CN111549128A - Gene diagnosis method for thrombus and hemorrhagic disease - Google Patents
Gene diagnosis method for thrombus and hemorrhagic disease Download PDFInfo
- Publication number
- CN111549128A CN111549128A CN201910804284.2A CN201910804284A CN111549128A CN 111549128 A CN111549128 A CN 111549128A CN 201910804284 A CN201910804284 A CN 201910804284A CN 111549128 A CN111549128 A CN 111549128A
- Authority
- CN
- China
- Prior art keywords
- thrombus
- sequencing
- gene
- genes
- rate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene diagnosis method for thrombus and hemorrhagic diseases. All the currently known 156 related genes which directly or indirectly affect blood coagulation can be comprehensively and systematically analyzed at one time, and the pathogenic mutation can be found by focusing on the region which is closely related to the disease in the human genome. The gene screening method is used for screening the genes related to the blood coagulation factor system, the platelet system, the fibrinolysis system, the endothelial system, the inflammation system, the metabolic system and the anticoagulation system widely at one time, covering point mutation, insertion deletion of small fragments and large fragments, copy number change and the like of most gene variations. Compared with other current genome-wide sequencing technologies, the method is superior to genome-wide sequencing in the indexes of target region coverage, effective data quantity, capture efficiency, data utilization rate, average sequencing depth, repetition rate and the like related to thrombus, and can effectively improve the diagnosis rate of thrombotic diseases and hemorrhagic diseases.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a gene diagnosis method for thrombus and hemorrhagic diseases.
Background
Thrombosis and hemorrhagic diseases are a series of diseases which are easy to form thrombosis or hemorrhage due to the change of blood coagulation state caused by polygenic environmental factors. The hypercoagulable state of blood is liable to cause thrombotic diseases such as: deep vein thrombosis and pulmonary artery thromboembolism of lower limbs, coronary embolism and acute myocardial infarction of the department of cardiology, cerebral infarction and intracranial venous sinus thrombosis which are easy to occur after orthopedic and gynecological operations. In contrast, a low blood coagulation leads to bleeding tendencies, such as hemophilia a, von willebrand disease, and the like. Thrombosis and hemorrhage can affect all organ systems of the whole body, relate to various disciplines of clinical medicine, and seriously harm human health.
Although the research work on antithrombotic drugs has been advanced, when patients with thrombosis are hospitalized, thrombus is formed and causes vascular embolism, and the curative effect after the blockage of these organs is poor. In addition, the underlying cause of thrombosis is not clear in time, which often affects the correct prevention and treatment, resulting in the occurrence or recurrence of serious thrombotic events. Therefore, the diagnosis and treatment of thrombotic diseases focus on early diagnosis and gene diagnosis.
The genetic tendency of thrombus and hemorrhagic diseases is obvious, relates to gene abnormality of hundreds of blood vessels and coagulation factors, and at present, no method for carrying out systematic molecular diagnosis on hundreds of genes exists at home and abroad. At present, the most similar related technology only aims at one or a plurality (less than 20) of coagulation related gene mutations, and PCR primers are designed to amplify and sequence the promoter region and the exon region of the gene.
At present, the detection of a target region is realized by multiple PCR amplification and library building, and a patent of application No. 201710187401.6 discloses a kit and a method for detecting the whole exon of ADAMTS13 gene. The kit comprises 26 positive and reverse primers for amplifying and covering the full exon sequences of ADAMTS13 genes, wherein a section of M13-F primer sequence with the length of 18bp and a section of M13-R primer sequence with the length of 16bp are respectively added at the 5 'end of an upstream primer and the 5' end of a downstream primer amplified by PCR. Based on a Sanger sequencing method, 1 pair of universal primers M13 are used as sequencing primers to detect the mutation condition of the ADAMTS13 gene full-exon sequence, and the method is applied to gene diagnosis of patients with thrombotic and thrombocytopenic purpura. However, this method can only amplify more than 10-20 genes simultaneously, and is difficult to design primers, high in primer specificity, harsh in reaction conditions, unstable in detection, and difficult in detection of amplification bias, copy number variation, and insertion deletion variation.
The genetic heterogeneity of the bleeding disease is very large, the genetic abnormality of hundreds of blood vessels and bleeding factors is involved, and the thrombus and the bleeding disease belong to the unity of opposites, the bleeding tendency or the comprehensive effect of the thrombus tendency can be accurately and scientifically judged only by analyzing the complete bleeding gene of each individual, and the diagnosis of the bleeding disease by only detecting one or a plurality of genes is far from sufficient.
Thus, the prior art is far from meeting the requirements of medical research and clinical applications. Although whole genome sequencing and exon sequencing can search for pathogenic mutations from the genome range, the method can obtain tens of thousands of genetic variations of the genome at one time due to large data volume and high consumption of computing resources, wherein most of the variations belong to background variations without clinical significance, so that the difficulty is increased for data analysis, and the period is long and the cost is high. For example: the whole genome sequencing data is generally as high as 90Gb, the sequencing depth is 30, the exon sequencing data is generally 10Gb, and the sequencing depth is generally 50, so that the false positive rate is high.
Disclosure of Invention
Technical problem to be solved
The invention aims to provide a method for diagnosing genes of thrombus and hemorrhagic diseases, which aims to solve the problems of small quantity of gene mutation expansion genes, low diagnosis rate of etiological diagnosis, unstable detection, difficult detection, long period and high cost of the existing method for diagnosing the genes of the hemorrhagic diseases.
(II) technical scheme
In order to solve the problems of small quantity of gene mutation and expansion genes, low disease diagnosis rate, unstable detection, difficult detection, long period and high cost of the existing hemorrhagic disease gene diagnosis method, the invention provides the following technical scheme: a method for diagnosing thrombus and hemorrhagic disease genes comprises the following steps:
2, aiming at each coding sequence, designing a probe sequence with the length of 120bp from the first base according to the principle of reverse sequence complementation from 5 'to 3', and overlapping 60bp between every two adjacent probe sequences;
step 6, counting the size, the comparison rate, the repetition rate and the quality value of sequencing data, and calculating the sequencing depth of each position of the target area of the thrombus and the hemostatic gene related pathogenic gene; dividing the data volume of the target area by the total data volume according to the comparison to obtain a result of the capture efficiency; and respectively counting the number of bases with the sequencing depth of more than or equal to 1, more than or equal to 4, more than or equal to 10 and more than or equal to 20 according to the sequencing depth of each position in the target area, and dividing the number of bases by the total number of bases in the target area to obtain index information of 1 multiplied by coverage rate, 4 multiplied by coverage rate, 10 multiplied by coverage rate and 20 multiplied by coverage rate.
Preferably, the oligonucleotide mixture prepared in step 3 is prepared by performing large-scale synthesis of oligonucleotides on a chip by using an oligonucleotide in-situ synthesis technique, washing off the oligonucleotides on the chip with ammonia water, and dissolving the oligonucleotides in 100 microliters of ultrapure water to form the oligonucleotide mixture.
Preferably, the reaction system of step 4 is:
the reaction conditions were cycled for 20 cycles as follows: 95 ℃ for 1 minute, 95 ℃ for 15 seconds, 48 ℃ for 15 seconds, 72 ℃ for 5 minutes, 4 ℃ incubation.
Preferably, in the step 5, the probe library is subjected to on-machine sequencing by using an Illumina high-throughput sequencer Hiseq 4000.
Preferably, step 5 aligns the sequencing data to human reference genome HG19 using BWA MEM software.
Preferably, in the step 6, a samtools tool in samtools-1.9 software is adopted to count the size, the alignment rate, the repetition rate and the quality value of sequencing data; then, the sequencing depth of each position of the target area of the pathogenic genes related to the thrombus and the hemostatic genes is calculated by using a samtools in the software.
Preferably, 156 genes related to thrombus and hemorrhage are extracted in the step 1.
(III) advantageous effects
Compared with the prior art, the invention provides a method for diagnosing the gene of the thrombus and the hemorrhagic disease, which has the following beneficial effects: the invention can comprehensively and systematically analyze 156 related genes which are known to directly or indirectly influence blood coagulation at one time, and can focus on the regions which are closely related to diseases in the human genome to find out pathogenic mutations. Compared with other current genome-wide sequencing technologies, the method is superior to genome-wide sequencing in the indexes of target region coverage, effective data quantity, capture efficiency, data utilization rate, average sequencing depth, repetition rate and the like related to thrombus, and can effectively improve the diagnosis rate of thrombotic diseases and hemorrhagic diseases.
Drawings
FIG. 1 is a diagram showing all the coding sequences of 156 thrombus and hemorrhage genes according to the present invention;
FIG. 2 is a gene profile of a mutation according to an embodiment of the present invention;
FIG. 3 is a graph showing the distribution of dominant mutations in 10 kinds of patients in a definite molecular diagnosis in an example of application of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The method for diagnosing the genes of the thrombus and the hemorrhagic disease in the embodiment is to call all coding sequences of 156 thrombus and hemorrhagic genes according to a human reference genome HG19 by combining an Ensembl, CCDS, Gencode, VEGA, SNP and a CytoBand database as shown in figure 1.
For each coding sequence, a probe sequence with the length of 120bp is designed from the first base according to the principle of reverse sequence complementation from 5 'to 3', and 60bp of overlap exists between every two adjacent probe sequences.
TAGGTGTGTAGGCGC and GTCAGCTAGTACGCA sequences were added to the 5 'and 3' ends of each probe sequence, respectively, to form a list of probe sequences with the same sequence at the 2-terminus.
The oligonucleotide is synthesized on a large scale on a chip by adopting an oligonucleotide in-situ synthesis technology. The oligonucleotides on the chip were washed with ammonia and dissolved in 100. mu.L of ultrapure water to form an oligonucleotide mixture. The oligonucleotide mixture is amplified by PCR method using 5' end with biotin label (TTAGATAGGTGTGTAGGCGC) and reverse primer (TAAGGTGCGTACTAGCTGAC) to form a biotin labeled thrombus and hemostatic gene DNA probe library. The reaction system is as follows:
the reaction conditions were cycled for 20 cycles as follows: 95 ℃ for 1 minute, 95 ℃ for 15 seconds, 48 ℃ for 15 seconds, 72 ℃ for 5 minutes, 4 ℃ incubation.
And (3) performing on-machine sequencing on the sequencing library by adopting an Illumina high-throughput sequencer Hiseq 4000 to obtain sequencing data of pathogenic genes related to the thrombus and the hemostatic gene. Sequencing data were aligned to the human reference genome HG19 using BWAMEM software. The parameters used were: bw mem-M-k 40-t 8-R "@ RG \ tID: Hiseq \ tPL: Illumina \ tSM: sample", thereby obtaining single nucleotide polymorphism, insertion or deletion different from the reference genome, i.e., the detected mutation.
The target area capturing effect evaluation method comprises the following steps: using a samtools in samtools-1.9 software to count the size, the comparison rate, the repetition rate and the quality value of data; then, the sequencing depth of each position of the target area of the pathogenic genes related to the thrombus and the hemostatic genes is calculated by using a samtools in the software. And according to the data amount of the compared target region, dividing the data amount by the total data amount to obtain a result of the capturing efficiency. And respectively counting the number of bases with the sequencing depth of more than or equal to 1, more than or equal to 4, more than or equal to 10 and more than or equal to 20 according to the sequencing depth of each position in the target area, and dividing the number of bases by the total number of bases in the target area to obtain index information of 1 multiplied by coverage rate, 4 multiplied by coverage rate, 10 multiplied by coverage rate and 20 multiplied by coverage rate.
Second, the screening method of the gene diagnosis kit for thrombotic and hemorrhagic diseases of this embodiment
Taking 1 mu g of human genome DNA, and breaking the DNA to the range of 200-300bp by using an ultrasonication instrument. Preparation of a DNA fragment library was performed using the IlluminaTruSeq DNA library preparation kit.
And (3) carrying out liquid phase hybridization on the DNA fragment library and the thrombus and hemostatic gene DNA probe library to capture the thrombus and the hemostatic gene.
PCR was performed using Illumina PE PCR primer 1.0
(AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and Illumina PE PCR primer 2.0
(CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC T) as a primer, amplifying the captured product to obtain a sequencing library. The reaction system is as follows:
| name of reagent | Volume of |
| Trapping the product | 10μl |
| PCR primer 1.0 (25. mu.M) | 2.5μl |
| PCR primer 2.0 (25. mu.M) | 2.5μl |
| Phusion High- |
25μl |
| Ultrapure water | 10ul |
The reaction conditions were cycled for 16 cycles as follows: 95 ℃ for 1 minute, 95 ℃ for 15 seconds, 65 ℃ for 15 seconds, 72 ℃ for 5 minutes, 4 ℃ incubation.
And (3) performing on-machine sequencing on the sequencing library by adopting an Illumina high-throughput sequencer Hiseq 4000 to obtain sequencing data of the thrombus and the hemostatic gene. Sequencing data were aligned to the human reference genome HG19 using BWA MEM software. The parameters used were:
bw mem-M-k 40-t 8-R "@ RG \ tID: Hiseq \ tPL: Illumina \ tSM: sample", thereby obtaining single nucleotide polymorphism, insertion or deletion different from the reference genome, i.e., the detected mutation.
The target area capturing effect evaluation method comprises the following steps: using a samtools in samtools-1.9 software to count the size, the comparison rate, the repetition rate and the quality value of data; the sequencing depth for each position of the target region was then calculated using the samtools in the software. And according to the data amount of the compared target region, dividing the data amount by the total data amount to obtain a result of the capturing efficiency. And respectively counting the number of bases with the sequencing depth of more than or equal to 1, more than or equal to 4, more than or equal to 10 and more than or equal to 20 according to the sequencing depth of each position in the target area, and dividing the number of bases by the total number of bases in the target area to obtain index information of 1 multiplied by coverage rate, 4 multiplied by coverage rate, 10 multiplied by coverage rate and 20 multiplied by coverage rate.
Third, whole genome sequencing and target region capture effect evaluation
Taking 1 mu g of human genome DNA, and breaking the DNA to the range of 200-300bp by using an ultrasonication instrument. Preparation of a DNA fragment library was performed using the IlluminaTruSeq DNA library preparation kit. And (3) performing on-machine sequencing on the sequencing library by adopting an Illumina high-throughput sequencer Hiseq 4000 to obtain sequencing data of the thrombus and the hemostatic gene.
Sequencing data were aligned to the human reference genome HG19 using BWA MEM software. The parameters used were:
bw mem-M-k 40-t 8-R "@ RG \ tID: Hiseq \ tPL: Illumina \ tSM: sample", thereby obtaining single nucleotide polymorphism, insertion or deletion different from the reference genome, i.e., the detected mutation.
Using a samtools in samtools-1.9 software to count the size, the comparison rate, the repetition rate and the quality value of data; the sequencing depth for each position of the target region was then calculated using the samtools in the software. And according to the data amount of the compared target region, dividing the data amount by the total data amount to obtain a result of the capturing efficiency. And respectively counting the number of bases with the sequencing depth of more than or equal to 1, more than or equal to 4, more than or equal to 10 and more than or equal to 20 according to the sequencing depth of each position in the target area, and dividing the number of bases by the total number of bases in the target area to obtain index information of 1 multiplied by coverage rate, 4 multiplied by coverage rate, 10 multiplied by coverage rate and 20 multiplied by coverage rate. Table 1 shows the statistical comparison of the results obtained from the methods for diagnosing the thrombotic and hemorrhagic disease genes and the whole genome sequencing, as follows:
TABLE 1 comparison of the Gene diagnosis method of the present invention and the technique of Whole genome sequencing
As can be seen from the above table, the gene diagnosis method of the present invention is compared with the technical data of whole genome sequencing: the method is superior to whole genome sequencing in the indexes of thrombus related target area coverage, effective data quantity, capture efficiency data utilization rate, average sequencing depth, repetition rate and the like.
Fourth, application example
126 cases of venous thrombosis patient DNA were selected from the thrombotic disease sample library, and were tested by the autonomously developed 156 gene "diagnosis of thrombosis and hemorrhagic disease gene".
The technical method discovers 118 mutations of 45 genes, and the total frequency of the mutations is 145; 30 of the mutations are not reported; 45 are pathogenic (well-defined thrombotic mutations); 34 were likely pathogenic (highly suspicious thrombus-related mutations); 39 were unbnown (potential thrombus-related mutations to be further confirmed).
In total, 50 patients found clearly harmful gene mutations, 23 patients found highly suspicious gene mutations, 25 patients found potential gene mutations, and 28 patients found no thrombotic gene mutations; based on definite harm and high suspicious gene mutation, the molecular diagnosis rate of the diagnosis method in patients with thrombus easily becomes about 57.9 percent, which is far higher than that of patients with venous thrombosis at home and abroad.
In summary, compared to sequencing based on first generation sequencing, exon sequencing and whole genome sequencing, the detection method has obvious benefits: the technologies such as first-generation sequencing, MLPA and the like can only detect a few genes at one time, each gene needs to be amplified in different regions, and the operation complexity of the screening method is obviously reduced. The screening method is used for screening genes related to a blood coagulation factor system, a platelet system, a fibrinolysis system and an anticoagulation system widely at one time, and covers most genetic variations such as point mutation, insertion deletion of small fragments and large fragments, copy number variation and the like. Can effectively improve the diagnosis rate of thrombotic diseases and hemorrhagic diseases. The data volume is only about 200M, the sequencing data volume is obviously reduced, and the downstream analysis can be effectively simplified. The detection cost is also obviously reduced. Among the 126 VTE molecular diagnoses, the positive rate of diagnosis is as high as 57.9%.
In addition, 156 genes can be detected by the method, and table 2 shows that the neutral variation Marker of the 156 genes detected in the test can successfully cover the 156 genes.
TABLE 2
It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other identical elements in a process, method, article, or apparatus that comprises the element.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (7)
1. A method for diagnosing genes of thrombus and hemorrhagic diseases is characterized by comprising the following steps:
step 1, according to a human reference genome HG19, combining an Ensembl, CCDS, Gencode, VEGA, SNP and a CytoBand database, calling all coding sequences of genes related to thrombus and hemorrhage and intron sequences within 20bp of two sides of the coding sequences;
2, aiming at each coding sequence, designing a probe sequence with the length of 120bp from the first base according to the principle of reverse sequence complementation from 5 'to 3', and overlapping 60bp between every two adjacent probe sequences;
step 3, adding TAGGTGTGTAGGCGC and GTCAGCTAGTACGCA sequences to the 5 'end and the 3' end of each probe sequence respectively to form a probe sequence list with the same sequence at the 2 end, and preparing an oligonucleotide mixture;
step 4, amplifying the oligonucleotide mixture by adopting a PCR method and adopting a primer (TTAGATAGGTGTGTAGGCGC) with a biotin label at the 5' end and a reverse primer (TAAGGTGCGTACTAGCTGAC) to form a DNA probe library of the thrombus and hemostasis related genes with the biotin label;
step 5, performing on-machine sequencing on the probe library to obtain sequencing data of the related pathogenic genes of the thrombus and the hemostatic gene, and comparing the sequencing data with a human reference genome HG 19;
step 6, counting the size, the comparison rate, the repetition rate and the quality value of sequencing data, and calculating the sequencing depth of each position of the target region of the thrombus and the hemostatic gene related pathogenic gene; dividing the data volume of the target area by the total data volume according to the comparison to obtain a result of the capture efficiency; and respectively counting the number of bases with the sequencing depth of more than or equal to 1, more than or equal to 4, more than or equal to 10 and more than or equal to 20 according to the sequencing depth of each position in the target area, and dividing the number of bases by the total number of bases in the target area to obtain index information of 1 multiplied by coverage rate, 4 multiplied by coverage rate, 10 multiplied by coverage rate and 20 multiplied by coverage rate.
2. The method for gene diagnosis of thrombotic and hemorrhagic disease according to claim 1, wherein: and 3, preparing the oligonucleotide mixture by adopting an oligonucleotide in-situ synthesis technology, carrying out large-scale synthesis of oligonucleotides on the chip, washing off the following oligonucleotides on the chip by using ammonia water, and dissolving the oligonucleotides in 100 microliters of ultrapure water to form the oligonucleotide mixture.
3. The method for gene diagnosis of thrombotic and hemorrhagic disease according to claim 1, wherein: the reaction system of the step 4 is as follows:
the reaction conditions were cycled for 20 cycles as follows: 95 ℃ for 1 minute, 95 ℃ for 15 seconds, 48 ℃ for 15 seconds, 72 ℃ for 5 minutes, 4 ℃ incubation.
4. The method for gene diagnosis of thrombotic and hemorrhagic disease according to claim 1, wherein: and 5, performing on-machine sequencing on the probe library by adopting an Illumina high-throughput sequencer Hiseq 4000.
5. The method for gene diagnosis of thrombotic and hemorrhagic disease according to claim 1, wherein: step 5 aligns the sequencing data to the human reference genome HG19 using BWA MEM software.
6. The method for gene diagnosis of thrombotic and hemorrhagic disease according to claim 1, wherein: step 6, adopting a samtools in samtools-1.9 software to count the size, the comparison rate, the repetition rate and the quality value of sequencing data; then, the sequencing depth of each position of the target area of the pathogenic genes related to the thrombus and the hemostatic genes is calculated by using a samtools in the software.
7. The method for gene diagnosis of thrombotic and hemorrhagic disease according to claim 1, wherein: 156 genes related to thrombus and hemorrhage are extracted in the step 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910804284.2A CN111549128A (en) | 2019-08-28 | 2019-08-28 | Gene diagnosis method for thrombus and hemorrhagic disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910804284.2A CN111549128A (en) | 2019-08-28 | 2019-08-28 | Gene diagnosis method for thrombus and hemorrhagic disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111549128A true CN111549128A (en) | 2020-08-18 |
Family
ID=72001805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910804284.2A Pending CN111549128A (en) | 2019-08-28 | 2019-08-28 | Gene diagnosis method for thrombus and hemorrhagic disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111549128A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807336A (en) * | 2022-05-20 | 2022-07-29 | 华中科技大学同济医学院附属协和医院 | Detection method of thrombus related gene chip |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105297145A (en) * | 2015-11-06 | 2016-02-03 | 艾吉泰康生物科技(北京)有限公司 | Inherited metabolic disease screening method and reagent kit |
| CN106591461A (en) * | 2016-12-29 | 2017-04-26 | 天津协和华美医学诊断技术有限公司 | Detection kit for detecting hereditary thrombophilia related gene group |
| CN106868174A (en) * | 2017-03-27 | 2017-06-20 | 杭州艾迪康医学检验中心有限公司 | Detect the kit and method of the full extron of ADAMTS13 genes |
-
2019
- 2019-08-28 CN CN201910804284.2A patent/CN111549128A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105297145A (en) * | 2015-11-06 | 2016-02-03 | 艾吉泰康生物科技(北京)有限公司 | Inherited metabolic disease screening method and reagent kit |
| CN106591461A (en) * | 2016-12-29 | 2017-04-26 | 天津协和华美医学诊断技术有限公司 | Detection kit for detecting hereditary thrombophilia related gene group |
| CN106868174A (en) * | 2017-03-27 | 2017-06-20 | 杭州艾迪康医学检验中心有限公司 | Detect the kit and method of the full extron of ADAMTS13 genes |
Non-Patent Citations (1)
| Title |
|---|
| SIMEONI等: "A high-throughput sequencing test for diagnosing inherited bleeding, thrombotic, and platelet disorders", vol. 127, no. 23, pages 2791 - 2803 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807336A (en) * | 2022-05-20 | 2022-07-29 | 华中科技大学同济医学院附属协和医院 | Detection method of thrombus related gene chip |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101795124B1 (en) | Method and system for detecting copy number variation | |
| CN105695606B (en) | Screening method for hypertrophic cardiomyopathy related pathogenic gene mutation for non-therapeutic purpose | |
| KR20220012849A (en) | Comprehensive detection of single-cell genetic structural variations | |
| EA035451B1 (en) | Method to diagnose cancer using genomic sequencing | |
| CN106715711A (en) | Method for determining the sequence of a probe and method for detecting genomic structural variation | |
| CN110656157B (en) | Quality control product for tracing high-throughput sequencing sample and design and use method thereof | |
| CN104145028A (en) | Method and device for detecting microdeletion in chromosome sts area | |
| KR20170133270A (en) | Method for preparing libraries for massively parallel sequencing using molecular barcoding and the use thereof | |
| CN108753954A (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| Smart et al. | A novel phylogenetic approach for de novo discovery of putative nuclear mitochondrial (pNumt) haplotypes | |
| CN103290135A (en) | Screening method of infantile autism gene | |
| CN111549128A (en) | Gene diagnosis method for thrombus and hemorrhagic disease | |
| Lagarde et al. | Systematic detection of mosaicism by using digital NGS reveals three new MEN1 mosaicisms | |
| CN115029430A (en) | Biomarker for evaluating aortic dissection risk and application thereof | |
| CN105209637B (en) | Noninvasive sex of foetus determines | |
| CN108728515A (en) | A kind of analysis method of library construction and sequencing data using the detection ctDNA low frequencies mutation of duplex methods | |
| CN103834673A (en) | EXT1 gene mutant and application thereof | |
| Cheranova et al. | RNA-seq analysis of transcriptomes in thrombin-treated and control human pulmonary microvascular endothelial cells | |
| Vrahatis et al. | Identifying miRNA-mediated signaling subpathways by integrating paired miRNA/mRNA expression data with pathway topology | |
| Ahmed et al. | Development of reference genes for horticultural plants | |
| US20200208195A1 (en) | Method for measuring mutation rate | |
| CN109097465B (en) | Application of SNP (single nucleotide polymorphism) site of CLIP3 gene | |
| Flannick et al. | Genetic discovery and translational decision support from exome sequencing of 20,791 type 2 diabetes cases and 24,440 controls from five ancestries | |
| CN109536488A (en) | People's clopidogrel medication is because of detection kit | |
| JP2021502072A (en) | Correction of sequence errors induced in deamination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |