CN111518899A - Application of NUDT21 gene in preparation of lung cancer treatment drug - Google Patents
Application of NUDT21 gene in preparation of lung cancer treatment drug Download PDFInfo
- Publication number
- CN111518899A CN111518899A CN202010204995.9A CN202010204995A CN111518899A CN 111518899 A CN111518899 A CN 111518899A CN 202010204995 A CN202010204995 A CN 202010204995A CN 111518899 A CN111518899 A CN 111518899A
- Authority
- CN
- China
- Prior art keywords
- nudt21
- lung cancer
- gene
- cells
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an application of an NUDT21 gene in preparing a medicine for treating lung cancer, and relates to the technical field of lung cancer diagnosis and dietary therapy, wherein the nucleotide sequence of the NUDT21 gene is shown as SEQ ID No. 1. Immunohistochemical staining analysis, in vivo and in vitro experiments and TCGA data sets of clinical small cell lung cancer specimens prove that the NUDT21 is closely related to lung cancer, silent NUDT21 obviously promotes the growth of tumors, high-expression NUDT21 reduces the growth process of the tumors, and the NUDT21 influences the survival time of lung cancer patients. Therefore, the NUDT21 can be used as a gene target of lung cancer, the diagnosis and treatment effects of the lung cancer, especially small cell lung cancer, are further improved, and accurate treatment of the lung cancer is promoted.
Description
Technical Field
The invention belongs to the technical field of lung cancer diagnosis and treatment, and particularly relates to an application of an NUDT21 gene in preparation of a lung cancer treatment drug.
Background
At present, the diagnosis and treatment of lung cancer still face some difficult problems, especially Small Cell Lung Cancer (SCLC), which accounts for a smaller proportion of lung cancer diseases in the world than the common adenocarcinoma. However, over 40 ten thousand cases are reported each year, and the treatment options of a large number of people are rare and have poor curative effect, and the most common chemotherapy or radiotherapy has certain limitations.
Radiotherapy and chemotherapy are often used in the original diagnosis and treatment of lung cancer, and gene therapy is also used for treatment, but many adverse reactions and complications exist, and the lung cancer cannot be comprehensively diagnosed.
Disclosure of Invention
In view of the above, the invention aims to provide application of the NUDT21 gene in preparation of a drug for treating lung cancer, and the NUDT21 gene is used as a gene target of lung cancer, so that the treatment effect of the lung cancer can be further improved, and accurate medical treatment of the lung cancer is promoted.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an application of an NUDT21 gene in preparing a medicament for treating lung cancer, wherein the nucleotide sequence of the NUDT21 gene is shown as SEQ ID No. 1.
Preferably, the NUDT21 affects the growth of lung cancer cells a549, including small cell lung cancer, by modulating GLS1 alternative splicing in hypoxic microenvironments.
The invention provides an application of an NUDT21 gene in preparing a medicament for treating lung cancer, wherein the nucleotide sequence of the NUDT21 gene is shown as SEQ ID No. 1. The immunohistochemical staining analysis is carried out on clinical small cell lung cancer specimens, the expression of the NUDT21 in small cell lung cancer tissues is found to be reduced compared with that in marginal normal tissues, and the TCGA data set shows the correlation between the NUDT21 and the survival time of lung cancer patients; expression of NUDT21 is regulated in hypoxic microenvironments and appears to HIF-1 α mediate expression of NUDT 21; further experiments in hypoxic microenvironments showed that hypoxia altered the expression of NUDT21 resulting in an influence on carbohydrate metabolism (A, B in fig. 3) and glutamine metabolism (C in fig. 3), with consequent conversion of glutaminase isoforms (D, E in fig. 3). In vivo and in vitro experiments prove that the NUDT21 is closely related to lung cancer, and under the condition of no radiotherapy and chemotherapy, silencing NUDT21 obviously promotes the proliferation of A549, inhibits apoptosis and promotes the formation of clones. Further injecting silent NUDT21 and high expression NUDT 21A 549 into nude mice respectively, finding that silent NUDT21 obviously promotes the growth of tumors, and high expression NUDT21 reduces the growth process of the tumors. Therefore, the NUDT21 can be used as a gene target of lung cancer, the treatment effect on the lung cancer, especially on small cell lung cancer, is further improved, and accurate treatment on the lung cancer is promoted.
Drawings
FIG. 1 is a graph of immunohistochemical staining analysis of clinical small cell lung cancer specimens and correlation of lung cancer patient survival to NUDT21, wherein: a represents a representative image of NUDT21 staining in tissue; -is sample staining negative, + is weakly stained sample, + is moderately stained sample, + is strongly stained sample; b represents the H-score statistics of 15 pairs of samples; c represents Kaplan-Meier analysis, with expression of NUDT21 correlated with survival in patients with lung cancer (median survival increased from 46.881678009 months to 78.61 months; no change in NUDT 21: n ═ 2288, change in NUDT 21: n ═ 15); p <0.05 in comparison to control;
fig. 2 is a graph of the expression of NUDT21 in hypoxic microenvironments, wherein: a represents the expression of NUDT21 in a549 cells at different times under 1% oxygen conditions; b represents 1% O2Culturing A549 cells, and detecting expression of HIFs and NUDT21 by western blot, wherein C represents the effect of 2h culture of A549 in DFO at different concentrations on expression of HIFs and NUDT21 Western blot, D represents the effect of silencing HIF-1 α on expression of NUDT21, E represents the effect of silencing HIF-2 α on expression of NUDT21, and the graph represents p<0.0001；
FIG. 3 is a graph of the effect of changes in expression of NUDT21 on glutamine metabolism in an oxygen microenvironment, wherein: a represents that A549 cells are cultured for 24h and 48h under the anoxic condition, and the expression of Gult1 and 3 is detected by Q-PCR; b represents that the Q-PCR method is used for detecting the expression of the Gult1 and Gult3 of A549 cells after NUDT21 is silenced; c represents that A549 cells are cultured for 24 hours and 48 hours under the anoxic condition, and the expression of GLS1 is detected by a Q-PCR method; d represents the expression of GLS1 of two splice variants of GAC and KGA in a549 cells under hypoxic conditions; e represents that the cultured A549 cells are cultured for 24 hours and 48 hours under the anoxic condition, and western blot detects the expression of NUDT21, GLS1, GAC and KGA subtypes; wherein p <0.05, p <0.01, p < 0.001;
fig. 4 is a graph of NUDT21 vs lung cancer, wherein: a represents silencing of A549 cells by NUDT21, and detection results by Q-PCR and western blot; b represents the effect of silencing NUDT21 on a549 cell proliferation; c represents the inhibition effect of NUDT21 on A549 cell apoptosis; d represents the clone formation of A549 cells after NUDT21 is silenced; e indicates that a549 cells were cultured under normal conditions and under hypoxic conditions for 15h, under which a549 cells had greater migratory capacity, p <0.05, p <0.01, p < 0.001.
FIG. 5 is a graph showing experimental results of a xenograft model in which: a represents Q-PCR detection of expression of NUDT21 in A549 cells; b indicates tumor growth was monitored 1 day, 7 days, 14 days, and 21 days after injection of a549 cells, respectively; c represents the change in body weight of the mice during the experiment; d represents the weight change of each group after tumor resection after the experiment is finished; e represents the comparison of tumor volumes of each group; f represents immunohistochemical detection of expression of NUDT21(70 ×); p <0.001 in the figure;
FIG. 6 is a diagram showing the structure of the expression protein of the NUDT21 gene, in which (left) is the structure of NUDT21(CPSF5) and (right) is the structure of CFim composed of it.
Detailed Description
The invention provides an application of an NUDT21 gene in preparing a medicament for treating lung cancer, wherein the nucleotide sequence of the NUDT21 gene is shown as SEQ ID No. 1. Preferably, the lung cancer of the present invention includes small cell lung cancer. The NUDT21 (also called CPSF5 or CFIm25) is used as a main regulator of shortening of 3' UTR, is a highly conserved CFIM component and is involved in the early stage of eukaryotic pre-mRNA aggregation, and the NUDT21 is mediated by hypoxia inducible factor HIF-1a (shown in figure 2), can regulate the generation and development of lung cancer by regulating alternative splicing and selective polyadenylation and is also involved in the survival and metabolism of lung cancer cells.
The NUDT21 gene is a mRNA precursor 3' end modifier, so that one member of the NUDT hydrolase protein superfamily has a NUDIX hydrolase structure domain, and the function of the NUDT hydrolase structure domain is similar to that of a real RNA binding protein. The expression protein NUDT21 (FIG. 6) of the NUDT21 gene of the present invention can bind to a specific RNA sequence, but because two of the four essential glutamic acid residues are lacking, the catalytic function and metal binding are ensured, and thus RNA cleavage is not possible.
In the invention, under the condition of low oxygen environment, the expression of the NUDT21 gene in the small cell lung cancer tissue is down-regulated. And most of small cell lung cancer tissue samples have negative H-SCORE SCOREs of the NUDT21 genes in the immunohistochemical detection, part of the small cell lung cancer tissue samples have weak positive H-SCORE SCOREs, a few of the small cell lung cancer tissue samples have moderate positive H-SCORE SCOREs, and the small cell lung cancer tissue samples have strong positive H-SCORE SCOREs in the immunohistochemical detection of the NUDT21 genes in punctured marginal normal tissues. Therefore, the H-SCORE of the NUDT21 gene was higher in the small cell lung cancer tissue-punctured borderline normal tissue than in the small cell lung cancer tissue, while the TCGA data set indicated that the survival of lung cancer patients was closely related to NUDT 21. Silencing the NUDT21 gene may be a potential target for promoting tumor growth and tumor metastasis.
The application of the NUDT21 gene provided by the present invention in the preparation of a drug for treating lung cancer will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.
Example 1
1. Cell lines and compounds
Human alveolar basal epithelial cells A549 cultured in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% FCS. Human embryonic kidney HEK293T cells were preserved in DMEM (ATCC, Manassas, VA, usa) supplemented with 10% FCS. Desferrioxamine (DFO) was purchased from Sigma.
2.Real-Time Reverse Transcript Polymerase Chain Reaction(RT-PCR)
Total RNA was extracted from A549 cells using Trio Reagent (Invitrogen, Carlsbad, Calif., USA). Specific conditions and parameters 2. mu.g of total RNA was inverted to cDNA using the TransScript One-Step gDNARemoval and cDNAsynthess SuperMix (Beijing Alkukin) instructions according to the protocol in the specification. Real-time PCR was performed in the 7500 detection system by using SYBR-Green I as a double stranded DNA specific binding dye. The mRNA of the target gene and the GAPDH mRNA of the housekeeping gene were quantified in separate tubes. This value represents the relative level of target gene expression, where the expression of NUDT21 in a549 cells at different times under 1% oxygen conditions is shown as a in fig. 2, as: 0h 0.017684, 4h0.01937, 8h 0.02313, 24h 0.01462, 48h 0.00883; the effect of silencing HIF-1 α on NUDT21 expression is shown in FIG. 2D, where under normal Conditions (CON) HIF-1a is 0.01154, NUDT21 is 0.01558, post-silencing (Sh-HIF1 α) HIF-1a is 0.00126, and NUDT21 is 0.03987; silencing HIF-2 α affects NUDT21 expression as shown in E in FIG. 2, where HIF2-a is 0.01154, NUDT21 is 0.02590, post-silencing HIF2-a is 0.00126, and NUDT21 is 0.03065 under normal conditions;
a549 cells are cultured for 24h and 48h under the anoxic condition, and the expression level of Gult1 and 3 detected by Q-PCR is shown as A in figure 3, wherein the expression level of Gult1 at 0, 24 and 48h is 0.00027, 0.00083 and 0.00070 respectively; the expression levels of Gult3 at 0, 24 and 48h are respectively 0.0011, 0.0122 and 0.0108; detecting the expression quantity of Gult1 and Gult3 of A549 cells after NUDT21 is silenced as shown in B in figure 3, wherein the expression quantity of Gult1 is 0.00012 under normal conditions, and the expression quantity of Gult3 is 0.00051; the expression level of NUDT21 after silencing is 0.0009 and 0.0007 respectively; a549 cells were cultured under anaerobic conditions for 24 hours and 48 hours, and the expression level of GLS1 detected by Q-PCR method is shown in C in FIG. 3, wherein the expression levels of GLS1 at 0, 24 and 48 hours are 0.01285, 0.00836 and 0.005216, respectively; under hypoxic conditions, GLS1 for two splice variants of GAC and KGA was expressed in a549 cells as shown in D in fig. 3, normally 68.778 and Hypoxia (Hypoxia) 37.9596.
The primers used for RT-PCR are shown in Table 1.
TABLE 1 primers used for RT-PCR
3. Vector Vectors and lentivirus-mediated shRNA transduction
Lentiviral short hairpin RNA (shRNA) vectors targeting NUDT21(PLKO.1-shNUDT21) were constructed according to the protocol of the PLKO.1-puro vector (Addgene, Cambridge, MA, USA).
The forward oligonucleotide (SEQ ID NO.20) 5'CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTTG 3';
and an inverse oligonucleotide (SEQ ID NO. 21): 5'CAAAAACAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGCCGG3'
Annealed at 95 ℃ for 4 min in a PCR instrument and inserted into PLKO.1-puro vector.
The control vector PLKO.1-shSCRamble was also purchased from addge (website: www.addgene.org).
HIF-1. alpha. and HIF-2. alpha. Lentiviral vectors were maintained in the laboratory. After co-transfection of PLKO.1-shNUDT21 or PLKO.1-shSCRamble with the phosphate co-precipitation kit (Promega, Madison, Wis., USA), packaging plasmid psPAX2 and envelope plasmid pMD2.G, lentiviruses were produced in 293T cells, the supernatant containing the viral particles was collected, the viruses were purified and concentrated by PEG, and then the viral titer was determined with HT1080 cells. A549 cells were transduced with lentiviruses with an MOI of 10 and the transduction efficiency was determined by GFP + cells using flow cytometry.
The results are shown in A in FIG. 4 and A in FIG. 5 (FIG. 4A: interference results detected after transfection of A549 cells by interfering with NUDT21 lentivirus, and FIG. 5A: high expression results related to stem detection after transfection of A549 cells by interfering with NUDT21 and high expression NUDT21 lentivirus).
4. Biological analysis after lentivirus infection of A549 cells
4.1. Cell proliferation assay
A549 cells with 5000/well density are paved in a 96-well plate, 10 mu L/well CCK8 is added after 24h, 48h, 72h and 96h respectively, and the proliferation condition of the A549 cells is measured after 3h (Table 2), and the result is shown as B in figure 4, and the proliferation capacity of the A549 cells after NUDT21 interference is stronger.
TABLE 2A 549 cell proliferation
4.2. Apoptosis assay
Apoptosis was determined by annexin V-APC staining. Exponentially growing a549 cells were seeded into 6-well plates at a density of 2.0 × 105 cells/well. After the cells were attached, they were infected with PLKO.1-shNUDT21 or PLKO.1-shScramble at 10-fold multiplicity of infection (MOI). After 48h, cells were harvested, labeled with APC-conjugated annexin-V and PI (sungnebiotech co., ltd., Tianjin, China) and analyzed by flow cytometry on a FACSCalibur (BD Bioscience, San Jose, CA, USA) (results are shown in table 3) as shown by C in fig. 4, which inhibits apoptosis after a549 cells interfere with NUDT 21.
TABLE 3 apoptosis test results
4.3. Cell clone formation assay
A549 cells were transduced with PLKO.1-shNUDT21 or PLKO.1-shScramble. Add 500 cells per well in 24-well plates, put at 37 ℃ and 5% CO2After one week of incubation in a humidified incubator of (2), the number of colonies formed was counted using an inverted microscope (CON averaged 33.7, Sh-NUDT21 averaged 63), and as shown in D in fig. 4, a549 cells interfered with NUDT21 to promote clonogenic.
5.Western-Blotting
The antibodies used were rabbit anti-human NUDT21 monoclonal antibody (Abcam, Cambridge, MA, USA), rabbit anti-human HIF-1 alpha, HIF-2 alpha monoclonal antibody (Cell Signaling Technology, CST, Danvers, MA, USA), rabbit anti-human GLS1 monoclonal antibody (Abcam). Protein extracts under various conditions were prepared from a549 cells.
Proteins were separated on a 12% SDS-PAGE gel and transferred to nitrocellulose membranes. The membrane was then blocked with 5% skim milk in PBS for 2h, labeled with primary antibody, and labeled with horseradish peroxidase-conjugated secondary antibody (zhongshan gold bridge biotechnology, beijing, china). Finally, detection of the antibodies was performed using chemiluminescence solution (Pirec Biotechnology, IL, USA). The expression levels were normalized to the relative glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Cell Signaling Technology, CST), and the results are shown as BCDE in fig. 2, E in fig. 3, and a in fig. 4.
6.Transwell assay
5.0 × 104A549 cells of (1) were added to 24-well plates at 21% O2、37℃、5％CO2And 1% of O2、37℃、5％CO2After 15h incubation in the incubator, the migratory capacity of the treated a549 cells was examined by transwell.
The transwell insert was added to the well by merging the bottom of the insert into the medium in the lower compartment. Then, cells were seeded into transwell inserts. After 15h incubation, the migrated cells were fixed, stained and counted (CON (control group) 52, 47, 59, respectively, and Hypoxia (Hypoxia experimental group) 83, 95, 91, respectively), resulting in a stronger migration of a549 in a hypoxic environment as shown in E in fig. 4.
7. Immunohistochemical staining and obtaining database information relating NUDT21 to survival
Small cell lung cancer tumor puncture and marginal tissues are embedded and fixed by paraffin to be made into slices, and the expression level of the slices is further detected by antibody markers (the experiment accords with ethical examination method (trial) of biomedical research of related people in Ministry of health and related regulations on biological human body tests announced by Helsinki, and is agreed and researched by medical ethical committee of national hospitals of Qinghai province).
Tissue section scanner model panoramic MIDI, manufacturer: and 3D HISTECH, the tissue slices are arranged on the machine, the slices move gradually under the lens of the scanner, imaging is carried out while moving, all tissue information on the tissue slices is scanned and imaged, and the imaged tissue slices are opened by Pannoramic viewer software and can be observed after being amplified by 1-400 times. The Quant center is analysis software matched with the Pannoramic viewer, enters densito Quant software in the Quant center after scanning is finished, automatically identifies and sets all dark brown on a tissue section as strong positive, brown yellow as medium positive, light yellow as weak positive and blue cell nucleus as negative. And then identifying and analyzing the areas (unit: pixel) of strong positive, medium positive, weak positive and negative, the percentage of positive, and finally grading H-score, namely the abbreviation of histochemistry score, which is a histological grading method for processing immunohistochemical results, and converting the number of positive cells in each section and the dyeing intensity thereof into corresponding numerical values to achieve the purpose of semi-quantifying tissue dyeing.
H-SCORE ∑ (PI × I) ((percentage of cells of week intensity × 1) + (percentage of cells of moderate intensity × 2) + percentage of cells of stronginity × 3), where PI represents the number of positive cells as a percentage of the number of all cells in the slice; i represents the intensity of staining, and the results are shown in fig. 1a and B, with NUDT21 being underexpressed in SCLC samples.
Cancer genomic map (TCGA) NUDT21 and survival information for lung cancer patients were downloaded from the cbioportal database (http:// www.cbioportal.org /). The data set includes the number of lung cancer patient samples and provides clinical survival information and microarray data. The kaplan-meier plot was used to show the effect of changes in NUDT21 expression on patient survival, with the results shown in fig. 1C, where median survival in patients increased from 46.881678009 months to 78.61 months.
8. Xenograft model
To establish a mouse tumor model, the Beijing military medical institute radiology institute has ethical reviewed and numbered (review number: IACUC-AMMS-13-2017-027) the mice were randomly divided into 4 groups (each group n is 6), and silent NUDT21(Sh-NUDT21), high expression NUDT21(H-NUDT21) and respective control groups (Sh-CON, H-CON) lung cancer A549 cells (A in FIG. 5) were inoculated subcutaneously into the right abdomen of 6-week-old BALB/c-nu mice, each mouse was injected with 2 × 106Cells were suspended in 100 μ L sterile Phosphate Buffered Saline (PBS) tumor growth was monitored by measuring tumor width (W) and length (L) at different experimental time points using calipers (B in fig. 5, interfering with faster growth of NUDT21)2(E in FIG. 5). Simultaneously, the electronic weighing instrument is used for weighing the weight of the mouse at different experimental time points to monitor the weight change(C in FIG. 5). At the end of the experiment, all mice were euthanized, tumors excised, weighed, interfered with NUDT21 groups weighing more than the rest (D in fig. 5) and saved for further immunohistochemical analysis to detect expression of NUDT21 in tumors of the corresponding group, consistent with transduced interference or high expression of NUDT21 lentivirus (F in fig. 5).
Wherein the body weight changes of the mice are shown in Table 4,
TABLE 4 mouse weight changes
The growth process of the mouse tumor is shown in table 5,
TABLE 5 mouse tumor growth Process
The body weights of the tumors of the mice are shown in table 6,
TABLE 6 mouse tumor weights
9. Expressed protein structural map of NUDT21 gene
Information on the structure of the CFI m (FIG. 6 (right)) composed of the structure of the NUDT21(CPSF5) (FIG. 6 (left)) and the structure of the CFI m (FIG. 6 (right)) composed of the NUDT21 is obtained from the National center for biotechnology information database (https:// www.ncbi.nlm.nih.gov/structure)；Among them is NUDT21And the detailed structure of cfim.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> military medical research institute of military science institute of people's liberation force of China
QINGHAI PROVINCIAL PEOPLE'S Hospital
Application of <120> NUDT21 gene in preparation of lung cancer treatment drug
<160>21
<170>SIPOSequenceListing 1.0
<210>1
<211>813
<212>DNA
<213>Homo sapiens
<400>1
gttcgttgca acaaattgat gagcaatgct tttttataat gccaactttg tacaaaaaag 60
ttggcatgtc tgtggtaccg cccaatcgct cgcagaccgg ctggccccgg ggggtcactc 120
agttcggcaa caagtacatc cagcagacga agcccctcac cctggagcgc accatcaacc 180
tgtaccctct taccaattat acttttggta caaaagagcc cctctacgag aaggacagct 240
ctgttgcagc cagatttcag cgcatgaggg aagaatttga taaaattgga atgaggagga 300
ctgtagaagg ggttctgatt gtacatgagc accggctacc ccatgtgtta ctgctgcagc 360
tgggaacaac tttcttcaaa ctacctggtg gtgaacttaa cccaggagaa gatgaagttg 420
aaggactaaa acgcttaatg acagagatac tgggtcgtca ggatggagtt ttgcaagact 480
gggtcattga cgattgcatt ggtaactggt ggagaccaaa ttttgaacct cctcagtatc 540
catatattcc tgcacatatt acaaagccta aggaacataa gaagttgttt ctggttcagc 600
ttcaagaaaa agccttgttt gcagtcccta aaaattacaa gctggtagct gcaccattgt 660
ttgaattgta tgacaatgca ccaggatatg gacccatcat ttctagtctc cctcagctgt 720
tgagcaggtt caattttatt tacaaatgcc caactttctt gtacaaagtt ggcattataa 780
gaaagcattg cttatcaatt tgttgcaacg aac 813
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
catcctcacc ctgaagtacc c 21
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
agcctggata gcaacgtaca tg 22
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gggtcgtcag gatggagttt t 21
<210>5
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
agggactgca aacaaggctt t 21
<210>6
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gctcatcctc ctccttcacc 20
<210>7
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
<210>8
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
<210>9
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
aagggaaagg gactgagc 18
<210>10
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
gaaaccacct atgacctgc 19
<210>11
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ctgtttgttg aagggagaa 19
<210>12
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
tgaaaacgag tccgaagcc 19
<210>13
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
gtggctgact tgaggttga 19
<210>14
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
caacatcaga tggtgtcatg ctagac 26
<210>15
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
aacagacaca ccccacaaat cgggactg 28
<210>16
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ttggactatg aaagtctcca acaagaac 28
<210>17
<211>34
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
ccattctata tactacagtt gtagagatgt cctc34
<210>18
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
actggagatg tgtctgcact tcgaag 26
<210>19
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
ccaaagtgca gtgcttcatc catgggagtg 30
<210>20
<211>58
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
ccggcagtgt agaataaatg tggtactcga gtaccacatt tattctacac tgtttttg 58
<210>21
<211>58
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
caaaaacagt gtagaataaa tgtggtactc gagtaccaca tttattctac actgccgg 58
Claims (2)
- The application of the NUDT21 gene in preparing the medicine for treating lung cancer is characterized in that the nucleotide sequence of the NUDT21 gene is shown as SEQ ID No. 1.
- 2. The use of claim 1, wherein the NUDT21 affects the growth of lung cancer cells A549 including small cell lung cancer by modulating GLS1 alternative splicing in hypoxic microenvironments.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010204995.9A CN111518899A (en) | 2020-03-23 | 2020-03-23 | Application of NUDT21 gene in preparation of lung cancer treatment drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010204995.9A CN111518899A (en) | 2020-03-23 | 2020-03-23 | Application of NUDT21 gene in preparation of lung cancer treatment drug |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111518899A true CN111518899A (en) | 2020-08-11 |
Family
ID=71901089
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010204995.9A Pending CN111518899A (en) | 2020-03-23 | 2020-03-23 | Application of NUDT21 gene in preparation of lung cancer treatment drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111518899A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113322319A (en) * | 2021-05-26 | 2021-08-31 | 中国人民解放军军事科学院军事医学研究院 | Application of nucleoside hydrolase 21 in preparation of reagent for detecting and/or treating multiple myeloma |
| CN114152752A (en) * | 2021-08-12 | 2022-03-08 | 南京市浦口医院 | Application of CFIm25 in detecting or treating atherosclerosis |
-
2020
- 2020-03-23 CN CN202010204995.9A patent/CN111518899A/en active Pending
Non-Patent Citations (7)
| Title |
|---|
| CHIONISO P. MASAMHA1等: "《CFIm25 links alternative polyadenylation to glioblastoma tumour suppression》", 《NATURE》 * |
| JINGJING HUANG等: "《Suppression of cleavage factor Im 25 promotes the proliferation of lung cancer cells through alternative polyadenylation》", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| MING XIONG等: "《NUDT21 inhibits bladder cancer progression through ANXA2 and LIMK2 by alternative polyadenylation》", 《THERANOSTICS》 * |
| ROXANA S.REDIS等: "《Allele-Specific Reprogramming of Cancer Metabolism by the Long Non-coding RNA CCAT2》", 《MOLECULAR CELL》 * |
| YANG,X.,等: "《Synthetic construct Homo sapiens clone ccsbBroadEn_07735 NUDT21 gene, encodes complete protein》", 《GENBANK: KJ898341.1》 * |
| YUNWU WANG 等: "《CFIm25 inhibits hepatocellular carcinoma metastasis by suppressing the p38 and JNK/c-Jun signaling pathways》", 《ONCOTARGET》 * |
| 黎兵华等: "谷氨酰胺酶与肿瘤的关系研究进展", 《转化医学电子杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113322319A (en) * | 2021-05-26 | 2021-08-31 | 中国人民解放军军事科学院军事医学研究院 | Application of nucleoside hydrolase 21 in preparation of reagent for detecting and/or treating multiple myeloma |
| CN114152752A (en) * | 2021-08-12 | 2022-03-08 | 南京市浦口医院 | Application of CFIm25 in detecting or treating atherosclerosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Minata et al. | Phenotypic plasticity of invasive edge glioma stem-like cells in response to ionizing radiation | |
| Yang et al. | RETRACTED: Exosome-derived miR-130a activates angiogenesis in gastric cancer by targeting C-MYB in vascular endothelial cells | |
| Li et al. | Klotho suppresses growth and invasion of colon cancer cells through inhibition of IGF1R-mediated PI3K/AKT pathway | |
| CN111424090B (en) | Application of SGCE gene as triple negative breast cancer marker | |
| CN101314793A (en) | Method for detecting ovarian cancer and method for suppresssing the same | |
| CN115029443B (en) | Colorectal cancer prognosis marker EIF3F and application thereof | |
| CN111518899A (en) | Application of NUDT21 gene in preparation of lung cancer treatment drug | |
| Hwang et al. | Insulin-like growth factor-II mRNA binding protein-3 and podoplanin expression are associated with bone invasion and prognosis in oral squamous cell carcinoma | |
| Long et al. | Extracellular matrix protein 1 regulates colorectal cancer cell proliferative, migratory, invasive and epithelial-mesenchymal transition activities through the PI3K/AKT/GSK3β/snail signaling axis | |
| Yuan et al. | MAT2B promotes proliferation and inhibits apoptosis in osteosarcoma by targeting epidermal growth factor receptor and proliferating cell nuclear antigen | |
| CN112114143B (en) | Application of hepatoma diagnosis and cancer-causing kinase treatment marker | |
| CN111096962A (en) | Application of fatty acid oxidation inhibitor in preparation of medicine for treating colorectal cancer | |
| CN107460237B (en) | Application of HES6 as molecular target in treating chronic granulocytic leukemia | |
| Takeshita et al. | FOXM1-mediated regulation of reactive oxygen species and radioresistance in oral squamous cell carcinoma cells | |
| CN111826354B (en) | NK cell and application thereof in tumor treatment | |
| CN114949226A (en) | Application of B7-H3 gene inhibitor in preparation of medicines for treating non-small cell lung cancer | |
| CN112899371A (en) | Application of hsa _ circ _0000231 in treatment of tongue squamous cell carcinoma | |
| CN111560349A (en) | Method for preventing liver cancer caused by hepatitis B virus | |
| CN115287359B (en) | Application of MCOLN2 in colorectal cancer | |
| CN116637123B (en) | Application of reagent for knocking down or down expression of C15orf39 gene in preparation of medicines for treating gastric cancer | |
| CN105925580B (en) | Inhibit the Smal linterference ribonucleic acid sequence of people PARD6A gene expression and its purposes of ovarian cancer resistance proliferation and transfer | |
| CN112280859B (en) | Breast cancer marker and application thereof | |
| Ai | circ_0008792 Prevents Against the Deterioration of Thyroid Cancer Through Regulating IGFBP5 | |
| US20240093194A1 (en) | Mir-7-5p mimic for inhibiting migration and invasion of breast cancer, screening method and application thereof | |
| EP4006166A2 (en) | Tumour marker aquaporin 2 protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 810007 No.2 Gonghe Road, Chengdong District, Xining City, Qinghai Province Applicant after: QINGHAI PROVINCIAL PEOPLE'S Hospital Applicant after: ACADEMY OF MILITARY MEDICAL SCIENCES Address before: 27 Taiping Road, Haidian District, Beijing Applicant before: ACADEMY OF MILITARY MEDICAL SCIENCES Applicant before: QINGHAI PROVINCIAL PEOPLE'S Hospital |
|
| CB02 | Change of applicant information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Qinqin Inventor after: Wang Lisheng Inventor after: Xiao Fengjun Inventor after: Gao Chuancheng Inventor after: Wu Zuze Inventor before: Wang Lisheng Inventor before: Xiao Fengjun Inventor before: Gao Chuancheng Inventor before: Xu Qinqin Inventor before: Wu Zuze |
|
| CB03 | Change of inventor or designer information |