CN111575392A - DNA fragment, primer and detection method for identifying Brucella S2/019 strain and other strains - Google Patents
DNA fragment, primer and detection method for identifying Brucella S2/019 strain and other strains Download PDFInfo
- Publication number
- CN111575392A CN111575392A CN202010403489.2A CN202010403489A CN111575392A CN 111575392 A CN111575392 A CN 111575392A CN 202010403489 A CN202010403489 A CN 202010403489A CN 111575392 A CN111575392 A CN 111575392A
- Authority
- CN
- China
- Prior art keywords
- brucella
- strains
- strain
- sample
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000589562 Brucella Species 0.000 title claims abstract description 85
- 238000001514 detection method Methods 0.000 title claims abstract description 31
- 239000012634 fragment Substances 0.000 title claims abstract description 17
- 238000006243 chemical reaction Methods 0.000 claims abstract description 19
- 241001465754 Metazoa Species 0.000 claims abstract description 11
- 206010006500 Brucellosis Diseases 0.000 claims abstract description 5
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 4
- 238000001962 electrophoresis Methods 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 239000008280 blood Substances 0.000 claims description 6
- 210000004369 blood Anatomy 0.000 claims description 6
- 239000011543 agarose gel Substances 0.000 claims description 4
- 238000000137 annealing Methods 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 4
- 230000036425 denaturation Effects 0.000 claims description 4
- 238000012257 pre-denaturation Methods 0.000 claims description 4
- 239000002773 nucleotide Substances 0.000 claims description 3
- 125000003729 nucleotide group Chemical group 0.000 claims description 3
- 239000000443 aerosol Substances 0.000 claims description 2
- 239000012295 chemical reaction liquid Substances 0.000 claims description 2
- 239000008267 milk Substances 0.000 claims description 2
- 210000004080 milk Anatomy 0.000 claims description 2
- 235000013336 milk Nutrition 0.000 claims description 2
- 229960005486 vaccine Drugs 0.000 description 15
- 238000003752 polymerase chain reaction Methods 0.000 description 12
- 206010000210 abortion Diseases 0.000 description 5
- 231100000176 abortion Toxicity 0.000 description 5
- 238000000034 method Methods 0.000 description 5
- 229920000742 Cotton Polymers 0.000 description 3
- 241001494479 Pecora Species 0.000 description 3
- 230000028327 secretion Effects 0.000 description 3
- 230000009385 viral infection Effects 0.000 description 3
- 241000894006 Bacteria Species 0.000 description 2
- 241000700605 Viruses Species 0.000 description 2
- 238000007598 dipping method Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 230000008030 elimination Effects 0.000 description 2
- 238000003379 elimination reaction Methods 0.000 description 2
- 230000036039 immunity Effects 0.000 description 2
- 230000003053 immunization Effects 0.000 description 2
- 238000002649 immunization Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 208000031295 Animal disease Diseases 0.000 description 1
- 241000283690 Bos taurus Species 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000010170 biological method Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000005202 decontamination Methods 0.000 description 1
- 230000003588 decontaminative effect Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000003748 differential diagnosis Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 231100000419 toxicity Toxicity 0.000 description 1
- 230000001988 toxicity Effects 0.000 description 1
- 230000001018 virulence Effects 0.000 description 1
- 206010048282 zoonosis Diseases 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific DNA fragment for identifying Brucella S2/019 strains and other Brucella strains, three primers are designed based on the specific fragment and upstream and downstream sequences thereof, and if two bands of 145bp and 251bp are amplified in a PCR reaction taking a genome of a sample to be detected as a template, the detected sample contains Brucella S2 or 019 strains; if a 276bp band is amplified, the detection sample contains brucella except S2 and 019; if three bands of 145bp, 251bp and 276bp are amplified, the detection sample contains Brucella S2/019 strain and other Brucella; if the above condition does not occur, the test sample does not contain the brucella, and the tested animal does not have the brucella infection.
Description
Technical Field
The invention relates to the technical field of pathogen detection, in particular to a specific DNA fragment for identifying Brucella S2/019 strains and other Brucella strains, a set of specific primers and a corresponding PCR detection method thereof.
Background
Brucellosis is a zoonosis caused by brucella, widely distributed around the world, and not only affects the healthy development of animal husbandry, but also harms human health. The incidence of disease has been on the rise year by year in recent years.
The main strategy for preventing and controlling the animal diseases in China is quarantine and purification. The vaccine strains used in China are mainly an A19 vaccine strain and an S2 vaccine strain, and a sheep seed M5-90 vaccine strain has been used before, and is not used for the moment due to the problem of virulence. The S2 vaccine strain has lower toxicity than A19 and Rev.1, can produce excellent immunity to pig, ox and sheep, and has the outstanding advantages of no abortion caused by oral administration of the vaccine to pregnant dam and being used frequently in immunity of ox and sheep. However, it interferes with the wild virus infection of Brucella in antibody diagnosis, and cannot perform antibody differential diagnosis on naturally infected and vaccine-immunized animals, so that the wild virus-infected animals cannot be identified by using an antibody detection method in an immune farm.
To implement the control procedures of brucellosis quarantine, culling and decontamination, they must be identified from the aspect of etiology. A plurality of detection methods for detecting Brucella exist, but the methods generally have the problems of complex operation, time consumption and high cost, and are inconvenient for quick detection to guide clinic. Meanwhile, the detection methods often cannot distinguish the brucella S2 vaccine strain from other strains, so that the wrong result of eliminating the animal carrying the S2 vaccine as a wild virus infected animal occurs, and serious economic loss is caused.
Disclosure of Invention
By utilizing a molecular biological method, specific primers are designed according to different base sequences between genomes of the S2 vaccine strain and other Brucella strains, and the identification and detection of the Brucella S2 strain and other Brucella strains are realized by methods such as PCR (polymerase chain reaction), so that technical support is provided for better prevention and control measures of Brucella disease immunization, detection and elimination.
The invention is realized by the following technical scheme:
a specific DNA fragment for identifying Brucella S2/019 strains and other Brucella strains, wherein the nucleotide sequence of the specific DNA fragment is represented by SEQ ID No. 1: TCCCTCATAAATGGCTTTCTTCATA are provided.
The invention also provides application of the specific DNA fragment for identifying the Brucella S2/019 strain and other Brucella strains, and the specific DNA fragment is used for detecting and distinguishing the Brucella S2/019 and other Brucella strains.
A set of PCR primers for identifying Brucella S2/019 strains and other Brucella strains comprises upstream primers SEQIDNo.2, SEQIDNo.3 and downstream primers SEQIDNo.4 which are respectively named as BF, S2/019F and BR,
forward primer BF: 5'-ATGCTTGGCGATCTCGGC-3', respectively;
forward primer S2/019F: 5'-TCCAAGGTCGGCTACGAACAGC-3', respectively;
a reverse primer BR: 5'-CTCCTTATTAGCGGACGCTCCC-3'
The invention also provides a PCR detection method for identifying the Brucella S2/019 strain and other Brucella strains, which comprises the following operation steps:
(1) extracting a genome of a sample to be detected;
(2) adding the extracted sample genome serving as a template into a reaction tube of a reaction system containing reaction liquid and polymerase to perform PCR amplification;
(3) taking 5ul of amplified product, adding the product into a sample adding hole of 2% agarose gel for electrophoresis detection, observing under an ultraviolet lamp, and if two bands of 145bp and 251bp are amplified, indicating that the detection sample contains brucella S2 or 019 strain; if a 276bp band is amplified, the detection sample contains brucella except S2 and 019; if three bands of 145bp, 251bp and 276bp are amplified, the detection sample contains Brucella S2/019 strain and other Brucella; if the above condition does not occur, the test sample does not contain the brucella, and the tested animal does not have the brucella infection.
Specifically, in the step (1), the sample to be tested includes any one of a blood sample, a milk sample, a tissue sample, and an aerosol sample.
Specifically, in the step (2), the reaction system specifically comprises the following components:
specifically, in the step (2), the specific conditions of the PCR amplification reaction are:
pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and reaction completion after 30 cycles of operation.
According to the technical scheme, the beneficial effects of the invention are as follows:
1) the primer pair has higher specificity, can effectively distinguish the Brucella S2/019 strain, other Brucella strains and other bacteria through amplification-electrophoresis detection, and has extremely high accuracy;
2) when the brucella wild virus infection is detected and purified in a culture farm immunized by the brucella S2 vaccine, the clinical sample can be detected by using the method, the sample infected with the brucella S2 vaccine strain is eliminated, and the economic loss caused by elimination due to misunderstanding as wild virus infection is avoided;
3) in a culture farm immunized by the Brucella S2 vaccine, the method is matched, and other Brucella can be detected and eliminated after immunization, so that the Brucella can be better prevented and controlled.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
Example 1
A specific DNA fragment for identifying Brucella S2/019 strains and other Brucella strains, wherein the nucleotide sequence of the specific DNA fragment is SEQ ID No. 1: TCCCTCATAAATGGCTTTCTTCATA, see sequence listing, which is obtained by online BLAST, which, when selecting fragments, is deleted in Brucella S2 and 019 strains, and is ubiquitous in other Brucella strains.
The present example provides the use of specific DNA fragments for identifying brucella S2/019 and other brucella strains for detecting and differentiating brucella S2/019 and other brucella strains.
A set of PCR primers for identifying Brucella S2/019 strains and other Brucella strains comprises upstream primers SEQID No.2 and SEQ ID No.3 and downstream primers SEQ ID No.4 which are respectively named as BF, S2/019F and BR,
forward primer BF: 5'-ATGCTTGGCGATCTCGGC-3', respectively;
forward primer S2/019F: 5'-TCCAAGGTCGGCTACGAACAGC-3', respectively;
a reverse primer BR: 5'-CTCCTTATTAGCGGACGCTCCC-3'
The primer pair has higher specificity, can effectively distinguish the Brucella S2/019 strain, other Brucella strains and other bacteria through amplification-electrophoresis detection, and has extremely high accuracy.
Example 2
A PCR detection method for identifying Brucella S2/019 strains and other Brucella strains comprises the following operation steps:
(1) dipping the abortion secretion of the animal immunized with the Brucella S2 vaccine in a cotton swab, and putting the cotton swab into TRIzol to extract the genome of the abortion secretion;
(2) collecting 1ul of the extracted abortion secretionA20 ul reaction system was prepared using the genome as a template, wherein 10. mu.l of 2 × AceTaq Master Mix (Dye Plus), 1. mu.l of 20. mu.M forward primer BF, 1. mu.l of 20. mu.M reverse primer S2/019F, 1. mu.l of 20. mu.M reverse primer BR, and ddH2O6 mul, putting the thin-wall PCR tube containing the reaction system into a PCR instrument, performing pre-denaturation at 94 ℃ for 3min, performing denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extending at 72 ℃ for 30s, and finishing the reaction after running for 30 cycles;
(3) and adding a product of 5ul PCR amplification reaction into a 2% agarose gel sample adding hole for electrophoresis detection, taking DL2000 DNA Marker as a molecular weight standard, observing under an ultraviolet lamp after electrophoresis, and showing that two bands of 145bp and 251bp appear, thereby indicating that the abortion secretion contains the Brucella S2 strain and detecting the infection of the animal by the Brucella vaccine.
Example 3
A PCR detection method for identifying Brucella S2/019 strains and other Brucella strains comprises the following operation steps:
(1) dipping the blood of the cattle immunized with the Brucella S2 vaccine with a cotton swab, and extracting a genome in the blood;
(2) 1ul of the extracted genome of blood was used as a template to prepare 20ul of a reaction system, including 10. mu.l of 2 × Ace TaqMaster Mix (Dye Plus), 10. mu.l of 20. mu.M forward primer BF 1. mu.l, 20. mu.M reverse primer S2/019F 1. mu.l, 20. mu.M reverse primer BR 1. mu.l, ddH2O6 mul, putting the thin-wall PCR tube containing the reaction system into a PCR instrument, performing pre-denaturation at 94 ℃ for 3min, performing denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extending at 72 ℃ for 30s, and finishing the reaction after running for 30 cycles;
(3) taking 5ul of products of the PCR amplification reaction, adding the products into a 2% agarose gel sample adding hole for electrophoresis detection, simultaneously using DL2000 DNA Marker as a molecular weight standard, observing under an ultraviolet lamp after electrophoresis, and showing that a band with the size of 276bp appears, which indicates that the detected blood sample contains brucella except S2 and 019 strains, and detecting that the animal is infected by brucella wild virus.
The embodiments described above are some, but not all embodiments of the invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Claims (7)
1. A specific DNA fragment for identifying Brucella S2/019 strains and other Brucella strains is characterized in that the nucleotide sequence of the specific DNA fragment is SEQ ID No. 1: TCCCTCATAAATGGCTTTCTTCATA are provided.
2. The application of the specific DNA fragment for identifying the Brucella S2/019 strain and other Brucella strains is characterized in that the specific DNA fragment is used for detecting and distinguishing the Brucella S2/019 strain and other Brucella strains.
3. A set of PCR primers for identifying Brucella S2/019 strains and other Brucella strains comprises upstream primers SEQID No.2, SEQ ID No.3 and downstream primers SEQ ID No.4 which are respectively named as BF, S2/019F and BR,
forward primer BF: 5'-ATGCTTGGCGATCTCGGC-3', respectively;
forward primer S2/019F: 5'-TCCAAGGTCGGCTACGAACAGC-3', respectively;
a reverse primer BR: 5'-CTCCTTATTAGCGGACGCTCCC-3' are provided.
4. A PCR detection method for identifying Brucella S2/019 strains and other Brucella strains is characterized by comprising the following operation steps:
(1) extracting a genome of a sample to be detected;
(2) adding the extracted sample genome serving as a template into a reaction tube of a reaction system containing reaction liquid and polymerase to perform PCR amplification;
(3) taking 5ul of amplified product, adding the product into a sample adding hole of 2% agarose gel for electrophoresis detection, observing under an ultraviolet lamp, and if two bands of 145bp and 251bp are amplified, indicating that the detection sample contains brucella S2 or 019 strain; if a 276bp band is amplified, the detection sample contains brucella except S2 and 019; if three bands of 145bp, 251bp and 276bp are amplified, the detection sample contains Brucella S2/019 strain and other Brucella; if the above condition does not occur, the test sample does not contain the brucella, and the tested animal does not have the brucella infection.
5. The detection method for identifying the Brucella S2/019 strain and other Brucella strains according to claim 4, wherein in the step (1), the sample to be detected comprises any one of blood, milk sample, tissue sample and aerosol sample.
6. The detection method for identifying the Brucella S2/019 strain and other Brucella strains according to claim 4, wherein in the step (2), the reaction system specifically comprises the following components:
7. the PCR primer and the detection method for identifying the Brucella S2/019 strain and other Brucella strain according to claim 1, wherein in the step (2), the specific conditions of PCR amplification reaction are as follows: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and reaction completion after 30 cycles of operation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010403489.2A CN111575392A (en) | 2020-05-13 | 2020-05-13 | DNA fragment, primer and detection method for identifying Brucella S2/019 strain and other strains |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010403489.2A CN111575392A (en) | 2020-05-13 | 2020-05-13 | DNA fragment, primer and detection method for identifying Brucella S2/019 strain and other strains |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111575392A true CN111575392A (en) | 2020-08-25 |
Family
ID=72119021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010403489.2A Pending CN111575392A (en) | 2020-05-13 | 2020-05-13 | DNA fragment, primer and detection method for identifying Brucella S2/019 strain and other strains |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111575392A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111793704A (en) * | 2020-09-10 | 2020-10-20 | 中国疾病预防控制中心传染病预防控制所 | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862405A (en) * | 2015-06-01 | 2015-08-26 | 何洪彬 | Primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid |
| CN105002173A (en) * | 2015-08-07 | 2015-10-28 | 山东省农业科学院奶牛研究中心 | Kit for identifying Brucella S2 vaccine strain and wild strain |
| CN105018489A (en) * | 2015-08-07 | 2015-11-04 | 山东省农业科学院奶牛研究中心 | Kit for recognizing Brucella wild strain and vaccine strains A19 and S2 |
-
2020
- 2020-05-13 CN CN202010403489.2A patent/CN111575392A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862405A (en) * | 2015-06-01 | 2015-08-26 | 何洪彬 | Primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid |
| CN105002173A (en) * | 2015-08-07 | 2015-10-28 | 山东省农业科学院奶牛研究中心 | Kit for identifying Brucella S2 vaccine strain and wild strain |
| CN105018489A (en) * | 2015-08-07 | 2015-11-04 | 山东省农业科学院奶牛研究中心 | Kit for recognizing Brucella wild strain and vaccine strains A19 and S2 |
Non-Patent Citations (1)
| Title |
|---|
| WENLONG NAN ET AL: "Duplex PCR for differentiation of the vaccine strain Brucella suis S2 and B. suis biovar 1 from other strains of Brucella spp" * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111793704A (en) * | 2020-09-10 | 2020-10-20 | 中国疾病预防控制中心传染病预防控制所 | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof |
| CN111793704B (en) * | 2020-09-10 | 2021-01-05 | 中国疾病预防控制中心传染病预防控制所 | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018489B (en) | Differentiate brucella street strain and vaccine strain A19 and S2 kit | |
| CN111394489A (en) | DNA fragment, primer and detection method for identifying Brucella A19/S19 strain and other strains | |
| CN105002173A (en) | Kit for identifying Brucella S2 vaccine strain and wild strain | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
| CN107365843B (en) | LAMP primer combination for detecting two main parasites causing calf diarrhea and application thereof | |
| CN114058719B (en) | Primer pair and kit for identifying brucella and application of primer pair and kit | |
| WO2010062897A1 (en) | Methods and compositions to detect clostridium difficile | |
| CN114790490A (en) | Molecular marker capable of distinguishing Brucella melitensis and detection method | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| Abraham et al. | Rapid detection of poliovirus by reverse transcription and polymerase chain amplification: application for differentiation between poliovirus and nonpoliovirus enteroviruses | |
| CN111575392A (en) | DNA fragment, primer and detection method for identifying Brucella S2/019 strain and other strains | |
| CN107287351A (en) | Method for detecting Koi herpesvirus by combining loop-mediated isothermal amplification with lateral flow test strip | |
| CN113337643A (en) | RT-LAMP primer group and kit for detecting bluetongue virus, animal epidemic hemorrhagic disease virus and paliyama virus | |
| CN112831610A (en) | Primer, amplification reaction liquid, kit and detection method for canine parainfluenza LAMP detection | |
| EP0255825B1 (en) | Detection and differentiation of coxiella burnetii in biological fluids | |
| CN104232789A (en) | RT-PCR (reverse transcription-polymerase chain reaction) technique capable of simultaneously identifying porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN110195120A (en) | Duplex PCR primer sets and kit a kind of while that detect MS-H vaccine strain and versatility | |
| EP3115466A1 (en) | Listeria monocytogenes clonogrouping and assessment of infectivity | |
| CN116004925A (en) | Triple fluorescence PCR primer probe group, reagent and method for identifying wild strain and gene deletion strain of African swine fever virus | |
| CN109762910A (en) | It is a kind of for detecting the primer and kit of amphitypy echinococcosis simultaneously | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| CN116377092A (en) | Single-tube nested qPCR reagent for detecting Brucella | |
| Famuyide et al. | Molecular Detection and Identification of Piroplasms in Semi-Intensively Managed Cattle from Abeokuta, Nigeria | |
| CN114214320A (en) | Probe primer composition for detecting porcine reproductive and respiratory syndrome virus, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200825 |
|
| RJ01 | Rejection of invention patent application after publication |