of the corynebacterium glutamicum are shown as the nucleotide sequences shown in SEQ ID NO. 3 and SEQ ID NO. 6 for coding;

the amino acid sequence of the histidine aldehyde/histidine alcohol dehydrogenase in the escherichia coli is coded by the nucleotide sequence shown in SEQ ID NO. 2, and the amino acid sequence of the histidine aldehyde/histidine alcohol dehydrogenase in the corynebacterium glutamicum is coded by the nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 8.

2. The method of claim 1, wherein the L-lysine production strain has an increased L-lysine production of at least 8% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

3. The method of claim 2, wherein the L-lysine production strain has an increased L-lysine production of at least 15% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

4. The method of claim 3, wherein the L-lysine production strain has an increased L-lysine production of at least 20% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

5. The method of claim 4, wherein the L-lysine production strain has an increased L-lysine production of at least 25% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

6. The method of claim 5, wherein the L-lysine production strain has an increased L-lysine production of at least 30% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

7. The method of claim 6, wherein the L-lysine production strain has an increased L-lysine production of at least 35% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

8. An L-lysine producing strain, wherein the strain is genetically engineered to be attenuated or inactivated intracellularly by one or more of imidazole glycerol phosphate dehydratase, histidinol phosphorylase, and histidinol/histidinol dehydrogenase; the strain is escherichia coli or corynebacterium glutamicum;

9. The L-lysine-producing strain of claim 8, wherein the L-lysine production yield of the L-lysine high producing strain is increased by at least 8% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

10. The L-lysine-producing strain of claim 9, wherein the L-lysine production yield of the L-lysine high producing strain is increased by at least 15% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

11. The L-lysine-producing strain of claim 10, wherein the L-lysine production yield of the L-lysine high producing strain is increased by at least 20% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

12. The L-lysine-producing strain of claim 11, wherein said L-lysine high producing strain has an increase in L-lysine production of at least 25% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

13. The L-lysine-producing strain of claim 12, wherein the L-lysine production yield of the L-lysine high producing strain is increased by at least 30% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

14. The L-lysine-producing strain of claim 13, wherein said L-lysine high producing strain has an increase in L-lysine production of at least 35% compared to endogenous imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase.

15. An expression vector comprising the nucleotide encoding one or more of the intracellular attenuated or inactivated imidazole glycerol phosphate dehydratase, histidinol phosphorylase, histidinol/histidinol dehydrogenase of claim 1.

16. A method for producing L-lysine, comprising:

1) culturing the L-lysine-producing strain of any one of claims 8 to 14 to produce L-lysine; and

2) optionally isolating L-lysine from the culture broth obtained in step 1).

17. Use of the L-lysine-producing strain constructed by the construction method according to any one of claims 1 to 7, the L-lysine-producing strain according to any one of claims 8 to 14, or the vector according to claim 15 for producing L-lysine.