CN111575388B - Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit - Google Patents

Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit Download PDF

Info

Publication number
CN111575388B
CN111575388B CN202010490098.9A CN202010490098A CN111575388B CN 111575388 B CN111575388 B CN 111575388B CN 202010490098 A CN202010490098 A CN 202010490098A CN 111575388 B CN111575388 B CN 111575388B
Authority
CN
China
Prior art keywords
pfhmgb1
gene
pelteobagrus fulvidraco
level
algal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010490098.9A
Other languages
Chinese (zh)
Other versions
CN111575388A (en
Inventor
王赟
柯飞
肖晓雪
岳靖凯
谢朝晖
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jianghan University
Original Assignee
Jianghan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jianghan University filed Critical Jianghan University
Priority to CN202010490098.9A priority Critical patent/CN111575388B/en
Publication of CN111575388A publication Critical patent/CN111575388A/en
Application granted granted Critical
Publication of CN111575388B publication Critical patent/CN111575388B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/142—Toxicological screening, e.g. expression profiles which identify toxicity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/42—Poisoning, e.g. from bites or stings
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/70—Mechanisms involved in disease identification
    • G01N2800/709—Toxin induced

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an application of a PfHMGB1 gene of pelteobagrus fulvidraco as a molecular marker of algal toxin invasion, wherein the amino acid sequence of the PfHMGB1 gene is shown as SEQ ID NO. 2, and the nucleic acid sequence of the PfHMGB1 gene is shown as SEQ ID NO. 1; the detection kit comprises a reagent for detecting the PfHMGB1 gene expression level of the pelteobagrus fulvidraco. The research of the invention shows that the mRNA level and the protein level of the PfHMGB1 gene in the liver of the pelteobagrus fulvidraco injured by the algae toxin are both obviously increased, and the protein level of the PfHMGB1 gene in the peripheral blood of the pelteobagrus fulvidraco is obviously increased. Therefore, the expression level of the PfHMGB1 gene can be used as one of auxiliary means, and other diagnostic standards are combined to judge whether the pelteobagrus fulvidraco is damaged by the algal toxins.

Description

Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit
Technical Field
The invention relates to the field of water ecology, in particular to application of a PfHMGB1 gene of pelteobagrus fulvidraco as a molecular marker for algal toxin invasion, and further relates to a detection kit for detecting whether the pelteobagrus fulvidraco is invaded by algal toxin.
Background
Blue algae bloom is one of the most important fresh water ecological problems at present, and the microcystis is a common blue algae bloom. Microcystins (MC) are generated after the Microcystins are cracked in water, so that fresh water resources are polluted, and the water safety of residents, industry and agriculture and the development of agriculture, animal husbandry and fishery are seriously influenced. MC is a class of cyclic heptapeptide hepatotoxins with the structure cyclo (-D-Ala-X-D-MeAsp-Z-Adda-D-Glu-Mdha), where X and Z are variable amino acids. Over 100 isomers have been found, of which MC-LR has the strongest acute and chronic toxicity and the greatest harm.
Prolonged exposure to or consumption of MC-LR contaminated water can cause damage to various target organs such as liver, kidneys, heart, reproductive organs, respiratory and circulatory systems, etc. in humans, livestock and wildlife. Fisheries are most susceptible to microcystins because of their direct correlation with water ecology.
The pelteobagrus fulvidraco belongs to the class of fin-fish, catfish, family of bagrus and genus of pelteobagrus, and is one of the current major economic fish species due to high yield, tender meat quality, delicious taste, less bones and much fat. Like the culture of other freshwater fishes, the culture of the pelteobagrus fulvidraco is also easily influenced by the toxins of the microcystis.
At present, no report exists on molecular indexes for diagnosing the yellow catfish being damaged by algal toxins.
Disclosure of Invention
In order to solve the problems, the pathogenic mechanism of the algae toxin MC-LR in the pelteobagrus fulvidraco body is deeply researched, and the mRNA level and the protein level of the HMGB1 (High mobility group pBox 1) gene show obvious difference in some organs or tissues compared with healthy pelteobagrus fulvidraco after the pelteobagrus fulvidraco is attacked by the algae toxin.
Based on the research, the invention provides the application of the PfHMGB1 gene of the pelteobagrus fulvidraco as a molecular marker for algal toxin invasion.
In a specific embodiment, the amino acid sequence of the PfHMGB1 gene is shown as SEQ ID NO. 2.
In a specific embodiment, the nucleic acid sequence of the PfHMGB1 gene is shown as SEQ ID NO 1.
In a specific embodiment, the algal toxin is a microcystin.
In a specific embodiment, the algal toxin is MC-LR.
The invention also provides a detection kit for detecting whether the pelteobagrus fulvidraco is damaged by algal toxins, which comprises a reagent for detecting the expression level of the PfHMGB1 gene of the pelteobagrus fulvidraco.
In a specific embodiment, the reagent for detecting the expression level of the PfHMGB1 gene of the pelteobagrus fulvidraco is an mRNA level detection reagent of the PfHMGB1 gene.
In a specific embodiment, the reagent for detecting the expression level of the PfHMGB1 gene of the pelteobagrus fulvidraco is a protein level detection reagent of the PfHMGB1 gene.
The research of the invention shows that the mRNA level and the protein level of the PfHMGB1 gene in the liver of the pelteobagrus fulvidraco injured by the algae toxin are both obviously increased, and the protein level of the PfHMGB1 gene in the peripheral blood of the pelteobagrus fulvidraco is obviously increased. Therefore, the expression level of the PfHMGB1 gene can be used as one of auxiliary means, and other diagnostic standards are combined to judge whether the pelteobagrus fulvidraco is damaged by the algal toxins.
Drawings
FIG. 1 is a statistical chart of the relative level of PfHMGB1 gene mRNA in the 11 middle tissues of healthy pelteobagrus fulvidraco, leveled by taking 18S rRNA as a housekeeping gene;
fig. 2 is a statistical graph of the relative levels of PfHMGB1 gene mRNA in the liver of pelteobagrus fulvidraco injected with 200 μ L PBS or PBS containing MC-LR, P <0.05, P <0.01, and leveled with 18S rRNA as a housekeeping gene;
FIG. 3 is a photograph of SDS-PAGE electrophoresis of rPfHMGB1 protein expressed by Escherichia coli after purification and desalting;
FIG. 4 is an immunoblot photograph of detecting the level of PfHMGB1 protein in the liver of Pelteobagrus fulvidraco injected with PBS, MC-LR or MC-LR + anti-PfHMGB 1 antibody using anti-PfHMGB 1 antibody, leveled with beta-actin as an internal standard;
FIG. 5 is an immunoblot photograph of the use of anti-PfHMGB 1 antibodies to detect the level of PfHMGB1 protein in the peripheral blood of Pelteobagrus fulvidraco injected with PBS, MC-LR or MC-LR + anti-PfHMGB 1 antibodies, leveled by using total protein as an internal standard.
Detailed Description
The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.
1. Domestication of pelteobagrus fulvidraco
Catching pelteobagrus fulvidraco juvenile fish with the weight of about 25g from the flat-topped flat west lake, and domesticating the pelteobagrus fulvidraco juvenile fish in a laboratory for at least 10 days. Culturing Pelteobagrus fulvidraco in a 300L aerated aquarium, maintaining the ambient temperature of 28 deg.C, and feeding once a day. The water in the aquarium was changed in half every 12 hours.
2. cloning and analysis of cDNA
Sequencing the Pelteobagrus fulvidraco kidney cDNA library constructed by the experiment to obtain a 5' end cDNA sequence of the PfHMGB1 gene. The 3 'terminal sequence was obtained by 3' -RACE. The nucleic acid sequence of the obtained pelteobagrus fulvidraco PfHMGB1 gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2.
3. Expression profiles of PfHMGB1 genes in different tissues
Healthy pseudobagrus fulvidraco was anesthetized with tricaine mesylate to harvest tissue, 11 tissues including body kidney, intestine, blood, spleen, muscle, skin, liver, head kidney, fin, gill and heart were harvested. Total RNA was extracted using Trizol, reverse-transcribed into cDNA using PrimeScript RT kit, and then the expression of PfHMGB1 was detected using 18S rRNA as an internal standard with the primers shown in Table 1. TABLE 1 primers used for qPCR reactions
Primer and method for producing the same Sequence of Serial number
qHMGB1-F ggattgtctattggtgatgtggcta SEQ ID NO:3
qHMGB1-R atcatctgctttgtctggtttggt SEQ ID NO:4
q18S-F ggacacggaaaggattgacaga SEQ ID NO:5
q18S-R gttcgctatcggaattaaccaga SEQ ID NO:6
SYBR Premix Ex-Taq was added to the reaction system, and PCR was performed on an ECO real-time PCR system (Illumina, USA) with relative fold calculated as 2- Δ CT.
The qPCR result is shown in figure 1, and in healthy pelteobagrus fulvidraco, the expression level of the PfHMGB1 gene in heart, muscle and liver is high.
4. PfHMGB1 gene mRNA level in pelteobagrus fulvidraco liver before and after MC-LR stimulation
200 mu L of PBS solution containing MC-LR (50 mu g/kg) is injected into the pelteobagrus fulvidraco in an abdominal cavity, the liver is collected after 24h, total RNA is extracted for quantitatively detecting the expression quantity of the PfHMGB1 gene, and the pelteobagrus fulvidraco injected with the PBS solution is used as a reference. The result is shown in fig. 2, the expression level of the PfHMGB1 gene of the pelteobagrus fulvidraco injected with MC-LR in the liver is about 2 times that of the pelteobagrus fulvidraco injected with PBS, and the expression level is significant.
5. Protein expression purification and polyclonal antibody preparation
The ORF of the PfHMGB1 gene amplified by using a primer pair HMGB1-ex-F/R (SEQ ID NOS: 7 and 8) is connected to pMD18-T, and is inserted into a pET-28a vector after being correctly sequenced to obtain a PfHMGB1 expression plasmid, and the expression plasmid is transferred into E.coli BL21 (DE 3). The transformant was cultured in LB medium at 37 ℃ to OD 600 =0.4, and then PfHMGB1 protein (rPfHMGB 1) was expressed under induction with 0.4mM IPTG at 28 ℃. Total protein was extracted, purified using a nickel column and desalted by dialysis against PBS. Slowly mixing the desalted protein with high-performance endotoxin affinity chromatography resin FF to remove endotoxin, and detecting with limulus reagent to confirm that the protein contains no endotoxin. Finally, quantification was performed using the Bradford protein assay kit. The SDS-PAGE electrophorogram after purification and desalting is shown in FIG. 3, and the band is in the vicinity of 25kDa and accords with the predicted rPfHMGB1 size.
To prepare polyclonal antibodies, 100. Mu.L of rPfHMGB1 protein (1. Mu.g/. Mu.L) was mixed in equal volumes with Freund's complete adjuvant, and then 5 BALA/c female mice were injected subcutaneously. 4 boosters were then performed, each booster injection of 100. Mu.L of rPfHMGB1 protein (1. Mu.g/. Mu.l) mixed in equal volume with Freund's incomplete adjuvant once a week. After 10 days of the last immunization, mouse sera were collected and stored frozen at-80 ℃.
6. PfHMGB1 protein level in liver and peripheral blood of pelteobagrus fulvidraco before and after MC-LR stimulation
Collecting fish liver, adding into high efficiency RIPA lysate containing protease inhibitor PMSF, and pulping into homogenate. The amount of total protein was determined using the BCA kit. The levels of PfHMGB1 protein were then detected by Western blotting using PfHMGB1 antibodies. Beta-actin was used as an internal standard and was detected using murine anti-beta-actin antibody and goat anti-mouse IgG.
Meanwhile, pfHMGB1 protein in peripheral blood plasma was also detected. Plasma was diluted 10-fold with PBS for electrophoresis. Since β -actin could not be detected in the diluted plasma, we used the BCA kit to quantify the total protein amount of plasma and verified by SDS-PAGE. PfHMGB1 protein levels were then detected by Western blotting.
As a result, as shown in fig. 4 and 5, when MC-LR stimulation was used, the PfHMGB1 protein level was significantly increased in both liver and peripheral blood, and if an anti-PfHMGB 1 antibody was contained in the MC-LR solution used, the PfHMGB1 protein level was significantly decreased in liver and peripheral blood, and thus it was found that the prepared antibody could neutralize the PfHMGB1 protein in vivo.
The experiments show that after MC-LR stimulation, the mRNA level and the protein level of the PfHMGB1 gene in the liver of the pelteobagrus fulvidraco are obviously increased, and the protein level of the PfHMGB1 gene in the peripheral blood of the pelteobagrus fulvidraco is obviously increased, so that the PfHMGB1 gene can be used as a molecular marker for judging whether the pelteobagrus fulvidraco is damaged by algal toxins such as MC-LR.
It should be noted that although the specific method is used in the examples herein to detect the mRNA and protein levels of the PfHMGB1 gene, those skilled in the art may substitute other methods after reviewing the disclosure herein, as long as the mRNA or protein level of the PfHMGB1 gene in the sample can be detected. Thus, the methods, primers, antibodies used in the specific examples herein are for illustrative purposes only and are not intended to be limiting.
The present invention is not limited to the above-described preferred embodiments, but rather, the present invention is intended to cover all modifications, equivalents, improvements, and equivalents included within the spirit and scope of the present invention.
Sequence listing
<110> university of Jianghan
Application of <120> PfHMGB1 as molecular marker for algal toxin invasion and detection kit
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 203
<212> PRT
<213> Pelteobagrus fulvidraco (Pelteobagrus fulvidraco)
<400> 1
Met Gly Lys Asp Pro Thr Lys Pro Arg Gly Lys Met Ser Ser Tyr Ala
1 5 10 15
Tyr Phe Val Gln Thr Cys Arg Glu Glu His Lys Lys Lys His Pro Asp
20 25 30
Thr Ser Val Asn Phe Ser Glu Phe Ser Lys Lys Cys Ser Glu Arg Trp
35 40 45
Lys Thr Met Ser Ala Lys Glu Lys Gly Lys Phe Glu Asp Met Ala Arg
50 55 60
Leu Asp Lys Ala Arg Tyr Glu Arg Glu Met Lys Asn Tyr Val Pro Pro
65 70 75 80
Arg Gly Glu Lys Lys Lys Arg Phe Lys Asp Pro Asn Ala Pro Lys Arg
85 90 95
Pro Pro Ser Ala Phe Phe Ile Phe Cys Ala Glu Tyr Arg Pro Lys Val
100 105 110
Lys Glu Glu Thr Pro Gly Leu Ser Ile Gly Asp Val Ala Lys Lys Leu
115 120 125
Gly Glu Met Trp Asn Lys Thr Ser Ala Glu Glu Lys Gln Pro Tyr Glu
130 135 140
Lys Lys Ala Ala Lys Leu Lys Glu Lys Tyr Glu Lys Asp Ile Ala Ala
145 150 155 160
Tyr Arg Lys Gly Lys Val Val Gly Gly Ala Ala Lys Ala Pro Thr Lys
165 170 175
Pro Asp Lys Ala Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp
180 185 190
Asp Asp Asp Asp Asp Glu Asp Asp Asp Asp Glu
195 200
<210> 2
<211> 612
<212> DNA
<213> Pelteobagrus fulvidraco (Pelteobagrus fulvidraco)
<400> 2
atggggaaag acccaacaaa gccaaggggc aaaatgtcct cttatgccta ttttgtccag 60
acctgcagag aggaacataa gaagaaacat cctgacacat cagtcaattt ctcagaattc 120
tctaaaaagt gctctgagcg gtggaagact atgtccgcta aggaaaaggg caagtttgaa 180
gacatggcca gacttgataa ggcccgttat gaacgggaga tgaagaacta tgtacctccc 240
agaggtgaaa agaagaagag gtttaaggac cccaatgctc ctaagagacc cccgtcagcc 300
tttttcattt tttgtgcgga atatcggccc aaggtgaaag aggagacccc aggattgtct 360
attggtgatg tggctaagaa gcttggggaa atgtggaaca agacctctgc tgaagagaag 420
cagccttatg agaagaaggc agccaagctg aaggagaaat atgagaagga cattgcagca 480
tatcgaaagg gaaaagttgt cgggggtgct gcgaaagccc ccaccaaacc agacaaagca 540
gatgatgatg atgacgacga tgacgatgat gacgacgacg atgacgatga tgaagatgac 600
gatgatgagt aa 612
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggattgtcta ttggtgatgt ggcta 25
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atcatctgct ttgtctggtt tggt 24
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggacacggaa aggattgaca ga 22
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gttcgctatc ggaattaacc aga 23

Claims (7)

1. The application of the PfHMGB1 gene of pelteobagrus fulvidraco in preparing an algal toxin invasion molecular marker, wherein the nucleic acid sequence of the PfHMGB1 gene is shown as SEQ ID NO:2, and the algal toxin is microcystin;
when the mRNA level and the protein level of the PfHMGB1 gene in the liver of the pelteobagrus fulvidraco are both obviously increased, or the protein level of the PfHMGB1 gene in the peripheral blood of the pelteobagrus fulvidraco is obviously increased, the pelteobagrus fulvidraco is damaged by algal toxins.
2. The use according to claim 1, wherein the amino acid sequence encoded by the PfHMGB1 gene is shown in SEQ ID NO 1.
3. The use of claim 1, wherein the algal toxin is MC-LR.
4. A detection kit for detecting whether pelteobagrus fulvidraco is invaded by algal toxins is characterized by comprising a reagent for detecting the expression level of a PfHMGB1 gene of pelteobagrus fulvidraco, wherein the nucleic acid sequence of the PfHMGB1 gene is shown as SEQ ID NO:2, and the algal toxins are microcystins.
5. The detection kit according to claim 4, wherein the amino acid sequence encoded by the PfHMGB1 gene is shown in SEQ ID NO 1.
6. The detection kit according to claim 4, characterized in that the reagent for detecting the expression level of PfHMGB1 gene of Pelteobagrus fulvidraco is an mRNA level detection reagent of PfHMGB1 gene.
7. The detection kit according to claim 4, wherein the reagent for detecting the expression level of the PfHMGB1 gene of the pelteobagrus fulvidraco is a protein level detection reagent of the PfHMGB1 gene.
CN202010490098.9A 2020-06-02 2020-06-02 Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit Active CN111575388B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010490098.9A CN111575388B (en) 2020-06-02 2020-06-02 Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010490098.9A CN111575388B (en) 2020-06-02 2020-06-02 Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit

Publications (2)

Publication Number Publication Date
CN111575388A CN111575388A (en) 2020-08-25
CN111575388B true CN111575388B (en) 2022-10-21

Family

ID=72118044

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010490098.9A Active CN111575388B (en) 2020-06-02 2020-06-02 Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit

Country Status (1)

Country Link
CN (1) CN111575388B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101775403A (en) * 2010-02-02 2010-07-14 暨南大学 Overall length cDNA sequence of micro-capsule algae toxins degrading enzyme MlrA, coded amino acid and application
CN105399808A (en) * 2015-11-23 2016-03-16 青岛农业大学 Sebastes schlegeli immunological enhancing protein (HNGB1) gene as well as coded protein and application
CN108135848A (en) * 2015-06-30 2018-06-08 纳米提克斯有限责任公司 Composition relevant with eliminating particle and method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101775403A (en) * 2010-02-02 2010-07-14 暨南大学 Overall length cDNA sequence of micro-capsule algae toxins degrading enzyme MlrA, coded amino acid and application
CN108135848A (en) * 2015-06-30 2018-06-08 纳米提克斯有限责任公司 Composition relevant with eliminating particle and method
CN105399808A (en) * 2015-11-23 2016-03-16 青岛农业大学 Sebastes schlegeli immunological enhancing protein (HNGB1) gene as well as coded protein and application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Chronic hyperosmotic stress interferes with immune homeostasis in striped catfish (Pangasianodon hypophthalmus, S.) and leads to excessive inflammatory response during bacterial infection;Melodie Schmitz et al.;《Fish & Shellfish Immunology》;20160624;550-558 *
XP_026995128.1;NCBI;《GenBank》;20181126;全文 *
高迁移率族蛋白1(HMGB1)的研究进展;陈德旺;《农技服务》;20161231;4-8 *
黄颡鱼饲料中添加谷胱甘肽降低藻毒素毒性作用的研究;董桂芳 等;《水生生物学报》;20100731;第34卷(第4期);722-730 *

Also Published As

Publication number Publication date
CN111575388A (en) 2020-08-25

Similar Documents

Publication Publication Date Title
Li et al. Molecular cloning, genomic organization and functional analysis of an anti-lipopolysaccharide factor from Chinese mitten crab Eriocheir sinensis
Liu et al. Molecular cloning and expression analysis of the liver-expressed antimicrobial peptide 2 (LEAP-2) gene in grass carp
Mu et al. A novel type III crustin (CrusEs2) identified from Chinese mitten crab Eriocheir sinensis
CN109576275B (en) Cynoglossus semilaevis antibacterial disease related gene and application method thereof
Xu et al. Characterization and expression analysis of bactericidal permeability-increasing protein (BPI) antimicrobial peptide gene from channel catfish Ictalurus punctatus
Chen et al. Functional analysis of an orange-spotted grouper (Epinephelus coioides) interferon gene and characterisation of its expression in response to nodavirus infection
Kong et al. Two novel secreted ferritins involved in immune defense of Chinese mitten crab Eriocheir sinensis
Zhu et al. Identification and molecular characterization of a novel anti-lipopolysaccharide factor (ALF) from red swamp crayfish, Procambarus clarkii
Wang et al. Molecular cloning, characterization and immunological response analysis of Toll-like receptor 21 (TLR21) gene in grass carp, Ctenopharyngodon idella
Xie et al. Identification and functional characterization of the goldfish (Carassius auratus L.) high mobility group box 1 (HMGB1) chromatin-binding protein
Barnes et al. Two hepcidin-like antimicrobial peptides in Barramundi Lates calcarifer exhibit differing tissue tropism and are induced in response to lipopolysaccharide
Liu et al. cDNA cloning and expression analysis of a hepcidin gene from yellow catfish Pelteobagrus fulvidraco (Siluriformes: Bagridae)
Bao et al. The interaction of TAK1 and TAB1 enhances LPS-induced cytokine release via modulating NF-κB activation (Larimichthys crocea)
Lin et al. Molecular cloning and expression studies of the adapter molecule myeloid differentiation factor 88 (MyD88) in turbot (Scophthalmus maximus)
Gao et al. Structurally diverse genes encode TLR13 in Nile tilapia: The two receptors can recognize Streptococcus 23S RNA and conduct signal transduction through MyD88
Liao et al. Molecular cloning and expression analysis of interleukin-1β and interleukin-1 receptor type I genes in yellow catfish (Pelteobagrus fulvidraco): Responses to challenge of Edwardsiella ictaluri
Li et al. Cloning and expression analysis of a Toll-like receptor 21 (TLR21) gene from turbot, Scophthalmus maximus
Cheng et al. Molecular cloning, characterization and expression analysis of a miiuy croaker (Miichthys miiuy) CXC chemokine gene resembling the CXCL9/CXCL10/CXCL11
CN111575388B (en) Application of PfHMGB1 as molecular marker of algal toxin invasion and detection kit
Xia et al. Molecular cloning and expression analysis of immunoglobulin M heavy chain gene of blunt snout bream (Megalobrama amblycephala)
CN110734486A (en) Cynoglossus semilaevis agglutinin family collectins disease-resistant gene
Kim et al. Molecular characterization and expression pattern of c-type and g-type lysozyme isoforms in starry flounder Platichthys stellate infected with Streptococcus parauberis
CN107602686B (en) Polypeptide with resistance to gram-positive bacteria
CN107557366B (en) Epinephelus coioides natural immune receptor TLR13 gene, eukaryotic expression vector and application thereof
Fu et al. Identification and functional analysis of the perforin-1 like gene in disease resistance in half smooth tongue sole (Cynoglossus semilaevis)

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant