CN111537725A - Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method - Google Patents
Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method Download PDFInfo
- Publication number
- CN111537725A CN111537725A CN202010476749.9A CN202010476749A CN111537725A CN 111537725 A CN111537725 A CN 111537725A CN 202010476749 A CN202010476749 A CN 202010476749A CN 111537725 A CN111537725 A CN 111537725A
- Authority
- CN
- China
- Prior art keywords
- antibody
- extracellular vesicles
- hole
- liquid
- fusion protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70521—CD28, CD152
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
Abstract
The invention relates to the field of molecular biology and biotechnology, in particular to a method for efficiently and quantitatively detecting the level of PD-1 in extracellular vesicles, an ELISA kit and a using method thereof, wherein the extracellular vesicles of human body fluid are captured by using the specificity of an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody, the level of PD-1 protein in the extracellular vesicles is detected by using the anti-PD-1 antibody, and the PD-1 in the extracellular vesicles is quantitatively detected by using the constructed corresponding CD63-PD-1, CD9-PD-1 or CD81-PD-1 fusion protein as a standard. The invention realizes the quantitative detection of the extracellular vesicle complex structure; meanwhile, the detection result is characterized by specific protein concentration by using the autonomously constructed fusion proteins of CD63-PD-1, CD9-PD-1 and CD81-PD-1 as standard proteins.
Description
Technical Field
The invention relates to the field of molecular biology and biotechnology, in particular to a method for efficiently and quantitatively detecting the level of PD-1 in extracellular vesicles, an ELISA kit and a using method.
Background
With the continuous rise of morbidity and mortality, malignant tumor is a major public health problem and becomes the leading cause of death in China. Although surgical level and chemoradiotherapy techniques have advanced sufficiently in the last two decades, the recurrence rate and mortality rate of malignant tumors have not been significantly alleviated. Tumor immunotherapy is an emerging therapeutic approach that allows patients to rely on autoimmunity to kill tumor cells and tumor tissues by reactivating the human immune system. Since the first approval for anti-PD-1 inhibitors to be marketed in 2014, over many years of clinical trials, immunotherapy targeting the immune checkpoint PD-L1/PD-1 signaling pathway has demonstrated significant therapeutic effects on a variety of malignancies, promising for patients with advanced malignancies. Compared with the traditional treatment methods such as radiotherapy, chemotherapy and the like, the immunotherapy based on the PD-L1/PD-1 monoclonal antibody has the greatest characteristics that: once the medicine takes effect to patients, the curative effect is obvious and lasting, and even the tumor can be completely eliminated to achieve the curative effect. However, only less than 30% of tumor patients can benefit from the expensive PD-L1/PD-1 monoclonal antibody treatment, and the treatment period of the treatment is long, so that the treatment failure is proved to delay the other treatment occasions of the patients. Therefore, there is an urgent need to find biomarkers that can accurately predict the efficacy of immunotherapy.
Extracellular Vesicles (EVs) are a general term for membrane structures with diameters of 50-1000nm, which are produced by cell secretion, carry abundant bioactive molecules (such as proteins, RNA, etc.), and can participate in the functional regulation of local or distant cells through autocrine or paracrine pathways, affecting the extracellular microenvironment. Therefore, the detection of the PD-1 level of the extracellular vesicles in body fluid has important significance for detecting the immune response of an organism and the like.
Traditional enzyme linked immunosorbent assay (ELISA) is a qualitative and quantitative detection method in which soluble antigen or antibody is bound to a solid phase carrier, and immunoreaction is performed by utilizing specific binding of antigen and antibody. The ELISA detection is an experimental diagnosis method with high sensitivity, strong specificity and good repeatability; due to factors such as stable reagent, easy storage, simple operation, objective result judgment and the like, ELISA has been widely used in various fields of immunological tests. The existing ELISA strategy for detecting the PD-1 level of the body fluid source of a patient mainly uses an anti-PD-1 antibody as a capture antibody, and simultaneously uses the anti-PD-1 antibody as a detection antibody to form a classic sandwich structure so as to detect the total PD-1 level in the body fluid. Because the PD-1 carried by the extracellular vesicles and a large amount of free PD-1 protein exist in the body fluid of a patient, the ELISA quantitative detection of the PD-1 level directly performed on a body fluid sample is interfered by the free PD-1 protein. In order to avoid interference of free PD-1 protein, the above strategy requires separation and purification of extracellular vesicles in body fluid by ultracentrifugation in advance in practical use. However, the ultracentrifugation method is time-consuming and labor-consuming, lacks a standardized operation process, and requires a large-scale ultracentrifugation device, which is not favorable for clinical popularization and application; more importantly, studies have demonstrated that ultracentrifugation is less than 30% efficient in isolating extracellular vesicles, and it is currently unclear whether the level of PD-1 in 30% of extracellular vesicles accurately reflects the level of PD-1 in total extracellular vesicles. Therefore, there is a need to develop a more reliable, rapid and economical method for quantitatively detecting the PD-1 level on extracellular vesicles in body fluids with high efficiency.
Disclosure of Invention
One of the purposes of the invention is to provide a method for efficiently and quantitatively detecting the level of PD-1 in extracellular vesicles, so that the defects of complicated step of centrifugally purifying the extracellular vesicles from body fluid and low sample recovery rate are overcome, the interference of free PD-1 protein on a detection result is avoided, and the specific identification and quantitative detection of the level of the protein of the extracellular vesicles PD-1 are realized.
The invention also aims to provide an ELISA kit for efficiently and quantitatively detecting the PD-1 level in the extracellular vesicles, which can rapidly and quantitatively detect the PD-1 level in the extracellular vesicles.
The invention also aims to provide a using method of the ELISA kit for efficiently and quantitatively detecting the PD-1 level in the extracellular vesicles.
The scheme adopted by the invention for realizing one of the purposes is as follows: a method for efficiently and quantitatively detecting the level of PD-1 in extracellular vesicles comprises the steps of capturing the extracellular vesicles by utilizing the specificity of an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody, detecting the level of PD-1 protein in the extracellular vesicles by utilizing the anti-PD-1 antibody, and quantitatively detecting the PD-1 in the extracellular vesicles by utilizing corresponding constructed CD63-PD-1 fusion protein, CD9-PD-1 fusion protein or CD81-PD-1 fusion protein as a standard substance.
Preferably, the nucleic acid sequence of the CD63-PD-1 fusion protein is shown in SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-1 fusion protein is shown as SEQ ID No: 3, respectively.
Preferably, the extracellular vesicles are derived from any one of blood, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, sweat, semen, lymph, and cell culture supernatant.
Except that the blood is specific to various cancers of the whole body, the other collected body fluids are specific part fluids for the detected cancers, such as saliva for cancers of oral cavity and adjacent parts, urine for urothelial cancer, pleural effusion for lung cancer, cerebrospinal fluid for brain glioma and the like.
The second scheme adopted by the invention for achieving the purpose is as follows: an ELISA kit for efficiently and quantitatively detecting the PD-1 level in extracellular vesicles comprises an ELISA plate, a sealing plate membrane, standard protein diluent, sample diluent, concentrated washing liquid, an enzyme-labeled antibody A, an enzyme-labeled antibody B, a color-developing agent A liquid, a color-developing agent B liquid and stop solution;
wherein, the ELISA plate is coated with anti-CD 63 antibody, anti-CD 9 antibody or anti-CD 81 antibody in advance according to the concentration of 1-5 mug/mL;
the standard protein is constructed CD63-PD-1 or CD9-PD-1 or CD81-PD-1 fusion protein.
The ELISA plate is a Nunc type ELISA plate of Biolegend company; the sealing membrane is a sealing membrane of Corning company, with the product number of UC-500, and the standard protein diluent comprises 100-20 g/L buffer solution and 2-6g/L preservative, and the buffer solution is 300 mmol/L.
Preferably, the anti-CD 63 antibody is an anti-CD 63 antibody from Thermo Fisher, cat # TJ 26539346; the anti-CD 9 antibody is an anti-CD 9 antibody from Thermo Fisher, cat # TL 2686763; the anti-CD 81 antibody is an anti-CD 81 antibody from Novus, cat No. 531413.
Preferably, the nucleic acid sequence of the CD63-PD-1 fusion protein is shown in SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-1 fusion protein is shown as SEQ ID No: 3, respectively.
Preferably, the concentrated washing solution is an aqueous solution containing 0.01-0.05mol/L PBS and 1-5 per mill of Tween-20 in mass percentage; the enzyme-labeled antibody A is a PD-1 detection antibody of 1 microgram/mL, and the enzyme-labeled antibody B is a horse radish peroxidase coupled chromogenic antibody of 1 microgram/mL.
The enzyme-labeled antibody A provided by the kit is a PD-1 detection antibody of 1 microgram/mL, and is an anti-PD-1 antibody of R & D company, wherein the cargo number is AF1086 after screening various commercially available PD-1 detection antibodies. The enzyme-labeled antibody B provided by the kit is a horseradish peroxidase-coupled chromogenic antibody of 1 mu g/mL, and is a HRP chromogenic antibody of BD company, the product number of which is 554066, after screening various commercially available HRP chromogenic antibodies.
Preferably, the color developing agent A liquid comprises 2.72% of sodium acetate, 0.32% of citric acid and 0.02% of hydrogen peroxide by mass percent, and is configured in distilled water; the color developing agent B liquid comprises 0.04% of disodium ethylene diamine tetraacetate, 0.19% of citric acid, 9% of glycerol and 0.03% of 3,3 ', 5, 5' -tetramethyl benzidine in percentage by mass, and is configured in distilled water; the stop solution is 2mol/L dilute sulfuric acid.
The scheme adopted by the invention for realizing the third purpose is as follows: the use method of the ELISA kit for efficiently and quantitatively detecting the PD-1 level in the extracellular vesicles comprises the following steps:
(1) after balancing at room temperature, taking out the ELISA plate, arranging a standard substance hole and a sample hole on the ELISA plate, adding standard proteins with different concentration gradients into the standard substance hole, adding a body fluid sample to be detected into the sample hole, and culturing for 1 hour at 37 ℃;
(2) discarding liquid in the hole, injecting washing liquid 300 mu L, washing, repeating for many times, discarding the washing liquid for the last time, and then inversely placing on absorbent paper for drying;
(3) adding 100 mu L of enzyme-labeled antibody A liquid and enzyme-labeled antibody B liquid which are mixed in advance into an ELISA plate hole, sealing the ELISA plate hole by using a sealing plate film, and incubating for 1 hour at 37 ℃;
(4) discarding liquid in the hole, injecting washing liquid 300 mu L, washing, repeating for many times, discarding the washing liquid for the last time, and then inversely placing on absorbent paper for drying;
(5) mixing the color developing agent A solution and the color developing agent B solution at a ratio of 1:1, adding 100 μ L of the mixture into each hole, and developing at room temperature in a dark place;
(6) and observing the standard sample hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop color development, slightly shaking until the color in the hole is yellow, measuring the OD value of each hole at the wavelength of 450nm and 570nm within 15 minutes, calculating the OD value at 450nm minus the OD value at 570nm to obtain the final OD value of the sample, and calculating the concentration of the sample to be measured.
Preferably, in step (1), the concentration gradient of the standard substance is eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL and 0ng/mL, and 100 μ L is added to each standard well.
The body fluid sample mentioned in step 1 of the present invention needs to be subjected to preliminary centrifugation treatment, and there are three main centrifugation conditions for different body fluids: firstly, for saliva and other viscous body fluids, the centrifugal force is 2600g, the centrifugal temperature is 4 ℃, the centrifugal time is 15 minutes, and supernatant is collected and centrifuged twice; secondly, for blood, the centrifugal force is 1550g, the centrifugal temperature is 25 ℃, the centrifugal time is 20 minutes, and upper transparent plasma is collected and centrifuged twice; thirdly, for relatively clear body fluid such as urine, the centrifugal force is 1550g, the centrifugal temperature is 4 ℃, the centrifugal time is 15 minutes, and the supernatant is taken and centrifuged twice.
The incubation temperature set in step 1 and step 3 of the present invention was 37 ℃ and the incubation time was 1 hour.
The washing method mentioned in step 2 and step 4 of the invention comprises the steps of completely sucking reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, completely sucking the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry.
The invention uses 8 or 12-channel pipettor to add liquid in steps 2 to 6 so as to reduce operation errors and loading errors.
The OD value mentioned in step 6 of the invention is an absorbance value, and the OD value at the wavelength of 570nm needs to be subtracted from the OD value at the wavelength of 450nm for correction, and finally the sample concentration is calculated according to the linear relation of the standard.
The invention has the following advantages and beneficial effects:
it has been shown that almost all extracellular vesicles express the tetraspanin family molecules CD63, CD9, CD81, and therefore CD63, CD9, CD81 molecules have been used as markers for identifying extracellular vesicles. Based on the above, the invention provides a novel detection method for directly detecting the PD-1 level in the extracellular vesicles of human body fluid, which adopts a double-antibody sandwich method, namely the method takes an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody as a capture antibody of the extracellular vesicles, takes an anti-PD-1 antibody as a detection antibody, and takes an autonomously constructed CD63-PD-1, CD9-PD-1 or CD81-PD-1 fusion protein as a standard substance, thereby realizing the rapid quantitative detection of the PD-1 content of the extracellular vesicles in the body fluid. Compared with the existing ELISA detection strategy which takes the anti-PD-1 antibody as the capture antibody, the method avoids the defects of complicated step of body fluid centrifugal purification and low sample recovery rate, simultaneously avoids the interference of free PD-1 protein on the detection result, and realizes the specific identification and quantitative detection of the protein level of the extracellular vesicle-PD-1. In addition, not every extracellular vesicle can express CD63, CD9 and CD81 at the same time, so that the capture efficiency of the total extracellular vesicles can be greatly improved by combining and matching different marker molecules, and the high-efficiency capture of the total extracellular vesicles can be realized. The method has wide application prospect in the aspects of early diagnosis, prognosis evaluation and immunotherapy curative effect prediction of malignant tumors.
Since PD-1 is widely present in two forms in body fluids, namelyPD-1 and free PD-1, existing PD-1, on extracellular vesicles+The quantitative detection of the extracellular vesicles needs to obtain the extracellular vesicles by ultracentrifugation and purification of body fluid and then perform quantitative detection by ELISA. The invention breaks through the mode of detecting free single protein molecules by the traditional 'A-A-A sandwich' ELISA, upgrades the original detection method by using the 'A-AB-B' strategy, and realizes the quantitative detection of PD-1 on the complex structure of extracellular vesicles; meanwhile, the detection result is no longer percentage content but is characterized by specific protein concentration by taking the independently constructed fusion proteins of CD63-PD-1, CD9-PD-1 and CD81-PD-1 as standard proteins.
Drawings
FIG. 1 is the extracellular vesicle size distribution (a-b) of the normal cell lines (HUVECs) and the human peripheral blood leukemia T cell line (Jurkat) in the fourth example of the present invention;
FIG. 2 is a standard curve of CD63-PD-1 recombinant protein in the fourth embodiment of the invention;
FIG. 3 shows ELISA detection results of cell supernatants (Supernatant), Extracellular Vesicles (EVs), and supernatants after ultracentrifugation (EVs-Freeprenatant) of normal cell lines (HUVECs) and human peripheral blood leukemia T cell line (Jurkat) in example four of the present invention;
FIG. 4 shows the change trend of PD-1 protein level and tumor Volume (Volume) in the extracellular vesicles of WM 164-transplanted tumor mice in example five of the present invention;
FIG. 5 shows the results of plasma ELISA tests of normal subjects (HD), untreated malignant Melanoma Patients (MP), and malignant melanoma patients (tMP) after receiving immunotherapy in example six of the present invention;
FIG. 6 is an ELISA result of capturing pleural effusion of a patient with non-small cell lung cancer according to example seven of the present invention with anti-CD 63 antibody, anti-CD 9 antibody, anti-CD 81 antibody, and anti-CD 63/9/81 mixed antibody.
Detailed Description
The following examples are provided to further illustrate the present invention for better understanding, but the present invention is not limited to the following examples.
The first embodiment is as follows: construction of CD63-PD-1 fusion protein
1. According to the sequence (Gene ID:967) of the human CD63 Gene queried by the PubmedGene, selecting a translation fragment from Ala103 to Val 203; PD-1 Gene sequence (Gene ID:5133), wherein Leu125 to Gln167 segments were selected. Designing a His protein tag sequence, an initiation codon and a stop codon; insertion of a connexin sequence between two sequences
(GGTGGTGGTGGTAGCGGTGGTGGCGGTAGTGGTGGTGGTGGTAGC), introducing EcoRl and Xhol double restriction sites, designing a pair of forward and reverse primers (Table 1), and carrying out PCR amplification to obtain a CD63-PD-1 gene fragment. .
TABLE 1 CD63-PD-1PCR primers
2. The CD63-PD-1 gene fragment and the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol are connected through an Exnase recombinase (Nonunza company, the cargo number C113-01), and a recombinant plasmid CD63-PD-1 is obtained after transformation and screening, wherein the nucleic acid sequence of the recombinant plasmid is shown in SEQ ID No: 1, and the amino acid sequence is shown in SEQ ID No: 4, respectively.
3. The recombinant plasmid CD63-PD-1 is transferred into E.coli DH5 α competent bacteria and is subjected to Kanamycin resistant agarose culture medium (K)+LB) and extracting the plasmid.
4. The extracted recombinant plasmid CD63-PD-1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K+The LB plate was used to obtain the desired clonal strain.
5. Single colonies were picked to 50mL K+LB culture to OD600When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.5-1mmol/L to stimulate protein expression, the culture is continuously carried out for 4-8 hours, centrifugation is carried out at 12000 r/min for 15 minutes, supernatant and precipitate are respectively collected, 20 mu L of 6 × protein loading buffer is added to 100 mu L after PBS dilution or heavy suspension, and SDS-polyacrylamide gel electrophoresis and Coomassie brilliant blue staining analysis and identification are carried out.
6. The collected bacterial pellet was added to 8mL of bacterial lysate (TRIS-HCl50mmol/L, NaCl300mmol/L, triton x-1000.5%, pH 8.0), mixed on ice for 30min, centrifuged at 4 ℃ at 12,000g for 10 min, and the pellet was resuspended in 15 volumes of inclusion body dissolution buffer (TRIS-HCl50mmol/L, NaCl100mmol/L, EDTA1mmol/L, triton x-1000.5%, urea 8mol/L, pH 8.0).
7. Adding 10mmol/L imidazole into the above heavy suspension, adding into chromatography column, controlling flow rate at 0.5-1 mL/min, washing column with washing buffer (TRIS-HCl50 mmol/L; NaCl300 mmol/L; imidazole 10 mmol/L; pH 8.0) at 1 mL/min to remove hetero protein, repeating washing for 6 times, eluting with elution buffer (TRIS-HCl50 mmol/L; NaCl300 mmol/L; imidazole 250 mmol/L; pH 8.0) for 4 times, and collecting eluate.
8. And dialyzing the collected eluent into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD63-PD-1 fusion protein.
Example two: construction of CD9-PD-1 fusion protein
1. According to the sequence (Gene ID:928) of a human CD9 Gene queried by Pubmed Gene, selecting a Ser 112-Ile 195 translation segment; PD-1 Gene sequence (Gene ID:5133), wherein Leu125 to Gln167 segments were selected. Designing a His protein tag sequence, an initiation codon and a stop codon; insertion of a connexin sequence between two sequences
(GGTGGTGGTGGTAGCGGTGGTGGCGGTAGTGGTGGTGGTGGTAGC), introducing EcoRl and Xhol double restriction sites, designing a pair of forward and reverse primers (Table 2), and carrying out PCR amplification to obtain a CD3-PD-1 gene fragment.
TABLE 2 CD9-PD-1PCR primers
2. The CD9-PD-1 gene fragment and the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol are connected through an Exnase recombinase (Nonunza company, the cargo number C113-01), and a recombinant plasmid CD9-PD-1 is obtained after transformation and screening, wherein the nucleic acid sequence of the recombinant plasmid is shown in SEQ ID No: 2, and the amino acid sequence is shown in SEQ ID No: 5, respectively.
3. Transferring the recombinant plasmid CD9-PD-1 into E.coliDH5 α competent bacteria, and culturing in Kanamycin-resistant agaroseRadical (K)+LB) and extracting the plasmid.
4. The extracted recombinant plasmid CD9-PD-1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K+The LB plate was used to obtain the desired clonal strain.
5. Single colonies were picked to 50mL K+LB culture to OD600When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.5-1mmol/L to stimulate protein expression, the culture is continuously carried out for 4-8 hours, centrifugation is carried out at 12000 r/min for 15 minutes, supernatant and precipitate are respectively collected, 20 mu L of 6 × protein loading buffer is added to 100 mu L after PBS dilution or heavy suspension, and SDS-polyacrylamide gel electrophoresis and Coomassie brilliant blue staining analysis and identification are carried out.
6. The collected bacterial pellet was added to 8mL of bacterial lysate (TRIS-HCl50mmol/L, NaCl300mmol/L, triton x-1000.5%, pH 8.0), mixed on ice for 30 minutes, centrifuged at 4 ℃ at 12,000g for 10 minutes, and the pellet was resuspended in 15 volumes of inclusion body dissolution buffer (TRIS-HCl50mmol/L, NaCl100mmol/L, EDTA1mmol/L, triton x-1000.5%, urea 8mol/L, pH 8.0).
7. Adding 10mmol/L imidazole into the above heavy suspension, adding into chromatography column, controlling flow rate at 0.5-1 mL/min, washing column with washing buffer (TRIS-HCl50 mmol/L; NaCl300 mmol/L; imidazole 10 mmol/L; pH 8.0) at 1 mL/min to remove hetero protein, repeating washing for 6 times, eluting with elution buffer (TRIS-HCl50 mmol/L; NaCl300 mmol/L; imidazole 250 mmol/L; pH 8.0) for 4 times, and collecting eluate.
8. And dialyzing the collected eluent into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD9-PD-1 fusion protein.
Example three: construction of CD81-PD-1 fusion protein
1. According to the sequence of human CD81 Gene (Gene ID:975) queried by PubmedGene, selecting a Phe113 to Lys201 translation segment; PD-1 Gene sequence (Gene ID:5133), wherein Leu125 to Gln167 segments were selected. Designing a His protein tag sequence, an initiation codon and a stop codon; insertion of a connexin sequence between two sequences
(GGTGGTGGTGGTAGCGGTGGTGGCGGTAGTGGTGGTGGTGGTAGC), introducing EcoRl and Xhol double-enzyme cutting sites, designing a pair of positive and negative primers (table 3), and carrying out PCR amplification to obtain a CD3-PD-1 gene fragment.
TABLE 3 CD81-PD-1PCR primers
2. The CD81-PD-1 gene fragment and the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol are connected through an Exnase recombinase (Nonunza company, the cargo number C113-01), and a recombinant plasmid CD81-PD-1 is obtained after transformation and screening, wherein the nucleic acid sequence of the recombinant plasmid is shown in SEQ ID No: 3, and the amino acid sequence is shown in SEQ ID No: and 6.
3. The recombinant plasmid CD81-PD-1 is transferred into E.coli DH5 α competent bacteria and is subjected to Kanamycin resistant agarose culture medium (K)+LB) and extracting the plasmid.
4. The extracted recombinant plasmid CD81-PD-1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K+The LB plate was used to obtain the desired clonal strain.
5. Single colonies were picked to 50mL K+LB culture to OD600When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.5-1mmol/L to stimulate protein expression, the culture is continuously carried out for 4-8 hours, the supernatant and the precipitate are respectively collected by centrifugation at 12,000 r/min for 15 minutes, 20 mu L of 6 × protein loading buffer is added to every 100 mu L after the dilution or the re-suspension by PBS, and the SDS-polyacrylamide gel electrophoresis and Coomassie brilliant blue staining analysis and identification are carried out.
6. The collected bacterial pellet was added to 8mL of bacterial lysate (TRIS-HCl50mmol/L, NaCl300mmol/L, triton x-1000.5%, pH 8.0), mixed on ice for 30min, centrifuged at 4 ℃ at 12,000g for 10 min, and the pellet was resuspended in 15 volumes of inclusion body dissolution buffer (TRIS-HCl50mmol/L, NaCl100mmol/L, EDTA1mmol/L, triton x-1000.5%, urea 8mol/L, pH 8.0).
7. Adding 10mmol/L imidazole into the above heavy suspension, adding into chromatography column, controlling flow rate for 0.5-1mL min, washing column with washing buffer (TRIS-HCl50 mmol/L; NaCl300 mmol/L; imidazole 10 mmol/L; pH 8.0) at flow rate of 1 mL/min to remove hetero protein, repeating washing for 6 times, eluting with elution buffer (TRIS-HCl50 mmol/L; NaCl300 mmol/L; imidazole 250 mmol/L; pH 8.0) for 4 times, and collecting eluate.
8. And dialyzing the collected eluent into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD81-PD-1 fusion protein.
Example four: ELISA detection of extracellular vesicle PD-1 level in vitro culture supernatant
1. Cell supernatants starved-cultured with low-concentration fetal calf serum (5%) for 48 hours were collected using human umbilical vein endothelial cell lines (HUVECs) and human peripheral blood leukemia T cell lines (Jurkat) cultured with exosome-free fetal calf serum (100000g, centrifuged overnight at 4 ℃).
2. The collected 10mL of cell supernatant was centrifuged at 2000g at 4 ℃ for 30min, the supernatant was retained to remove cells and cell debris, 1mL of the supernatant was retained for examination, the remaining 9mL of the supernatant was centrifuged at 100000g at 4 ℃ for 70 min, the centrifuged supernatant was collected and the pellet was resuspended in 20. mu.L of PBS to obtain extracellular vesicles.
3. The resuspended extracellular vesicles were examined by Nanoparticle Tracking Analysis (NTA) and found to have an average particle size of about 100nm for both HVUEC and Jurkat cell-derived extracellular vesicles (FIG. 1, a-b).
4. 100 μ L of Supernatant (Supernatant) collected from the HUVEC and Jurkat cell lines, extracellular vesicles (diluted 40 times), and Supernatant obtained by ultracentrifugation were added to the sample wells, and 100 μ L of CD3-PD-1 standard protein obtained in example one was added to each standard well according to eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL, and 0ng/mL, and the wells were sealed with a membrane to seal the well plates, and incubated at 37 ℃ in an incubator for 1 h.
5. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 5 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
6. Discarding the liquid in the wells of the ELISA plate, injecting 300. mu.L of PBST cleaning solution (0.05% Tween 20 in PBS), repeatedly washing for 4 times, inverting on absorbent paper, patting dry, adding 100. mu.L of the enzyme-labeled antibody mixture of step 6, and incubating in a 37 ℃ incubator for 1 hour.
7. Discarding liquid in the holes of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 4 times, and inversely placing on absorbent paper for drying; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
8. After the color of the standard wells changes linearly (about 10-30 minutes), adding 50 mu L of stop solution into each well, slightly shaking until the liquid in the wells turns yellow, and measuring OD values at the wavelength of 450nm and 570nm by using an enzyme labeling instrument within 15 minutes (the OD value at 450nm minus the OD value at 570nm is the final OD value of the sample).
9. The PD-1 concentration of each cell line sample was calculated by plotting a standard curve (fig. 2) from the standard results (fig. 3) showing: for HUVECs cell lines which do not express PD-1, PD-1 can not be detected in cell supernatants (Supernatant), Extracellular Vesicles (EVs) and ultracentrifugation supernatants (EVs-Free superanatant); cell supernatants from the Jurkat lymphocyte cell line were significantly higher than extracellular vesicles obtained after centrifugation, while some PD-1 was detectable in the supernatants obtained after ultracentrifugation. The above results suggest that the PD-1 content of lymphocyte-derived extracellular vesicles can be detected by grasping extracellular vesicle surface molecules such as CD63, CD9, or CD81 using the ELISA kit; the traditional ultracentrifugation method can not completely centrifuge the extracellular vesicles, and the PD-1 on the extracellular vesicles in the culture supernatant can be directly and quantitatively detected by using the ELISA kit.
Example five: application of ELISA kit for efficiently and quantitatively detecting extracellular vesicle PD-1 level in monitoring tumor progress
1. Logarithmic phase WM164 cells (malignant melanoma cell line) were inoculated subcutaneously into the backs of 8-week-old C57BL/6N mice, and 5 × 10 cells were injected into each mouse6Individual cells (100. mu.L) were inoculated with a total of 20 cells; three weeks in culture, photographed and measured tumor volume, calculated as width2× length/2.
2. Euthanizing the mice, immediately collecting 500 mu L of eyeball arterial blood, centrifuging for 10 minutes at 25 ℃ under 1550g, and collecting upper plasma; the supernatant plasma was collected by centrifugation for 10 minutes under the same conditions.
3. Taking out the ELISA plate on which the CD63 capture antibody is pre-paved, setting 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL and 0ng/mL of the CD63-PD-1 recombinant protein prepared in the first embodiment for concentration gradient, and adding the concentration gradient into a standard well; adding 100 mu L of mouse plasma into the sample hole; the well plate was sealed with a sealing membrane and incubated in an incubator at 37 ℃ for 1 hour.
4. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 3 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
5. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, sucking up liquid in the holes, repeatedly washing for 4 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; add 100. mu.L of the enzyme-labeled antibody mixture of step 3, and incubate in 37 ℃ incubator for 1 hour.
6. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, sucking up liquid in the holes after shaking for 2 minutes, repeatedly washing for 5 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
7. And observing the standard product hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop the color reaction, slightly shaking until the reaction is completely stopped in the hole, measuring the OD value of each hole at the wavelength of 450nm and 570nm of an enzyme-linked immunosorbent assay detector within 15 minutes, calculating the final OD value of the sample by subtracting the OD value at the position of 570nm from the OD value at the position of 450nm, and calculating the concentration of the sample to be measured.
8. The correlation of tumor volume with PD-1 concentration on blood extracellular vesicles was analyzed in conjunction with tumor measurements (fig. 4). The results indicate that the concentration of PD-1 on extracellular vesicles in the blood of mice increases with increasing tumor volume (P ═ 0.0021), suggesting that PD-1 on extracellular vesicles in body fluids may predict tumor progression.
Example six: application of ELISA kit for efficiently and quantitatively detecting extracellular vesicle PD-1 level in tumor diagnosis and curative effect prediction
1. Blood was collected in 2mL volumes from normal subjects (HD), untreated malignant Melanoma patients (Melanoma patient, MP), and malignant Melanoma patients (Treated Melanoma, tMP) for five cases per group. Centrifuging at 25 deg.C and 1550g for 10 min, collecting upper layer plasma, and removing blood cells; the cells were centrifuged for 10 minutes under the same conditions to remove the remaining blood cells, and the upper plasma was collected and stored at 4 ℃ for further use.
2. Adding 100 μ L of the collected plasma into an enzyme label plate sample hole on which a CD63 capture antibody is previously paved; setting 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL and 0ng/mL of the CD63-PD-1 recombinant protein prepared in the first example to form a concentration gradient, and adding the concentration gradient into a standard well; the well plate was sealed with a sealing membrane and incubated in an incubator at 37 ℃ for 1 hour.
3. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 3 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
4. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, sucking up liquid in the holes, repeatedly washing for 4 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; add 100. mu.L of the enzyme-labeled antibody mixture of step 3, and incubate in 37 ℃ incubator for 1 hour.
5. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, sucking up liquid in the holes after shaking for 2 minutes, repeatedly washing for 5 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
6. And observing the standard product hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop the color reaction, slightly shaking until the reaction is completely stopped in the hole, measuring the OD value of each hole at the wavelength of 450nm and 570nm of an enzyme-linked immunosorbent assay detector within 15 minutes, calculating the final OD value of the sample by subtracting the OD value at the position of 570nm from the OD value at the position of 450nm, and calculating the concentration of the sample to be measured.
7. The PD-1 concentrations of blood samples of three groups HD, MP, and tMP were compared (fig. 5). The result shows that the PD-1 content in the blood extracellular vesicles of the malignant tumor patients is higher than that of normal subjects, and the PD-1 content in the blood extracellular vesicles of the malignant melanoma patients after receiving immunotherapy is obviously reduced compared with that of the patients before the immunotherapy. It is suggested that the PD-1 content of the extracellular vesicles in the body fluid can be used as a potential tumor diagnosis marker for patients with malignant tumors, and the change of the PD-1 content of the extracellular vesicles in the body fluid of patients who receive immunotherapy can be used as a biomarker for evaluating the therapeutic effect.
Example seven: application of ELISA kit for efficiently detecting extracellular vesicle PD-1 level in detection of pleural effusion extracellular vesicle PD-1 level of tumor patient
1. Five patients with non-small cell lung cancer (NSCLC) were collected and centrifuged at 1550g for 15 min at 4 ℃ in 5mL of pleural effusion, and the supernatant was collected, centrifuged twice and stored at 4 ℃ for further use.
2. An anti-CD 63 antibody (Thermo Fisher, Cat. No. TJ26539346), an anti-CD 9 antibody (Thermo Fisher, Cat. No. TL2686763), and an anti-CD 81 antibody (Novus, Cat. No. 531413) were each diluted at a concentration of 5. mu.g/mL in a carbonic acid coating buffer (8.4g of NaHCO3, 3.56g of Na2CO3 in 1L of double distilled water, and the pH was adjusted to 9.5), and CD63, CD9, and anti-CD 81 antibodies were each mixed and diluted at a concentration of 5. mu.g/mL to serve as capture antibodies for total extracellular vesicles of body fluid.
Adding 50 mu L of the CD63, CD9, CD81 and CD63/9/81 mixed antibody into each hole of an ELISA plate, wherein each group has 5 holes and the total number of the holes is 20; the pore plate was sealed with a sealing film and left overnight at 4 ℃.
4. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, sucking up liquid in the holes, repeatedly washing for 4 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry.
5. Add 200. mu.L of blocking solution (10% FBS, 2mL fetal bovine serum in 18mL PBS) per well and block for 1 hour at room temperature.
6. Adding 100 μ L of the supernatant collected in step 1 into the sample wells, each patient having a well without an incubated capture antibody as a blank; the well plate was sealed with a sealing membrane and incubated in an incubator at 37 ℃ for 1 hour.
7. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while performing step 6, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
8. Sucking up reaction liquid in the pores, injecting 300 mu L of washing liquid, and sucking up liquid in the pores after shaking for 2 minutes; washing for 4 times, wherein the last time, the washing liquid in the holes needs to be completely absorbed, and the holes are inversely placed on the absorbent paper to be dried; add 100. mu.L of the enzyme-labeled antibody mixture of step 3, and incubate in 37 ℃ incubator for 1 hour.
9. Sucking up reaction liquid in the pores, injecting 300 mu L of washing liquid, and sucking up liquid in the pores after shaking for 2 minutes; washing for 5 times, wherein the last time, the washing liquid in the holes needs to be completely absorbed, and the holes are inversely placed on the absorbent paper to be dried; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
10. And (3) observing the color change of the sample hole within 10-30 minutes, adding 50 mu L of stop solution to stop the color reaction, slightly shaking until the color reaction is completely stopped in the hole, measuring the OD value of each hole at the wavelength of 450nm and 570nm of an enzyme-linked immunosorbent assay detector within 15 minutes, and calculating the OD value at 450nm minus the OD value at 570nm to obtain the final OD value of the sample.
11. Comparing the detection results obtained after capturing CD63, CD9, CD81, CD63/9/81 mixed antibody (fig. 6), with CD63/9/81 as a control, it can be seen that the PD-1 content obtained by using CD63 capture antibody is slightly higher than that obtained by using CD9 and CD81 capture antibody, i.e. more extracellular vesicles are captured by using anti-CD 9 antibody, while more extracellular vesicles and PD-1 are detected by using CD63/9/63 mixed capture antibody than CD63, CD9 and CD81 antibody, indicating that the surface standard protein molecules of extracellular vesicles in different body fluids are expressed differently, and the use of CD63/9/81 mixed capture antibody can avoid errors caused by the expression difference of surface protein molecules of different body fluids.
While the foregoing is directed to the preferred embodiment of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow.
Sequence listing
<110> Wuhan university
<120> method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>801
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggctggct atgtgtttag agataaggtg atgtcagagt ttaataacaa cttccggcag 60
cagatggaga attacccgaa aaacaaccac actgcttcga tcctggacag gatgcaggca 120
gattttaagt gctgtggggc tgctaactac acagattggg agaaaatccc ttccatgtcg 180
aagaaccgag tccccgactc ctgctgcatt aatgttactg tgggctgtgg gattaatttc 240
aacgagaagg cgatccataa ggagggctgt gtggagaaga ttgggggctg gctgaggaaa 300
aatgtgggtg gtggtggtag cggtggtggc ggtagtggtg gtggtggtag cttagactcc 360
ccagacaggc cctggaaccc ccccaccttc tccccagccc tgctcgtggt gaccgaaggg 420
gacaacgcca ccttcacctg cagcttctcc aacacatcgg agagcttcgt gctaaactgg 480
taccgcatga gccccagcaa ccagacggac aagctggccg ccttccccga ggaccgcagc 540
cagcccggcc aggactgccg cttccgtgtc acacaactgc ccaacgggcg tgacttccac 600
atgagcgtgg tcagggcccg gcgcaatgac agcggcacct acctctgtgg ggccatctcc 660
ctggccccca aggcgcagat caaagagagc ctgcgggcag agctcagggt gacagagaga 720
agggcagaag tgcccacagc ccaccccagc ccctcaccca ggccagccgg ccagttccaa 780
catcaccatc atcatcatta a 801
<210>2
<211>750
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atgtcccaca aggatgaggt gattaaggaa gtccaggagt tttacaagga cacctacaac 60
aagctgaaaa ccaaggatga gccccagcgg gaaacgctga aagccatcca ctatgcgttg 120
aactgctgtg gtttggctgg gggcgtggaa cagtttatct cagacatctg ccccaagaag 180
gacgtactcg aaaccttcac cgtgaagtcc tgtcctgatg ccatcaaaga ggtcttcgac 240
aataaattcc acatcggtgg tggtggtagc ggtggtggcg gtagtggtgg tggtggtagc 300
ttagactccc cagacaggcc ctggaacccc cccaccttct ccccagccct gctcgtggtg 360
accgaagggg acaacgccac cttcacctgc agcttctcca acacatcgga gagcttcgtg 420
ctaaactggt accgcatgag ccccagcaac cagacggaca agctggccgc cttccccgag 480
gaccgcagcc agcccggcca ggactgccgc ttccgtgtca cacaactgcc caacgggcgt 540
gacttccaca tgagcgtggt cagggcccgg cgcaatgaca gcggcaccta cctctgtggg 600
gccatctccc tggcccccaa ggcgcagatc aaagagagcc tgcgggcaga gctcagggtg 660
acagagagaa gggcagaagt gcccacagcc caccccagcc cctcacccag gccagccggc 720
cagttccaac atcaccatca tcatcattaa 750
<210>3
<211>765
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atgtttgtca acaaggacca gatcgccaag gatgtgaagc agttctatga ccaggcccta 60
cagcaggccg tggtggatga tgacgccaac aacgccaagg ctgtggtgaa gaccttccac 120
gagacgcttg actgctgtgg ctccagcaca ctgactgctt tgaccacctc agtgctcaag 180
aacaatttgt gtccctcggg cagcaacatc atcagcaacc tcttcaagga ggactgccac 240
cagaagatcg atgacctctt ctccgggaag ggtggtggtg gtagcggtgg tggcggtagt 300
ggtggtggtg gtagcttaga ctccccagac aggccctgga acccccccac cttctcccca 360
gccctgctcg tggtgaccga aggggacaac gccaccttca cctgcagctt ctccaacaca 420
tcggagagct tcgtgctaaa ctggtaccgc atgagcccca gcaaccagac ggacaagctg 480
gccgccttcc ccgaggaccg cagccagccc ggccaggact gccgcttccg tgtcacacaa 540
ctgcccaacg ggcgtgactt ccacatgagc gtggtcaggg cccggcgcaa tgacagcggc 600
acctacctct gtggggccat ctccctggcc cccaaggcgc agatcaaaga gagcctgcgg 660
gcagagctca gggtgacaga gagaagggca gaagtgccca cagcccaccc cagcccctca 720
cccaggccag ccggccagtt ccaacatcac catcatcatc attaa 765
<210>4
<211>266
<212>PRT
<213>CD63-PD-1(CD63-PD-1)
<400>4
Met Ala Gly Tyr Val Phe Arg Asp Lys Val Met Ser Glu Phe Asn Asn
1 5 10 15
Asn Phe Arg Gln Gln Met Glu Asn Tyr Pro Lys Asn Asn His Thr Ala
20 25 30
Ser Ile Leu Asp Arg Met Gln Ala Asp Phe Lys Cys Cys Gly Ala Ala
35 40 45
Asn Tyr Thr Asp Trp Glu Lys Ile Pro Ser Met Ser Lys Asn Arg Val
50 55 60
Pro Asp Ser Cys Cys Ile Asn Val Thr Val Gly Cys Gly Ile Asn Phe
65 70 75 80
Asn Glu Lys Ala Ile His Lys Glu Gly Cys Val Glu Lys Ile Gly Gly
85 90 95
Trp Leu Arg Lys Asn Val Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
100 105 110
Gly Gly Gly Gly Ser Leu Asp Ser Pro Asp Arg Pro Trp Asn Pro Pro
115 120 125
Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp Asn Ala Thr
130 135 140
Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val Leu Asn Trp
145 150 155 160
Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala Ala Phe Pro
165 170 175
Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg Val Thr Gln
180 185 190
Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg Ala Arg Arg
195 200 205
Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys
210 215 220
Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val Thr Glu Arg
225 230 235 240
Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser Pro Arg Pro Ala
245 250 255
Gly Gln Phe Gln His His His His His His
260 265
<210>5
<211>249
<212>PRT
<213>CD9-PD-1(CD9-PD-1)
<400>5
Met Ser His Lys Asp Glu Val Ile Lys Glu Val Gln Glu Phe Tyr Lys
1 5 10 15
Asp Thr Tyr Asn Lys Leu Lys Thr Lys Asp Glu Pro Gln Arg Glu Thr
20 25 30
Leu Lys Ala Ile His Tyr Ala Leu Asn Cys Cys Gly Leu Ala Gly Gly
35 40 45
Val Glu Gln Phe Ile Ser Asp Ile Cys Pro Lys Lys Asp Val Leu Glu
50 55 60
Thr Phe Thr Val Lys Ser Cys Pro Asp Ala Ile Lys Glu Val Phe Asp
65 70 75 80
Asn Lys Phe His Ile Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
85 90 95
Gly Gly Gly Ser Leu Asp Ser Pro Asp Arg Pro Trp Asn Pro Pro Thr
100 105 110
Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp Asn Ala Thr Phe
115 120 125
Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val Leu Asn Trp Tyr
130 135 140
Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala Ala Phe Pro Glu
145 150 155 160
Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg Val Thr Gln Leu
165 170 175
Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg Ala Arg Arg Asn
180 185 190
Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala
195 200 205
Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val Thr Glu Arg Arg
210 215 220
Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser Pro Arg Pro Ala Gly
225 230 235 240
Gln Phe Gln His His His His His His
245
<210>6
<211>254
<212>PRT
<213>CD81-PD-1(CD81-PD-1)
<400>6
Met Phe Val Asn Lys Asp Gln Ile Ala Lys Asp Val Lys Gln Phe Tyr
1 5 10 15
Asp Gln Ala Leu Gln Gln Ala Val Val Asp Asp Asp Ala Asn Asn Ala
20 25 30
Lys Ala Val Val Lys Thr Phe His GluThr Leu Asp Cys Cys Gly Ser
35 40 45
Ser Thr Leu Thr Ala Leu Thr Thr Ser Val Leu Lys Asn Asn Leu Cys
50 55 60
Pro Ser Gly Ser Asn Ile Ile Ser Asn Leu Phe Lys Glu Asp Cys His
65 70 75 80
Gln Lys Ile Asp Asp Leu Phe Ser Gly Lys Gly Gly Gly Gly Ser Gly
85 90 95
Gly Gly Gly Ser Gly Gly Gly Gly Ser Leu Asp Ser Pro Asp Arg Pro
100 105 110
Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly
115 120 125
Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe
130 135 140
Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu
145 150 155 160
Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe
165 170 175
Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val
180 185 190
Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu CysGly Ala Ile Ser
195 200 205
Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg
210 215 220
Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser
225 230 235 240
Pro Arg Pro Ala Gly Gln Phe Gln His His His His His His
245 250
Claims (10)
1. A method for efficiently and quantitatively detecting the level of PD-1 in extracellular vesicles is characterized by comprising the following steps: the method specifically captures extracellular vesicles by using an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody, detects the level of PD-1 protein in the extracellular vesicles by using an anti-PD-1 antibody, and realizes quantitative detection of PD-1 in the extracellular vesicles by using the constructed corresponding CD63-PD-1 fusion protein, CD9-PD-1 fusion protein or CD81-PD-1 fusion protein as a standard.
2. The method for efficiently and quantitatively detecting the PD-1 level in extracellular vesicles according to claim 1, wherein: the nucleic acid sequence of the CD63-PD-1 fusion protein is shown as SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-1 fusion protein is shown as SEQ ID No: 3, respectively.
3. The method for efficiently and quantitatively detecting the PD-1 level in extracellular vesicles according to claim 1, wherein: the extracellular vesicles are derived from any one of blood, saliva, urine, cerebrospinal fluid, abdominal dropsy, pleural effusion, sweat, semen, lymph fluid, and cell culture supernatant.
4. An ELISA kit for efficiently and quantitatively detecting the PD-1 level in extracellular vesicles is characterized in that: the kit comprises an ELISA plate, a sealing plate membrane, standard protein diluent, sample diluent, concentrated washing liquid, an ELISA antibody A, an ELISA antibody B, a color developing agent A liquid, a color developing agent B liquid and stop solution;
wherein, the ELISA plate is coated with anti-CD 63 antibody, anti-CD 9 antibody or anti-CD 81 antibody in advance according to the concentration of 1-5 mug/mL;
the standard protein is constructed CD63-PD-1 or CD9-PD-1 or CD81-PD-1 fusion protein.
5. The ELISA kit for high-efficiency quantitative detection of PD-1 levels in extracellular vesicles according to claim 4, characterized in that: the anti-CD 63 antibody is an anti-CD 63 antibody from Thermo Fisher, cat # TJ 26539346; the anti-CD 9 antibody is an anti-CD 9 antibody from Thermo Fisher, cat # TL 2686763; the anti-CD 81 antibody is an anti-CD 81 antibody from Novus, cat No. 531413.
6. The ELISA kit for high-efficiency quantitative detection of PD-1 levels in extracellular vesicles according to claim 4, characterized in that: the nucleic acid sequence of the CD63-PD-1 fusion protein is shown as SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-1 fusion protein is shown as SEQ ID No: 3, respectively.
7. The ELISA kit for high-efficiency quantitative detection of PD-1 levels in extracellular vesicles according to claim 4, characterized in that: the concentrated washing solution is an aqueous solution containing 0.01-0.05mol/L PBS and 1-5 per mill Tween-20 by mass percent; the enzyme-labeled antibody A is a PD-1 detection antibody of 1 microgram/mL, and the enzyme-labeled antibody B is a horse radish peroxidase coupled chromogenic antibody of 1 microgram/mL.
8. The ELISA kit for high-efficiency quantitative detection of PD-1 levels in extracellular vesicles according to claim 4, characterized in that: the color developing agent A liquid comprises 2.72% of sodium acetate, 0.32% of citric acid and 0.02% of hydrogen peroxide by mass percent, and is configured in distilled water; the color developing agent B liquid comprises 0.04% of disodium ethylene diamine tetraacetate, 0.19% of citric acid, 9% of glycerol and 0.03% of 3,3 ', 5, 5' -tetramethyl benzidine in percentage by mass, and is configured in distilled water; the stop solution is 2mol/L dilute sulfuric acid.
9. A method for using the ELISA kit for the high-efficiency quantitative detection of the PD-1 level in the extracellular vesicles according to any one of claims 4 to 8, characterized by comprising the following steps:
(1) after balancing at room temperature, taking out the ELISA plate, arranging a standard substance hole and a sample hole on the ELISA plate, adding standard proteins with different concentration gradients into the standard substance hole, adding a body fluid sample to be detected into the sample hole, and culturing for 1 hour at 37 ℃;
(2) discarding liquid in the hole, injecting washing liquid 300 mu L, washing, repeating for many times, discarding the washing liquid for the last time, and then inversely placing on absorbent paper for drying;
(3) adding 100 mu L of enzyme-labeled antibody A liquid and enzyme-labeled antibody B liquid which are mixed in advance into an ELISA plate hole, sealing the ELISA plate hole by using a sealing plate film, and incubating for 1 hour at 37 ℃;
(4) discarding liquid in the hole, injecting washing liquid 300 mu L, washing, repeating for many times, discarding the washing liquid for the last time, and then inversely placing on absorbent paper for drying;
(5) mixing the color developing agent A solution and the color developing agent B solution according to the volume ratio of 1:1, adding 100 mu L of the mixture into each hole, and developing at room temperature in a dark place;
(6) and observing the standard sample hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop color development, shaking until the color in the hole is yellow, measuring the OD value of each hole at the wavelength of 450nm and 570nm within 15 minutes, calculating the final OD value of the sample by subtracting the OD value at the wavelength of 570nm from the OD value at the wavelength of 450nm, and calculating the concentration of the sample to be measured.
10. The use method of the ELISA kit for high-efficiency quantitative detection of PD-1 levels in extracellular vesicles according to claim 9, characterized in that: in the step (1), the concentration gradient of the standard substance is eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL and 0ng/mL, and 100 mu L of the standard substance is added into each standard hole.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010476749.9A CN111537725A (en) | 2020-05-29 | 2020-05-29 | Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010476749.9A CN111537725A (en) | 2020-05-29 | 2020-05-29 | Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111537725A true CN111537725A (en) | 2020-08-14 |
Family
ID=71976590
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010476749.9A Pending CN111537725A (en) | 2020-05-29 | 2020-05-29 | Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111537725A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022040350A1 (en) * | 2020-08-19 | 2022-02-24 | Ohio State Innovation Foundation | Highly sensitive platform to characterize extracellular vesicular biomarkers for cancer immunotherapy |
| WO2023107537A1 (en) * | 2021-12-07 | 2023-06-15 | Evelo Biosciences, Inc. | Antibody compositions and methods for utilizing with extracellular vesicles and microbes |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317778A (en) * | 2008-01-25 | 2012-01-11 | 汉萨生物医药公司 | Measure and characterize the new method of microvesicle in people's body fluid |
| WO2019094692A2 (en) * | 2017-11-09 | 2019-05-16 | The Trustees Of The University Of Pennsylvania | Extracellular vesicle proteins and their use for cancer diagnosis, predicting response to therapy, and treatment |
| CN111133106A (en) * | 2017-07-12 | 2020-05-08 | 外来体诊断公司 | Method for isolating and enriching extracellular vesicles from biological fluid sources and methods of use thereof |
-
2020
- 2020-05-29 CN CN202010476749.9A patent/CN111537725A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317778A (en) * | 2008-01-25 | 2012-01-11 | 汉萨生物医药公司 | Measure and characterize the new method of microvesicle in people's body fluid |
| CN111133106A (en) * | 2017-07-12 | 2020-05-08 | 外来体诊断公司 | Method for isolating and enriching extracellular vesicles from biological fluid sources and methods of use thereof |
| WO2019094692A2 (en) * | 2017-11-09 | 2019-05-16 | The Trustees Of The University Of Pennsylvania | Extracellular vesicle proteins and their use for cancer diagnosis, predicting response to therapy, and treatment |
Non-Patent Citations (8)
| Title |
|---|
| COSMO BIO CO.LTD: "CD9/CD63 Exosome ELISA Kit, Human", 《HTTPS://WWW.COSMOBIOUSA.COM/CONTENT/DOCUMENT/COSMO-BIO-LTD/CSR-EXH0102EL_CD9CD63-EXOSOME-ELISA-KIT_DATASHEET.PDF》 * |
| GANG CHEN ET AL: "Exosomal PD-L1 Contributes to Immunosuppression and is Associated with anti-PD-1 Response", 《NATURE》 * |
| MARIE-NICOLE THEODORAKI ET AL: "Clinical Significance of PD-L1 Exosomes in Plasma of Head and Neck Cancer Patients", 《CLIN CANCER RES》 * |
| 中国抗癌协会肿瘤标志专业委员会外泌体技术专家委员会: "外泌体研究、转化和临床应用专家共识", 《转化医学杂志》 * |
| 张盈盈，等: "外泌体作为药物载体的研究进展", 《药学学报》 * |
| 株式会社ハカレル: "PD-L1/CD9 Exosome ELISA Kit, Human", 《HTTPS://SEARCH.COSMOBIO.CO.JP/COSMO_SEARCH_P/SEARCH_GATE2/DOCS/HAK_/HAKHELPDL1091.20190926.PDF》 * |
| 苏春霞 主编: "《肺癌的免疫治疗新进展》", 30 June 2018, 上海科学普及出版社 * |
| 魏晓晶，等: "外泌体功能与临床应用研究进展。", 《中国医药导报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022040350A1 (en) * | 2020-08-19 | 2022-02-24 | Ohio State Innovation Foundation | Highly sensitive platform to characterize extracellular vesicular biomarkers for cancer immunotherapy |
| WO2023107537A1 (en) * | 2021-12-07 | 2023-06-15 | Evelo Biosciences, Inc. | Antibody compositions and methods for utilizing with extracellular vesicles and microbes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110093356B (en) | DNA sequence coding for African swine fever virus antigen, composition of antigen coded by DNA sequence and application of DNA sequence in immunological detection | |
| US9068988B2 (en) | Compositions and methods of detecting TIABs | |
| CN111443199B (en) | Reagent for rapidly detecting novel coronavirus antibody by magnetic nanoparticle immunochromatography and preparation method thereof | |
| CN102321175B (en) | Nano-antibody or polypeptide aiming at breast cancer Her2/new | |
| CN101949937A (en) | Oophoroma tumor marker HE4 time-resolved fluoroimmunoassay detection kit | |
| CN108508200B (en) | Method for detecting CD19 CAR-expressing cells and application thereof | |
| CN111521816B (en) | Time-resolved fluorescence immunochromatographic assay test strip for echinococcosis granulosus of cattle and preparation method thereof | |
| CN110146697B (en) | Immune test strip for rapidly detecting malignant malaria, vivax malaria, triumphaniae and oval malaria | |
| CN111537725A (en) | Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method | |
| CN108484779B (en) | Fusion protein of nano antibody and human placenta alkaline phosphatase and application | |
| US10408840B2 (en) | Method for predicting clinical effect of immunotherapy | |
| CA2287545A1 (en) | Ma family polypeptides and anti-ma antibodies | |
| CN111551732A (en) | Method for quantitatively detecting content of tumor-derived extracellular vesicle PD-L1 in body fluid, ELISA kit and using method | |
| CN106404731B (en) | PCT and CRP double-labeling time-resolved fluorescence immunoassay method for simultaneously detecting bacterial meningitis and viral meningitis | |
| CN111796090B (en) | Time-resolved fluorescence immunochromatographic assay test strip for echinococcosis granulosus of cattle and preparation method thereof | |
| CN111551733A (en) | Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method | |
| CN105861520A (en) | Application of Rv3121 protein for detecting mycobacterium tuberculosis infection | |
| KR101805250B1 (en) | Method and kit for TB diagnosis based on immune response to K-strain specific antigens | |
| CN110526981B (en) | anti-CD 3 and EpCAM bispecific antibody and application thereof in lung cancer treatment | |
| CN104749371B (en) | People's nephroblastoma overepressed gene encoding proteins enzyme linked immunological kit | |
| CN111537726A (en) | Method for efficiently and quantitatively detecting PD-L1 level in extracellular vesicle, ELISA kit and using method | |
| CN110540599B (en) | Klebsiella pneumoniae Elisa detection kit based on Klebsiella pneumoniae surface protein antibody and preparation method thereof | |
| CN104945496B (en) | A kind of polypeptide and its application in the preparation and purification antibody special to EHD2 | |
| CN113433321A (en) | Novel method for detecting expression level of tumor antigen OVA12 in tumor tissue | |
| CN106884018B (en) | Reagent and kit for detecting oncogenic protein epidermal growth factor receptor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230602 Address after: Room 409, Building 1, Block B, Gaonong Biological Park Headquarters, No. 888 Gaoxin Avenue, Donghu New Technology Development Zone, Wuhan City, Hubei Province, 430000 Applicant after: Jiabi Biotechnology (Wuhan) Co.,Ltd. Address before: 430072 Hubei Province, Wuhan city Wuchang District of Wuhan University Luojiashan Applicant before: WUHAN University |
|
| TA01 | Transfer of patent application right |