CN111549154A - Liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application - Google Patents
Liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application Download PDFInfo
- Publication number
- CN111549154A CN111549154A CN202010401875.8A CN202010401875A CN111549154A CN 111549154 A CN111549154 A CN 111549154A CN 202010401875 A CN202010401875 A CN 202010401875A CN 111549154 A CN111549154 A CN 111549154A
- Authority
- CN
- China
- Prior art keywords
- serotype
- vibrio parahaemolyticus
- gene
- parahaemolyticus
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a specific oligonucleotide sequence for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus, and an oligonucleotide probe connected to magnetic microspheres marked with different fluorescent dyes, wherein the oligonucleotide comprises: from 6 serotypes of Vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyIn genes, and of K60wzxA DNA fragment selected from each of the genes. The invention combines the Bio-Plex 200 suspension chip system of the Bio-Rad company to establish a suspension chip detection system and a detection method for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus, and fills the defect that the common pathogenic K antigen serotypes of vibrio parahaemolyticus are detected by using a molecular biological methodThe technical blank for detecting the serotype of the disease K antigen is of great significance to the clinical identification and epidemiological monitoring of the important pathogenic bacteria.
Description
Technical Field
The invention belongs to the technical field of bacteria detection methods, and relates to a liquid chip for serum type detection of 7 common pathogenic K antigens of vibrio parahaemolyticus and application thereof.
Background
Vibrio parahaemolyticus is a halophilic gram-negative bacillus, is often isolated in offshore and estuary regions of the ocean, and is also a parasitic bacterium of various shellfish organisms. Since the 50's of the last century, large-scale food poisoning incidents in Japan were caused and isolated, food poisoning incidents caused by Vibrio parahaemolyticus worldwide were rare. In coastal areas such as Guangdong, Shanghai, Zhejiang and the like in China, vibrio parahaemolyticus can be separated all the year round and sporadic food poisoning events caused by the vibrio parahaemolyticus occur. Therefore, the method has important significance for the rapid detection and tracing of the vibrio parahaemolyticus in the field of food safety.
Currently, in national food safety standards (GB 4789.7-2013) adopted in China, the test of vibrio parahaemolyticus is in the aspects of bacterial culture and biochemical test, the qualitative identification needs about 8-18 hours, and the quantitative identification needs about 4-5 days. In the industry standard of the national entry-exit inspection and quarantine just issued in 2019, a real-time fluorescent quantitative PCR method is adopted for detecting the vibrio parahaemolyticus in the aquatic animal body, and the whole process can be completed within 24 hours. The detection method can only detect the vibrio parahaemolyticus to the level of the species, and has low detection flux, thus being difficult to meet the requirements of strain epidemic traceability and rapid detection.
The serological detection method has the characteristics of simple and convenient operation and intuitive result interpretation, is widely applied since the last 30 century, is considered to have the best specificity and sensitivity, and can effectively distinguish strains with different pathogenicity in one species/genus. At present, most important pathogenic bacteria establish a serological typing system based on surface polysaccharide antigen, and the typing system is widely applied to inspection and quarantine and disease prevention control systems. In the national food safety standard (GB 4789.7-2013) adopted in China, serology is also used as an item for detecting the vibrio parahaemolyticus. However, although the conventional serological identification method is widely used, there are still many defects. The method mainly comprises the following steps: 1) the work of establishing a serology typing system is complex and long in period; 2) the production and quality control of antiserum are difficult; 3) many antisera are produced and stored internationally in only a few units, and the antisera used for identification are severely incomplete; 4) the experimental procedure for serological identification takes a long time (2-6 days).
The establishment of high-flux molecular discrimination technology corresponding to the traditional serological method can not only greatly improve the speed, accuracy and flux of bacterial serotype identification, but also effectively integrate and coordinate various epidemiological data based on the traditional serological identification and molecular biological identification, and can enable data communication among laboratories using different bacterial identification technologies, thereby being beneficial to the establishment of a multi-level infectious disease prevention and control system. The liquid phase chip is a new technology combining chip technology and flow cytometry. Attaching DNA, antibody and the like on the surface of a microsphere as a probe, combining with an object to be detected in a liquid phase, adding a fluorescence-labeled reporter molecule, and detecting the fluorescence-labeled object on the surface of the microsphere by means of a flow cytometer. Besides the characteristics of high flux, high specificity, high sensitivity and the like, compared with the traditional solid phase chip, the chip also has the characteristics of rapid signal collection and processing, simple and convenient operation, relatively low cost and the like. In recent years, with the gradual maturity of liquid-phase chip technology, the liquid-phase chip technology is gradually used in scientific research and a plurality of molecular biology diagnosis laboratories and is gradually commercialized, showing a good application prospect.
The bacterial surface polysaccharide antigen mainly comprises O polysaccharide (O antigen), Common Antigen (CA), exopolysaccharide antigen, spore, capsular polysaccharide (K antigen) and the like. Among them, the structural diversity of O polysaccharide (O antigen) and capsular polysaccharide (K antigen) is the basis of serotype typing of bacteria. The diversity of O antigen and/or K antigen within the same bacterium is determined by the genetic diversity of the genes encoding the various enzymes that synthesize O antigen and/or K antigen. These genes are often located in clusters at fixed sites on the genome, and are referred to as O antigen gene clusters and/or K antigen gene clusters. Vibrio parahaemolyticus is classified into 71K antigen serotypes according to the diversity of K antigens, and 7 serotypes K6, K8, K25, K41, K56, K60 and K68 are reported to be frequently isolated from pathogenic strains and related to the pathogenicity of the bacteria. The K antigen gene clusters of the serotypes are all positioned ingmhDAndrjgbetween two housekeeping genes, and the gene cluster information has been decipheredThe molecular serological detection of the 7 pathogenic serotypes of vibrio parahaemolyticus becomes possible by adopting a molecular biological method and taking the specific gene in the K antigen synthetic gene cluster as a target.
Disclosure of Invention
The invention provides specific oligonucleotide sequences for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus on the basis of analyzing 7 common pathogenic K antigen serotype gene clusters and respective specific genes of the two, and establishes a set of suspension chip detection system and a detection method for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus by combining a Bio-Plex 200 suspension chip system of a Bio-Rad company, fills the blank of a molecular serological typing technology of the vibrio parahaemolyticus, and has important significance for clinical identification and epidemiological monitoring of the vibrio parahaemolyticus.
In order to achieve the purpose, the invention discloses the following technical contents:
a liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus, characterized in that the oligonucleotides are 6 serotypes selected from vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyIn genes, and of K60wzxA DNA fragment selected from each of the genes.
The oligonucleotide DNA fragment has the nucleotide sequence shown in SEQ ID NO 1-7 as follows:
SEQ ID (5'-3')
NO 1 AGCATATTAGAACTTGCA for detecting K6 serotype of vibrio parahaemolyticus
NO 2 TTCCGACTTGTTATACAGCATC for detecting K8 serotype of vibrio parahaemolyticus
NO 3 GGGGTTCTCCTTATTTAGCGA for detecting K25 serotype of vibrio parahaemolyticus
NO. 4 GAGGTCTATCTAACTCAATT for detecting K41 serotype of vibrio parahaemolyticus
NO 5 TTTTGGCGTTCCGTTTCAC for detecting K56 serotype of vibrio parahaemolyticus
NO 6 TGACGCAGGTTCATACAA for detecting K60 serotype of vibrio parahaemolyticus
NO 7 CTACTTCAATGGGTGGGA for detecting K68 serotype of vibrio parahaemolyticus
The invention further discloses application of the oligonucleotide probe connected to the magnetic microspheres marked with different fluorescent dyes in preparation of a suspension chip for detecting at least one serotype of 7K antigen serotypes of vibrio parahaemolyticus. The test result shows that the suspension chip can complete the test of at least one serotype in 7 common pathogenic K antigen serotypes of the vibrio parahaemolyticus.
The invention further discloses a preparation method of the liquid-phase chip suspension chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus, which mainly comprises the following steps:
(1) among 6 serotypes of Vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyInternal to the gene, and of K60wzxDesigning and preparing DNA primers for multiplex PCR in the gene, wherein each serotype primer comprises 1 pair of upstream and downstream primers, and the downstream primer is marked by a biotin group;
(2) among 6 serotypes of Vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyInternal to the gene, and of K60wzxDesigning and preparing DNA probes in the gene, wherein the position of each serotype probe on the gene is positioned between the corresponding upstream primer and the corresponding downstream primer, 15 thymine nucleotides (dT) are added into the 5' end of each DNA probe to serve as a connecting arm, and an amino group is added into the tail end of the connecting arm to modify so as to couple the DNA probes with the magnetic microspheres with hydroxyl groups;
(3) coupling the specific probe in the step (2) with oligonucleotide probe microspheres on different fluorescent dye magnetic microspheres;
(4) preparing genome DNA of a sample to be detected, and performing multiplex PCR amplification by using the primer prepared in the step (1);
(5) hybridizing and dyeing the amplification product obtained in the step (4) and the probe of the coupled microsphere obtained in the step (3);
(6) the stained hybridization product obtained in step (5) was detected using a Bio-Plex 200 suspension chip system.
Wherein, the primer in the step (1) comprises nucleotide sequences shown in SEQ ID NO. 8-21, and each sequence (5'-3') and the corresponding function thereof are as follows:
p1 (SEQ ID NO: 8) TTGGTTTGATCGGACTTT amplified V.parahaemolyticus K6 serotypewzyUpstream primer of gene
P2 (SEQ ID NO: 9) AGGGCTTACTCCTTCACC amplified V.parahaemolyticus K6 serotypewzyDownstream primer of gene
P3 (SEQ ID NO: 10) AATCTAGCACTTAATCGAAAGC amplified serotype K8 of Vibrio parahaemolyticuswzyUpstream primer of gene
P4 (SEQ ID NO: 11) TCCGACACTGCACCCATA amplified V.parahaemolyticus K8 serotypewzyDownstream primer of gene
P5 (SEQ ID NO: 12) ACCATTGTTATTAGGGAC amplified V.parahaemolyticus K25 serotypewzyUpstream primer of gene
P6 (SEQ ID NO: 13) TTACATAAAACCACCACC amplified serotype K25 of Vibrio parahaemolyticuswzyDownstream primer of gene
P7 (SEQ ID NO: 14) ACCAGTATTTGAACCATT amplified V.parahaemolyticus K41 serotypewzyUpstream primer of gene
P8 (SEQ ID NO: 15) ACGGAAGAGCTAATGACT amplified V.parahaemolyticus K41 serotypewzyDownstream primer of gene
P9 (SEQ ID NO: 16) GCTGCTCTGTTTCTCATG amplified V.parahaemolyticus K56 serotypewzyUpstream primer of gene
P10 (SEQ ID NO: 17) TCCTCAACTTTGCCTTCT amplified serotype K56 of Vibrio parahaemolyticuswzyDownstream primer of gene
P11 (SEQ ID NO: 18) TGACGCAGGTTCATACAA amplified V.parahaemolyticus K60 serotypewzxUpstream primer of gene
P12 (SEQ ID NO: 19) TACCCTTCAGGAAATAGG amplified V.parahaemolyticus K60 serotypewzxDownstream primer of gene
P13 (SEQ ID NO: 20) AATAATCCTTTGGCTAGTTT amplified V.parahaemolyticus K68 serotypewzyUpstream primer of gene
P14 (SEQ ID NO: 21) CCCGATGCATATAGGACAGA amplified serotype K68 of Vibrio parahaemolyticuswzyDownstream primer of gene
The liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and the application thereof disclosed by the invention have the positive effects that:
(1) the invention discloses a technical means for serological molecular typing of important food-borne pathogenic bacteria, namely vibrio parahaemolyticus for the first time, fills in the technical blank of serotype typing of pseudomonas aeruginosa by using a molecular biological means, and can be used for clinical identification and epidemiological monitoring of 7 common pathogenic K serotype strains of vibrio parahaemolyticus.
(2) The liquid phase chip detection system can complete the detection of clinical samples within 24 hours, can simultaneously detect 7 pathogenicity related K serotype vibrio parahaemolyticus, and has the advantages of short detection time and high detection flux.
(3) The liquid phase chip detection system can realize at least 101Accurate detection of individual bacteria, and high detection sensitivity.
Drawings
FIG. 1 is a bar chart showing the results of detection of K antigen serotypes of Vibrio parahaemolyticus 7 by the liquid phase chip of the present invention.
Detailed Description
The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention. The raw materials and reagents used in the present invention are commercially available.
Vibrio parahaemolyticus sources for specific detection
Example 1
Design and preparation of 7K antigen serum type specific primers of vibrio parahaemolyticus
(1) Selecting 6 serotypes of vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyGene, and of K60wzxThe gene is a target gene sequence.
(2) The selected target gene sequences aiming at different serotypes of vibrio parahaemolyticus are led into primer design software PrimerPrimier 5.0, and parameters are set. Wherein, the output modes of the sense strand and the complementary strand are selected; the sequence amplification length is 150-350 bp; haripin: none; dimer: none: false Priming: none; cross Dimer: none. The program was run to obtain 1 pair of specific primer sequences for each serotype for the sense and antisense strands.
(3) The designed primer sequence is sent to Saimer Feishale science and technology (China) Co., Ltd for DNA synthesis, and purified by PAGE for later use. The synthesis of antisense strand primer requires the 5' end of DNA sequence to be connected with biotin group for labeling.
Example 2
Design and preparation of serotype specific probe for pseudomonas aeruginosa
(1) Selecting 6 serotypes of vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyGene, and of K60wzxThe gene is a target gene sequence. .
(2) And introducing the selected target gene sequences aiming at each serotype of the pseudomonas aeruginosa into Primer design software Primer 5.0, and setting parameters. Wherein only the sense chain output mode is selected; haripin: none; dimer: none: false Priming: none; cross Dimer: no, the position of the sequence is within the position of the sense and antisense strand primers in example 1. The procedure was run to obtain 1 specific probe for each serotype.
(3) Sending the designed probe sequence to Saimer Feishale science and technology (China) Co., Ltd for DNA synthesis, connecting 12 carbon atoms as connecting arms at the 5' end of the sequence, connecting 1 amino group at the last 1 carbon atom end, and purifying by PAGE for later use.
Example 3
Coupling of specific probe and microsphere (operation in dark place)
(1) Suspending the microspheres for 30 s at the highest rotation speed on a vortex instrument, checking the numbers of the microspheres and the probes, and marking.
(2) Take 80. mu.l of microspheres in a 1.5mL centrifuge tube at 12000 rpm, and centrifuge for 2 minutes.
(3) Discarding the supernatant, resuspending with 10 microliters of 2- (N-morpholine) ethanesulfonic acid solution (MES) (pH 4.5) with the concentration of 0.1 mol/L, and thoroughly vortexing to disperse the microspheres;
(4) add 2. mu.l of probe (previously placed at room temperature) and 6. mu.l of freshly prepared 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride solution (EDC) at 10 mg/mL, mix and incubate in the dark at room temperature for 30 minutes (mix with shaking every 15 min).
(5) 6 microliters of freshly prepared 10 mg/mL EDC solution was added and mixed, and incubated in the dark at room temperature for 30 minutes.
(6) Adding 1ml Tween 20 solution (TWEEN-20) with concentration of 0.02%, mixing, rotating at 12000 r/min, and centrifuging for 2 min.
(7) The supernatant was discarded, 1ml of 0.1% sodium dodecyl sulfate solution (SDS) was added, and the pellet was resuspended for 40 seconds at 12000 rpm and centrifuged for 2 minutes.
(8) The supernatant was discarded, 25. mu.l of Tris-EDTA buffer (pH 8.0) was added, the pellet was resuspended, vortexed at high speed for 30 seconds, and stored at 4 ℃ in the dark until use.
Example 4
Establishment of Vibrio parahaemolyticus PCR System
(1) First, a bacterial genomic DNA extraction kit (product No. DP 302) from Tiangen Biochemical technology (Beijing) Ltd was used to extract bacterial genomic DNA according to the procedure.
(2) Taking 0.5 microliter of the genome DNA extracting solution as a template, and adding the template into the PCR reaction mixed solution. The composition of the PCR reaction mixture is shown in Table 1.
TABLE 1 PCR reaction mixture composition
(3) The reaction mixture was placed in a PCR instrument (Biometra), the cycling parameters were set and run. The cycle parameters were as follows:
example 5
Hybridization of multiplex PCR products with Probe-microsphere coupling products
(1) And (3) uniformly mixing all prepared probe-microsphere coupling products by vortex at the maximum rotation speed, mixing each probe-microsphere coupling product by 2 microliters, diluting the mixture by 250 times by using 1.5 times of TMAC hybridization buffer solution, and uniformly mixing the diluted mixture by oscillation.
(2) Taking 33 microliters of the probe-microsphere mixed solution, adding 17 microliters of PCR product to form a hybridization reaction system of 50 microliters in total. The blank was replaced by 17. mu.l of Tris-EDTA buffer (pH8.0).
(3) And (3) placing the hybridization reaction system in a PCR instrument, setting reaction parameters and operating. The reaction parameters were as follows:
example 6
Washing and staining of the hybridization product
(1) The hybridization products in the PCR tubes were transferred to 96-well plates at 12000 rpm, centrifuged for 1 min, washed 2 times with 70. mu.l of 1 XTMAC buffer, 12000 rpm after each wash, and centrifuged for 1 min.
(2) Streptavidin-PE fluorescein was diluted 250-fold with 1 XTAC buffer, and 80. mu.l of diluted fluorescein solution was added to each well.
(3) The 96-well plate was placed in a hybridization oven at 55 ℃ at 500 rpm and reacted for 30 minutes with shaking.
Example 7
On-machine detection of hybridization products (using Bio-Plex 200 suspension chip System)
(1) And turning on the power supply of the instrument and the power supply connected with the computer, clicking a Bio-Plex Manager button on the desktop of the computer, and entering a software interface.
(2) Adding ddH2O and 70% isopropanol solution into an MCV plate matched with the instrument, placing the MCV plate in a machine, clicking a Start up button of a software interface, and then clicking a Warm up button according to interface prompts to preheat for 30 minutes generally.
(3) After the completion of the preheating, calibration liquids with numbers CAL1 and CAL2 were added to the MCV plate, and the calibration of the apparatus was performed by clicking the calibration button. The CAL1 and CAL2 calibration solutions were returned to room temperature and vortexed for more than 30 seconds before addition.
(4) And after the correction is finished, clicking a New button of the toolbar, opening a method editing Protocol window, and filling the microsphere number and the corresponding probe number according to the prompt. After the edition is finished, clicking a Format Plate button, and sequentially setting detection positions of a detection background (B) and a sample (X) to be detected according to the sample adding sequence of a 96-pore Plate. The MCV plate in the instrument is taken out, a 96-well plate containing the sample is added, and a run Protocol button is clicked to start detection.
(5) After the program is finished, storing the data into an Excel table according to the prompt of a software interface for subsequent analysis.
And clicking the Shut down button of the toolbar to operate according to the screen prompt, and after the prompt is finished, closing the Bio-Plex Manager program of the computer, and then closing the machine power supply and the computer power supply. The detection result shows that: the liquid phase chip of the invention can realize the detection of at least one serotype in 7 V.parahaemolyticus K antigen serotypes.
Example 8
Detection of 7K antigen serotypes of vibrio parahaemolyticus in mock sample
(1) Oysters were purchased from the market, washed with sterile water, ground thoroughly into chips using a rotary blade homogenizer, divided into 2.5 g/part, and dissolved in 22.5ml of saline (sodium chloride content 3%).
(2) The 7K antigen serotypes of Vibrio parahaemolyticus cultured at 37 degrees overnight were diluted in 10-fold steps of 100. mu.l each (containing 10. mu.l each)4，103，102，101And 100Bacteria) are respectively added into the samples prepared in the step (1), 3ml of the mixture is sucked and added into 27ml of culture medium (the content of peptone is 1 percent; sodium chloride content 6%), shake-cultured at 37 ℃ for 6 hours.
(3) The overnight culture samples in 1ml of (2) were aspirated, subjected to boiling water bath for 10 minutes, and centrifuged at 8000 rpm for 5 minutes to obtain a crude DNA extract for each sample.
(4) 3 microliters of the crude DNA extract was taken as a template, and the detection was performed according to the procedures of examples 4-7, so that the specific Vibrio parahaemolyticus K antigen serum type in each sample could be accurately detected, and the detection sensitivity before enrichment could reach 101And (4) bacteria.
Therefore, the liquid phase chip for detecting 7K antigen serotypes of vibrio parahaemolyticus provided by the invention can accurately realize the detection of specific serotype vibrio parahaemolyticus in a simulated sample, and the detection sensitivity can reach 101And (4) bacteria.
SEQUENCE LISTING
<110> liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application
<120> southern university
<160>21
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213> Artificial sequence
<400>1
agcatattag aacttgca 18
<210>2
<211>22
<212>DNA
<213> Artificial sequence
<400>2
ttccgacttg ttatacagca tc 22
<210>3
<211>21
<212>DNA
<213> Artificial sequence
<400>3
ggggttctcc ttatttagcg a 21
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>4
gaggtctatc taactcaatt 20
<210>5
<211>19
<212>DNA
<213> Artificial sequence
<400>5
ttttggcgtt ccgtttcac 19
<210>6
<211>18
<212>DNA
<213> Artificial sequence
<400>6
tgacgcaggt tcatacaa 18
<210>7
<211>18
<212>DNA
<213> Artificial sequence
<400>7
ctacttcaat gggtggga 18
<210>8
<211>18
<212>DNA
<213> Artificial sequence
<400>8
ttggtttgat cggacttt 18
<210>9
<211>18
<212>DNA
<213> Artificial sequence
<400>9
agggcttact ccttcacc 18
<210>10
<211>22
<212>DNA
<213> Artificial sequence
<400>10
aatctagcac ttaatcgaaa gc 22
<210>11
<211>18
<212>DNA
<213> Artificial sequence
<400>11
tccgacactg cacccata 18
<210>12
<211>18
<212>DNA
<213> Artificial sequence
<400>12
accattgtta ttagggac 18
<210>13
<211>18
<212>DNA
<213> Artificial sequence
<400>13
ttacataaaa ccaccacc 18
<210>14
<211>18
<212>DNA
<213> Artificial sequence
<400>14
accagtattt gaaccatt 18
<210>15
<211>18
<212>DNA
<213> Artificial sequence
<400>15
acggaagagc taatgact 18
<210>16
<211>18
<212>DNA
<213> Artificial sequence
<400>16
gctgctctgt ttctcatg 18
<210>17
<211>18
<212>DNA
<213> Artificial sequence
<400>17
tcctcaactt tgccttct 18
<210>18
<211>18
<212>DNA
<213> Artificial sequence
<400>18
tgacgcaggt tcatacaa 18
<210>19
<211>18
<212>DNA
<213> Artificial sequence
<400>19
tacccttcag gaaatagg 18
<210>20
<211>20
<212>DNA
<213> Artificial sequence
<400>20
aataatcctt tggctagttt 20
<210>21
<211>20
<212>DNA
<213> Artificial sequence
<400>21
cccgatgcat ataggacaga 20
Claims (3)
1. A liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus, characterized in that the oligonucleotides are 6 serotypes selected from vibrio parahaemolyticus K6, K8, K25, K41, K56 and K68wzyIn genes, and of K60wzxA DNA fragment selected from each of the genes;
the oligonucleotide DNA fragment has the nucleotide sequence shown in SEQ ID NO 1-7 as follows:
SEQ ID (5'-3')
NO. 1 AGCATATTAGAACTTGCA for detecting serotype K6 of Vibrio parahaemolyticus;
NO. 2 TTCCGACTTGTTATACAGCATC for detecting serotype K8 of Vibrio parahaemolyticus;
3 GGGGTTCTCCTTATTTAGCGA for detecting serotype K25 of vibrio parahaemolyticus;
4 GAGGTCTATCTAACTCAATT for detecting serotype K41 of Vibrio parahaemolyticus;
NO. 5 TTTTGGCGTTCCGTTTCAC for detecting serotype K56 of Vibrio parahaemolyticus;
6 NO. 6 TGACGCAGGTTCATACAA for detecting serotype K60 of Vibrio parahaemolyticus;
NO. 7 CTACTTCAATGGGTGGGA was used to detect serotype K68 of Vibrio parahaemolyticus.
2. The method for preparing a liquid phase chip for detecting 7 common pathogenic K antigen serotypes of Vibrio parahaemolyticus according to claim 1, which is characterized by comprising the following steps:
(1) in serotypes K6, K8, K25, K41, K56 and K68 of Vibrio parahaemolyticuswzyIntragenic, and of serotype K60wzxInside the gene, DNA primers for multiplex PCR are designed and prepared, wherein each serotype primer comprises 1 pair of upstream primer and downstream primer, and the downstream primers are marked by biotin groups;
(2) in serotypes K6, K8, K25, K41, K56 and K68 of Vibrio parahaemolyticuswzyIntragenic, and K60 serotypewzxDesigning and preparing DNA probes in the gene, wherein the position of each serotype probe on the gene is positioned between the corresponding upstream primer and the corresponding downstream primer, 15 thymine nucleotides (dT) are added into the 5' end of each DNA probe to serve as a connecting arm, and an amino group is added into the tail end of the connecting arm to modify so as to couple the DNA probes with the magnetic microspheres with hydroxyl groups;
(3) coupling the specific probe in the step (2) with oligonucleotide probe microspheres on different fluorescent dye magnetic microspheres;
(4) preparing genome DNA of a sample to be detected, and performing multiplex PCR amplification by using the primer prepared in the step (1);
(5) hybridizing and dyeing the amplification product obtained in the step (4) and the probe of the coupled microsphere obtained in the step (3);
(6) detecting the dyed hybridization product obtained in the step (5) by utilizing a Bio-Plex 200 suspension chip system;
wherein, the primer in the step (1) comprises nucleotide sequences shown as SEQ ID NO: 8-21, and each sequence (5'-3') is as follows:
p1 (SEQ ID NO: 8) TTGGTTTGATCGGACTTT amplified V.parahaemolyticus K6 serotypewzyAn upstream primer of the gene;
p2 (SEQ ID NO: 9) AGGGCTTACTCCTTCACC amplified V.parahaemolyticus K6 serotypewzyDownstream primers for the gene;
p3 (SEQ ID NO: 10) AATCTAGCACTTAATCGAAAGC amplified serotype K8 of Vibrio parahaemolyticuswzyAn upstream primer of the gene;
p4 (SEQ ID NO: 11) TCCGACACTGCACCCATA amplified V.parahaemolyticus K8 serotypewzyDownstream primers for the gene;
p5 (SEQ ID NO: 12) ACCATTGTTATTAGGGAC amplified V.parahaemolyticus K25 serotypewzyAn upstream primer of the gene;
p6 (SEQ ID NO: 13) TTACATAAAACCACCACC amplified serotype K25 of Vibrio parahaemolyticuswzyDownstream primers for the gene;
p7 (SEQ ID NO: 14) ACCAGTATTTGAACCATT amplified V.parahaemolyticus K41 serotypewzyAn upstream primer of the gene;
p8 (SEQ ID NO: 15) ACGGAAGAGCTAATGACT amplified V.parahaemolyticus K41 serotypewzyDownstream primers for the gene;
p9 (SEQ ID NO: 16) GCTGCTCTGTTTCTCATG amplified V.parahaemolyticus K56 serotypewzyAn upstream primer of the gene;
p10 (SEQ ID NO: 17) TCCTCAACTTTGCCTTCT amplified serotype K56 of Vibrio parahaemolyticuswzyDownstream primers for the gene;
p11 (SEQ ID NO: 18) TGACGCAGGTTCATACAA amplified V.parahaemolyticus K60 serotypewzxAn upstream primer of the gene;
p12 (SEQ ID NO: 19) TACCCTTCAGGAAATAGG amplified V.parahaemolyticus K60 serotypewzxDownstream primers for the gene;
p13 (SEQ ID NO: 20) AATAATCCTTTGGCTAGTTT amplified V.parahaemolyticus K68 serotypewzyAn upstream primer of the gene;
p14 (SEQ ID NO: 21) CCCGATGCATATAGGACAGA amplified serotype K68 of Vibrio parahaemolyticuswzyDownstream primers for the gene.
3. The use of the liquid phase chip for detecting 7 common pathogenic K antigen serotypes of Vibrio parahaemolyticus according to claim 1 for preparing a chip for detecting at least one serotype of the 7 common pathogenic K antigen serotypes of Vibrio parahaemolyticus.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010401875.8A CN111549154A (en) | 2020-05-13 | 2020-05-13 | Liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application |
| PCT/CN2020/135550 WO2021227480A1 (en) | 2020-05-13 | 2020-12-11 | Liquidchip for detecting seven common pathogenic k antigen serotypes of vibrio parahaemolyticus, and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010401875.8A CN111549154A (en) | 2020-05-13 | 2020-05-13 | Liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111549154A true CN111549154A (en) | 2020-08-18 |
Family
ID=71998519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010401875.8A Pending CN111549154A (en) | 2020-05-13 | 2020-05-13 | Liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN111549154A (en) |
| WO (1) | WO2021227480A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021227480A1 (en) * | 2020-05-13 | 2021-11-18 | 南开大学 | Liquidchip for detecting seven common pathogenic k antigen serotypes of vibrio parahaemolyticus, and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154559A (en) * | 2015-09-21 | 2015-12-16 | 南开大学 | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof |
| CN106148502A (en) * | 2014-12-11 | 2016-11-23 | 中国科学院上海生命科学研究院 | A kind of high throughput method directly detecting food source pathogenic bacteria |
| CN110129237A (en) * | 2019-05-30 | 2019-08-16 | 浙江大学 | A kind of novel K serotype vibrio parahaemolytious and its application |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131760A (en) * | 2011-12-05 | 2013-06-05 | 中国人民解放军军事医学科学院卫生学环境医学研究所 | Suspension chip detection method capable of simultaneously detecting six treatment microbes |
| CN105177144A (en) * | 2015-09-21 | 2015-12-23 | 南开大学 | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof |
| CN105200153A (en) * | 2015-10-29 | 2015-12-30 | 广州市疾病预防控制中心 | Gene probe for simultaneously detecting five food-borne pathogenic bacteria through liquid chip and detection method |
| US11104964B2 (en) * | 2017-04-03 | 2021-08-31 | William Marsh Rice University | Universal microbial diagnostics using random DNA probes |
| CN111549154A (en) * | 2020-05-13 | 2020-08-18 | 南开大学 | Liquid phase chip for detecting 7 common pathogenic K antigen serotypes of vibrio parahaemolyticus and application |
-
2020
- 2020-05-13 CN CN202010401875.8A patent/CN111549154A/en active Pending
- 2020-12-11 WO PCT/CN2020/135550 patent/WO2021227480A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148502A (en) * | 2014-12-11 | 2016-11-23 | 中国科学院上海生命科学研究院 | A kind of high throughput method directly detecting food source pathogenic bacteria |
| CN105154559A (en) * | 2015-09-21 | 2015-12-16 | 南开大学 | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof |
| CN110129237A (en) * | 2019-05-30 | 2019-08-16 | 浙江大学 | A kind of novel K serotype vibrio parahaemolytious and its application |
Non-Patent Citations (1)
| Title |
|---|
| PANG YU等: "Developing a novel molecular serotyping system based on capsular polysaccharide synthesis gene clusters of Vibrio parahaemolyticus", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021227480A1 (en) * | 2020-05-13 | 2021-11-18 | 南开大学 | Liquidchip for detecting seven common pathogenic k antigen serotypes of vibrio parahaemolyticus, and application |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021227480A1 (en) | 2021-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN107586861B (en) | Suspension chip for detecting serotype enterobacter aerogenes typing and application | |
| CN109371148B (en) | Fluorescent PCR kit for identifying three porcine respiratory bacteria and quantitative detection method | |
| CN111394488A (en) | Liquid phase chip for detecting 19 serotypes of pseudomonas aeruginosa and application | |
| WO2021227480A1 (en) | Liquidchip for detecting seven common pathogenic k antigen serotypes of vibrio parahaemolyticus, and application | |
| CN101348831B (en) | Fluorescence quantitative PCR method for fast detecting Campylobacter jejuni macrolide drug resistant mutational site | |
| CN112210614A (en) | Real-time fluorescent quantitative LAMP (Loop-mediated isothermal amplification) primer group for detecting purple sisal leaf roll disease phytoplasma and application thereof | |
| CN102260738B (en) | Oligonucleotide gene chip and application of oligonucleotide gene chip to detection of various bacteria | |
| CN112481397B (en) | Liquid phase chip for detecting 4 main O antigen serotypes of yersinia enterocolitica and application | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN112575097B (en) | Liquid phase chip for detecting bacillus cereus and application | |
| CN109355408B (en) | Primer, kit and method for PSR (phosphosilicate receptor) detection of Escherichia coli type I Shiga toxin | |
| WO2015020671A1 (en) | Multiplex amplification reaction method for determination of campylobacter jejuni penner/capsule type | |
| CN112592986B (en) | Liquid phase chip for detecting stenotrophomonas maltophilia and application | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN106929573B (en) | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof | |
| CN112592985B (en) | Real-time fluorescence PCR detection method for bacillus cereus and application | |
| CN112375834B (en) | PCR detection method and application of 4 main O antigen serotypes of yersinia enterocolitica | |
| CN112301139B (en) | Specific target spot, primer and detection method for detecting escherichia coli O157: H7 and application | |
| CN105112506B (en) | A kind of gene liquid chip and its detection method to 10 kinds of K antigens genotypings of escherichia coli in sample | |
| CN114854886A (en) | Real-time fluorescence PCR detection method for Edwardsiella tarda and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20200818 |
|
| WD01 | Invention patent application deemed withdrawn after publication |