CN111518853B - Method for synthesizing D-psicose by whole cell transformation - Google Patents

Method for synthesizing D-psicose by whole cell transformation Download PDF

Info

Publication number
CN111518853B
CN111518853B CN202010381488.2A CN202010381488A CN111518853B CN 111518853 B CN111518853 B CN 111518853B CN 202010381488 A CN202010381488 A CN 202010381488A CN 111518853 B CN111518853 B CN 111518853B
Authority
CN
China
Prior art keywords
escherichia coli
psicose
rhab
dpe
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010381488.2A
Other languages
Chinese (zh)
Other versions
CN111518853A (en
Inventor
朱理平
高晓冬
李子杰
温俊婷
冯林雪
陈洲
陈科材
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dongtai Haorui Biological Technology Co ltd
Original Assignee
Dongtai Haorui Biological Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dongtai Haorui Biological Technology Co ltd filed Critical Dongtai Haorui Biological Technology Co ltd
Priority to CN202010381488.2A priority Critical patent/CN111518853B/en
Publication of CN111518853A publication Critical patent/CN111518853A/en
Application granted granted Critical
Publication of CN111518853B publication Critical patent/CN111518853B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1229—Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01005—Rhamnulokinase (2.7.1.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/04—Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C12Y207/04001—Polyphosphate kinase (2.7.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y501/00—Racemaces and epimerases (5.1)
    • C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)

Abstract

The invention relates to the technical field of biology, in particular to a method for synthesizing D-psicose by utilizing whole cell transformation, wherein a whole reaction system in the method comprises a substrate D-fructose, wet thalli after induction of recombinant escherichia coli, ATP and metal ions, the reaction system is heated after catalytic reaction, and acid phosphatase is added after cooling to obtain the D-psicose through dephosphorization reaction. The method can improve the yield of D-psicose.

Description

Method for synthesizing D-psicose by whole cell transformation
Technical Field
The invention relates to the technical field of biology, in particular to a method for synthesizing D-psicose by utilizing whole cell transformation.
Background
D-psicose (D-psicose) is a rare hexulose and is an isomer with D-fructose. Since D-psicose has remarkable effects in medical treatment, health care, etc., it was formally listed in GRAS (recognized safety, GENERALLY RECOGNIZED AS SAFE) foods in 2011. With the continuous advancement of research on rare sugars, D-psicose has received extensive attention due to its unique functional properties. In the aspect of food application, the sweetness of the sweet potato starch is about 70 percent of that of the sucrose, but the sweet potato starch is low in energy, has the characteristics of low absorption, low calorie and the like, and can be used as an edible substitute of the sucrose. In addition, the D-psicose has the functions of inhibiting obesity, reducing blood sugar, reducing blood fat and the like, and is very suitable for diabetics and obese people, so that the D-psicose has remarkable effects in medical treatment and health care.
At present, the main synthesis methods of D-psicose include chemical synthesis and biological synthesis, wherein the chemical synthesis method is ring-closing conversion (ring-closing metathesis, RCM) synthesis method, firstly, synthesizing alpha, beta-hexabasic unsaturated lactone by the RCM method, then, further modifying and synthesizing rare sugar by a series of reactions such as reduction, acylation and the like. However, the method has the disadvantages of complicated steps, more byproducts and low yield. Northrup et al propose the synthesis of sugars using a two-step process of selective aldol condensation. This process appears to be simple to operate, but it is difficult to obtain highly enantioselective intermediates with low yields. Biosynthetic methods mainly use isomerase enzymes to catalyze the interconversion between a variety of sugars. Compared with chemical synthesis, the biological synthesis method has more prominent advantages: the method has the advantages of low cost of substrate, few byproducts, high stereoselectivity and mild reaction conditions, is favorable for purifying the target product, and is more suitable for industrial production. However, the reactions catalyzed by the isomerase are mostly reversible processes (the conversion rate of the isomerase is generally only about 30%), the yield of the product is low, meanwhile, a mixture of various sugars is often obtained after the reaction is finished, the physicochemical properties are very similar, and the product is difficult to distinguish completely. Therefore, how to increase the conversion of the reaction remains a significant challenge.
Disclosure of Invention
The technical problems to be solved by the invention are as follows: aiming at the defects existing in the prior art, a method for synthesizing D-psicose by utilizing whole cell transformation is provided, and the yield of the D-psicose can be improved by utilizing the method.
In order to solve the technical problems, the technical scheme of the invention is as follows:
A method for synthesizing D-psicose by utilizing whole cell transformation, wherein the whole reaction system comprises a substrate D-fructose, wet thalli after induction of recombinant escherichia coli, ATP and metal ions, the reaction system is heated after catalytic reaction, and acid phosphatase is added after cooling to obtain the D-psicose through dephosphorylation reaction.
As an improved technical scheme, the pH value of the whole reaction system is 7-10 during the catalytic reaction, the reaction temperature is 20-60 ℃, the reaction time is 2-6h, and the metal ions are Mg 2+、Mn2+、Co2+ or Ca 2+; the reheating temperature after the catalytic reaction is controlled at 80-100 ℃, and the temperature after the cooling is controlled at 20-37 ℃.
As a preferable technical scheme, the pH value of the whole reaction system is 8.5 in the catalytic reaction, the reaction temperature is 37 ℃, and the metal ion is Mg 2+.
As an improved technical scheme, the recombinant escherichia coli is recombinant escherichia coli which simultaneously expresses L-rhamnose glucokinase and D-psicose-3-epimerase.
As an improved technical scheme, the construction method of the recombinant escherichia coli comprises the following steps: the L-rhaponticin glucokinase gene rhaB (kegg, no. B21_ 03739) derived from E.coli BL21 was ligated to the pCDFDuet-1 plasmid to give a recombinant plasmid pCDFDuet-rhaB; connecting D-psicose-3-epimerase gene dpe derived from clostridium H10 (Clostridium cellulolyticum H) to pET28a plasmid to obtain recombinant plasmid pET28a-dpe; then, pCDFDuet-rhaB and pET28a-dpe are transformed into escherichia coli Roseta (DE 3) together to obtain recombinant escherichia coli; or the single plasmid pCDFDuet-1 is used for simultaneously inserting rhaB and dpe genes to obtain a recombinant plasmid pCDFDuet-rhaB-dpe, and then the recombinant plasmid pCDFDuet-rhaB-dpe is transformed into escherichia coli Roseta (DE 3) to obtain recombinant escherichia coli.
As an improved technical scheme, the recombinant escherichia coli is cultured in an LB culture medium at 37 ℃, when the OD 600 is 0.6-1.0, IPTG with the final concentration of 0.1-1.0mM is added, induction is carried out for 5-20h at 16-37 ℃, and wet thalli are obtained after collection.
As an improved technical scheme, the recombinant escherichia coli is recombinant escherichia coli which simultaneously expresses L-rhamnose glucokinase, D-psicose-3-epimerase and polyphosphate kinase; when the recombinant escherichia coli is adopted, the whole reaction system also comprises sodium polyphosphate.
As an improved technical scheme, the construction method of the recombinant escherichia coli comprises the following steps: the L-rhamnose kinase gene rhaB derived from E.coli BL21 and the polyphosphate kinase gene ppk1 (kegg. Sup. Th. Er. B2501) derived from E.coli MG1655 were ligated to the pCDFDuet-1 plasmid to give a recombinant plasmid pCDFDuet-rhaB-ppk; d-psicose-3-epimerase gene dpe (GeneBank accession No. ACL 75304) derived from Clostridium H10 (Clostridium cellulolyticumH 10) was ligated to pET28a plasmid to obtain recombinant plasmid pET28a-dpe; then, pET28a-dpe and pCDFDuet-rhaB-ppk recombinant plasmid are co-transformed into Escherichia coli Roseta (DE 3) to obtain recombinant Escherichia coli.
As an improved technical scheme, the recombinant escherichia coli is cultured in LB culture medium at 37 ℃ until the OD600 is 0.6-1.0, 0.1-1.0mM IPTG is added, induction is carried out for 5-20h at 16-37 ℃, and wet thalli are obtained after collection.
After the technical scheme is adopted, the invention has the beneficial effects that:
(1) The invention directly adopts whole cells as the catalyst without purifying enzyme, reduces the consumption of ATP, reduces the production cost and is beneficial to industrial production; compared with the prior art, the single-enzyme conversion of D-psicose-3-epimerase is adopted, so that the conversion rate of D-psicose is greatly improved.
(2) According to the invention, D-fructose is taken as a substrate, ATP, metal ions and recombinant escherichia coli (which can simultaneously express L-rhamnose glucokinase and D-psicose-3-epimerase or can simultaneously express L-rhamnose glucokinase, D-psicose-3-epimerase and polyphosphate kinase) are added, induced wet thalli are subjected to catalytic reaction and then heated, and acid phosphatase is added to carry out dephosphorization reaction, so that the conversion rate of D-psicose can be greatly improved through the process; when recombinant escherichia coli (can express L-rhamnose glucokinase and D-psicose-3-epimerase simultaneously), the conversion rate of D-psicose can reach more than 83 percent and can reach 93 percent at most; when recombinant escherichia coli (can express L-rhamnose glucokinase, D-psicose-3-epimerase and polyphosphate kinase simultaneously), the conversion rate of D-psicose can reach more than 82 percent, and can reach 94 percent at most, and the consumption of ATP is reduced.
Drawings
FIG. 1 is an HPLC plot of the reaction product under the conditions of example 1;
FIG. 2 is an HPLC plot of the reaction product under the conditions of example 8.
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Example 1
A method for synthesizing D-psicose by utilizing whole cell transformation comprises the steps of taking D-fructose as a substrate (the concentration of fructose is 10 g/L), adding ATP (the adding amount is 50 mM), metal ions (5 mM of Mg 2+) and induced wet thalli (the concentration of the wet thalli is 20 g/L) of recombinant escherichia coli, regulating the pH to 8.5, controlling the reaction temperature to 37 ℃, carrying out a catalytic reaction for 6 hours (wherein the whole reaction system is 1L), heating the reaction system to 100 ℃ after the reaction is finished, regulating the pH to about 5.0, adding an Acid Phosphatase (AP) to a shaking table at 30 ℃ for overnight to remove phosphate groups, regulating the pH to 7.0 by NaOH, heating at 100 ℃ to terminate the reaction, centrifuging at a high speed for 10min, and collecting supernatant to obtain the D-psicose.
Wherein the recombinant escherichia coli is recombinant escherichia coli which simultaneously expresses L-rhamnose glucokinase and D-psicose-3-epimerase; (Bacillus subtilis or Corynebacterium glutamicum may also be selected for expression of L-rhamnose glucokinase and D-psicose-3-epimerase in the present invention;)
Preparation of wet bacterial cells:
1) Construction of recombinant plasmid pET28 a-dpe: the dpe gene fragment (GeneBank accession No. ACL 75134) derived from Clostridium H10 (Clostridium cellulolyticum H) was used as a template, and dpe-F1: GCGCGGATCCATGAAGCACGGTATCTATTA (BAMH I) is the upstream primer, dpe-R1: GCGCAAGCTTTTAGGAGTGTTTGTGACATTCTA (HIND III) is a downstream primer for PCR amplification, restriction enzymes BamHI and Hind III are used for respectively carrying out double enzyme digestion on plasmid pET28a and amplified dpe gene fragment at 37 ℃, and then T4 ligase is used for connecting the digested dpe gene fragment with plasmid pET28a to obtain recombinant plasmid pET28a-dpe;
2) Construction of recombinant plasmid pCDFDuet-rhaB: coli BL21 was used as a template, rhaB-F: GCGCGGATCCAATGACCTTTCGCAATTGTGTC (BAMH I) is an upstream primer, rhaB-R: GCGCAAGCTTTCATGCGCAAAGCTCCTTTGT (HIND III) is a downstream primer for PCR amplification, restriction enzymes BamHI and Hind III are used for respectively carrying out double digestion on plasmid pCDFDuet-1 and amplified rhaB gene fragment at 37 ℃, and then T4 ligase is used for connecting the digested rhaB gene fragment with plasmid pCDFDuet-1 to obtain recombinant plasmid pCDFDuet-rhaB;
3) Transformation of recombinant plasmid pET28a-dpe and recombinant plasmid pCDFDuet-rhaB: co-transforming pET28a-dpe and pCDFDuet-rhaB into escherichia coli Roseta (DE 3) to obtain recombinant escherichia coli;
The recombinant escherichia coli can be prepared by inserting the rhaB and dpe genes into the single plasmid pCDFDuet-1 to obtain a recombinant plasmid pCDFDuet-rhaB-dpe, and then transforming the recombinant plasmid pCDFDuet-rhaB-dpe into escherichia coli Roseta (DE 3).
The construction process of the recombinant plasmid pCDFDuet-rhaB-dpe is as follows: firstly, constructing a recombinant plasmid pCDFDuet-rhaB, wherein the method is as described above; the recombinant plasmid pCDFDuet-rhaB-dpe is obtained by inserting dpe genes on the basis of the recombinant plasmid pCDFDuet-rhaB, and the specific construction method is as follows:
The dpe gene fragment is used as a template, and an upstream primer dpe-F2 is designed: GCGCGGTACCATGAAGCACGGTATCTATTA (KPNI), downstream primer dpe-R2: GCGCCTCGAGTTAGGAGTGTTTGTGACATTCTA (XHO I), amplifying, carrying out double digestion on the plasmid pCDFDuet-rhaB and the amplified dpe by using restriction enzymes KpnI and Xho I, and connecting the digested dpe gene fragment with the plasmid pCDFDuet-rhaB by using T4 ligase to obtain a recombinant plasmid pCDFDuet-rhaB-dpe.
4) Inducible expression of recombinant proteins rhaB and DPE: culturing recombinant Escherichia coli in LB culture medium at 37deg.C until OD 600 is 0.6-1.0, adding 0.1-1.0mM IPTG, inducing at 16-37deg.C for 5-20 hr, and collecting wet thallus.
The whole reaction process of the reaction system comprises the following steps:
note that: DPE D-psicose-3-epimerase; rhaB: L-Rhamnus rhamnoides glucokinase.
The consumption of substrate D-fructose and the production of product D-psicose were detected by High Performance Liquid Chromatography (HPLC), and the conversion was calculated.
The HPLC detection conditions were as follows: chromatographic column WaterSugarPak (300 mm. Times.6.5 mm), mobile phase 500mg/L EDTA calcium salt, flow rate 0.5mL/min, column temperature 80 ℃, differential (RI) detector. Wherein the retention time of the D-fructose standard was 11.6min and the retention time of the D-psicose standard was 16.2min (FIG. 1).
Example 2
The reaction temperature of the whole reaction system in the catalytic reaction was 30℃and the rest of the operations were the same as those in example 1.
Example 3
The pH of the whole reaction system was 7.0 during the catalytic reaction, and the rest of the operations were the same as in example 1.
Example 4
The pH of the whole reaction system was 10.0 during the catalytic reaction, and the rest of the operations were the same as in example 1.
Example 5
The reaction temperature of the whole reaction system in the catalytic reaction was 50℃and the rest of the operations were the same as those in example 1.
Example 6
The substrate D-fructose (fructose concentration: 50 g/L) was added to the whole reaction system, ATP (addition amount: 250 mM), metal ions (5 mM of Mg 2+) and the recombinant E.coli were subjected to induction to obtain wet cells (wet cells concentration: 30 g/L), and the other operations were the same as those in the examples.
Example 7
The procedure of example 1 was repeated except that ATP (500 mM in addition) and metal ions (5 mM of Mg 2+) were added to the substrate D-fructose (fructose concentration: 100 g/L) in the whole reaction system to obtain a wet cell (wet cell concentration: 50 g/L) after induction of recombinant E.coli.
Example 8
A method for synthesizing D-psicose by utilizing whole cell transformation comprises the steps of taking D-fructose as a substrate (the concentration of fructose is 10 g/L), adding ATP (the adding amount is 10 mM), metal ions (5 mM of Mg 2+), 6mM of sodium polyphosphate and wet thalli (the concentration of the wet thalli is 20 g/L) of recombinant escherichia coli after induction, regulating the pH to 8.5, controlling the reaction temperature to 37 ℃, carrying out a catalytic reaction for 6 hours (wherein the whole reaction system is 1L), heating the reaction system to 100 ℃ after the reaction is finished, regulating the pH to about 5.0, adding an Acid Phosphatase (AP) to 30 ℃ overnight to remove phosphate groups, regulating the pH to 7.0 by NaOH, heating to terminate the reaction, centrifuging at a high speed for 10min, and collecting supernatant to obtain the D-psicose.
Wherein the recombinant escherichia coli is recombinant escherichia coli which simultaneously expresses L-rhamnose glucokinase, D-psicose-3-epimerase and polyphosphate kinase; (Bacillus subtilis or Corynebacterium glutamicum may also be selected for expression of L-rhamnose glucokinase and D-psicose-3-epimerase in the present invention)
Preparation of wet bacterial cells:
1) Construction of recombinant plasmid pET28a-dpe is described in example 1.
2) Construction of recombinant plasmid pCDFDuet-rhaB-pkk: the pkk gene was inserted on the basis of the recombinant plasmid pCDFDuet-rhaB constructed in example 1 to obtain the recombinant plasmid pCDFDuet-rhaB-pkk.
Coli MG1655 as template, ppk-F1: GCGCCATATGATGGGTCAGGAAAAGCTATA (NDE I) is the upstream primer, ppk-R1: GCGCCTCGAGTTATTCAGGTTGTTCGAGTG (XHO I) is a downstream primer, amplification is carried out, restriction enzymes NdeI and XhoI are used for carrying out double digestion on a plasmid pCDFDuet-rhaB and amplified ppk gene respectively, and then T4 ligase is used for connecting the digested ppk gene fragment with the plasmid pCDFDuet-rhaB to obtain a recombinant plasmid pCDFDuet-rhaB-pkk.
3) Transformation of recombinant plasmid pCDFDuet-rhaB-pkk and recombinant plasmid pET28 a-dpe: the pCDFDuet-rhaB-pkk and pET28a-dpe are transformed into escherichia coli Roseta (DE 3) together to obtain recombinant escherichia coli;
4) Inducible expression of recombinant proteins rhaB and DPE: culturing recombinant Escherichia coli in LB culture medium at 37deg.C until OD 600 is 0.6-1.0, adding 0.1-1.0mM IPTG, inducing at 16-37deg.C for 5-20 hr, and collecting wet thallus.
The whole reaction flow of the invention is as follows:
Note that: DPE D-psicose-3-epimerase; rhaB: l-rhamnose gum glucokinase; PPK: polyphosphate kinase; (Pi) n polyphosphate.
The consumption of substrate D-fructose and the production of product D-psicose were detected by High Performance Liquid Chromatography (HPLC), and the conversion was calculated.
The HPLC detection conditions were as follows: chromatographic column WaterSugarPak (300 mm. Times.6.5 mm), mobile phase 500mg/L EDTA calcium salt, flow rate 0.5mL/min, column temperature 80 ℃, differential (RI) detector. Wherein the retention time of the D-fructose standard was 11.6min and the retention time of the D-psicose standard was 16.2min (FIG. 2).
Example 9
The reaction temperature of the whole reaction system in the catalytic reaction was 30℃and the rest of the operations were the same as in example 8.
Example 10
The pH of the whole reaction system was 7.0 during the catalytic reaction, and the rest of the operations were the same as in example 8.
Example 11
The pH of the whole reaction system was 10.0 during the catalytic reaction, and the rest of the operations were the same as in example 8.
Example 12
The reaction temperature of the whole reaction system in the catalytic reaction was 50℃and the rest of the operations were the same as in example 8.
Example 13
The procedure of example 8 was repeated except that ATP (50 mM in addition) and metal ions (5 mM of Mg 2+) were added to the substrate D-fructose (concentration of fructose: 50 g/L) in the whole reaction system to obtain a wet cell (concentration of wet cell: 30 g/L) after induction of recombinant E.coli.
Example 14
The procedure of example 8 was repeated except that ATP (100 mM in addition) and metal ions (5 mM of Mg 2+) were added to the substrate D-fructose (100 g/L concentration of fructose) in the whole reaction system to obtain a wet cell (50 g/L concentration of wet cell) of recombinant E.coli after induction.
In order to better demonstrate that the conversion of D-psicose can be improved by the process of the present invention, 9 comparative examples were simultaneously made, wherein comparative example 1, comparative example 2, comparative example 3, comparative example 4 and comparative example 5 were respectively compared with reference to example 1, and comparative example 6, comparative example 7, comparative example 8 and comparative example 9 were respectively compared with reference to example 8.
Comparative example 1
The conventional operation method in the prior art adopts D-fructose as a substrate, and DPE single enzyme is used for preparing D-psicose.
Comparative example 2
The operation was the same as in example 1 except that the temperature of the reaction system was controlled at 18℃and the other operations were the same as in example 1.
Comparative example 3
The operation was the same as in example 1 except that the temperature of the reaction system was controlled at 65℃and the rest was the same.
Comparative example 4
The procedure was the same as in example 1 except that the pH of the reaction system was controlled to 4.5.
Comparative example 5
The procedure was the same as in example 1 except that the pH of the reaction system was controlled at 12.
Comparative example 6
The procedure was the same as in example 8 except that the temperature of the reaction system was controlled at 18℃and the rest was the same.
Comparative example 7
The procedure was the same as in example 8 except that the temperature of the reaction system was controlled at 65℃and the rest was the same.
Comparative example 8
The procedure was the same as in example 8 except that the pH of the reaction system was controlled to 4.5.
Comparative example 9
The procedure was the same as in example 8 except that the pH of the reaction system was controlled at 12.
The conversion of D-psicose in inventive examples 1 to 7 and comparative examples 1 to 5 are shown in Table 1 below, respectively. The conversion of D-psicose in examples 8 to 14 and comparative examples 6 to 9 according to the present invention are shown in Table 2 below, respectively.
TABLE 1
TABLE 2
As can be seen from the data in tables 1 and 2, the invention uses D-fructose as a substrate, ATP, metal ions and recombinant escherichia coli (which can simultaneously express L-rhamnose glucokinase and D-psicose-3-epimerase or can simultaneously express L-rhamnose glucokinase, D-psicose-3-epimerase and polyphosphate kinase) are added, wet thalli after induction are subjected to catalytic reaction and then are heated, and after cooling, acid phosphatase is added to carry out dephosphorization reaction, and the process can greatly improve the conversion rate of D-psicose compared with the process in the prior art (comparative example 1); in addition, comparing examples 1-7 in Table 1 with examples 8-14 in Table 2, it was found that the use of recombinant E.coli (capable of expressing L-rhamnose kinase, D-psicose-3-epimerase and polyphosphate kinase simultaneously) was selected to induce wet cells, and the consumption of ATP was reduced and the cost was saved under the condition that the conversion rate of D-psicose was similar.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

Claims (3)

1. A method for synthesizing D-psicose by whole cell transformation, which is characterized in that: the whole reaction system comprises a substrate D-fructose, wet thalli after induction of recombinant escherichia coli, ATP and metal ions, the reaction system is heated after catalytic reaction, and acid phosphatase is added after cooling to obtain D-psicose through dephosphorization reaction;
The pH value of the whole reaction system is 8.5 during the catalytic reaction, the reaction temperature is 37 ℃, the reaction time is 6h, and the metal ion is Mg 2+; the reheating temperature after the catalytic reaction is controlled at 100 ℃, and the temperature after the cooling is controlled at 30 ℃;
The recombinant escherichia coli is recombinant escherichia coli which simultaneously expresses L-rhamnose glucokinase and D-psicose-3-epimerase; the construction method of the recombinant escherichia coli comprises the following steps: ligating L-rhamnokinase gene rhaB to pET28a plasmid, wherein kegg of L-rhamnokinase gene rhaB is numbered as B21_03739, and recombinant plasmid pET28a-rhaB is obtained; ligating the D-psicose-3-epimerase gene dpe to the pCDFDuet-1 plasmid to give a recombinant plasmid pCDFDuet-dpe; then jointly transforming pET28a-rhaB and pCDFDuet-dpe into escherichia coli Roseta (DE 3) to obtain recombinant escherichia coli; or the single plasmid pCDFDuet-1 is used for simultaneously inserting rhaB and dpe genes to obtain a recombinant plasmid pCDFDuet-rhaB-dpe, and then the recombinant plasmid pCDFDuet-rhaB-dpe is transformed into escherichia coli Roseta (DE 3) to obtain recombinant escherichia coli;
Or the recombinant escherichia coli is recombinant escherichia coli which simultaneously expresses L-rhamnose glucokinase, D-psicose-3-epimerase and polyphosphate kinase; when the recombinant escherichia coli is adopted, the whole reaction system also comprises sodium polyphosphate, and the construction method of the recombinant escherichia coli comprises the following steps: ligating the L-rhamnokinase gene rhaB and the polyphosphate kinase gene ppk1 to the pCDFDuet-1 plasmid, wherein kegg of the polyphosphate kinase gene ppk1 is numbered b2501, to obtain a recombinant plasmid pCDFDuet-rhaB-ppk; connecting a D-psicose-3-epimerase gene dpe to a pET28a plasmid, wherein the GeneBank number of the D-psicose-3-epimerase gene dpe is ACL75304, and obtaining a recombinant plasmid pET28a-dpe; then, pET28a-dpe and pCDFDuet-rhaB-ppk recombinant plasmid are co-transformed into Escherichia coli Roseta (DE 3) to obtain recombinant Escherichia coli.
2. A method for synthesizing D-psicose by whole cell transformation according to claim 1, wherein: culturing the recombinant escherichia coli in an LB culture medium at 37 ℃, adding 0.1-1.0mM IPTG with final concentration when OD600 is 0.6-1.0, inducing for 5-20h at 16-37 ℃, and collecting to obtain wet thalli.
3. A method for synthesizing D-psicose by whole cell transformation according to claim 1, wherein: culturing the recombinant escherichia coli in an LB culture medium at 37 ℃ until the OD600 is 0.6-1.0, adding 0.1-1.0 mM IPTG with the final concentration, inducing for 5-20h at 16-37 ℃, and collecting the wet thalli.
CN202010381488.2A 2020-05-08 2020-05-08 Method for synthesizing D-psicose by whole cell transformation Active CN111518853B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010381488.2A CN111518853B (en) 2020-05-08 2020-05-08 Method for synthesizing D-psicose by whole cell transformation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010381488.2A CN111518853B (en) 2020-05-08 2020-05-08 Method for synthesizing D-psicose by whole cell transformation

Publications (2)

Publication Number Publication Date
CN111518853A CN111518853A (en) 2020-08-11
CN111518853B true CN111518853B (en) 2024-04-30

Family

ID=71912471

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010381488.2A Active CN111518853B (en) 2020-05-08 2020-05-08 Method for synthesizing D-psicose by whole cell transformation

Country Status (1)

Country Link
CN (1) CN111518853B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114350727B (en) * 2022-01-18 2023-10-03 湖南成大生物科技有限公司 Method for synthesizing D-psicose by combining phosphorylation and ATP regeneration system

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106282211A (en) * 2016-09-13 2017-01-04 江南大学 A kind of method of recombination bacillus coli resting cell synthesis D psicose
CN110079488A (en) * 2018-01-25 2019-08-02 中国科学院天津工业生物技术研究所 A kind of engineered strain producing psicose, construction method and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106282211A (en) * 2016-09-13 2017-01-04 江南大学 A kind of method of recombination bacillus coli resting cell synthesis D psicose
CN110079488A (en) * 2018-01-25 2019-08-02 中国科学院天津工业生物技术研究所 A kind of engineered strain producing psicose, construction method and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Xiao, Q.等. High Conversion of D-Fructose into D-Allulose by Enzymes Coupling with an ATP Regeneration System. Mol Biotechnol .第61卷摘要，材料和方法，结果，讨论部分. *

Also Published As

Publication number Publication date
CN111518853A (en) 2020-08-11

Similar Documents

Publication Publication Date Title
RU2732228C1 (en) Novel promoter and method of producing purine nucleotides using same
CN107267578B (en) Method for producing N-acetyl-D-glucosamine and/or D-glucosamine salt by microbial fermentation
EP2100967B1 (en) Method for producing lacto-n-biose i or galacto-n-biose
CN114350727B (en) Method for synthesizing D-psicose by combining phosphorylation and ATP regeneration system
TWI704227B (en) A composition for producing tagatose and methods for producing tagatose using the same
CN111518853B (en) Method for synthesizing D-psicose by whole cell transformation
CN112359082A (en) Preparation method of nicotinamide mononucleotide
CN111944865A (en) Application of alpha-L-rhamnosidase from bacteria in efficient production of hesperetin-7-O-glucoside
CN102827851B (en) Ketoreductase gene and application of ketoreductase gene
CN113755413A (en) Recombinant microorganism producing beta-nicotinamide mononucleotide and method for producing NMN (N-methyl-N) by using same
CN102827853B (en) Halogenohydrin dehalogenation enzyme gene mutant and application thereof
CN113755411B (en) Recombinant microorganism for high-yield of beta-nicotinamide mononucleotide and method for producing beta-nicotinamide mononucleotide by recombinant microorganism
CN114921392B (en) Method for efficiently co-producing gluconic acid and allitol
CN114164161B (en) Double-enzyme co-expression strain for producing neohesperidin and construction method and application thereof
CN114591938B (en) Carboxylase mutant and preparation method and application thereof
CN114480461B (en) Recombinant microorganism for producing beta-nicotinamide mononucleotide and construction method and application thereof
CN113528562B (en) Recombinant microorganism for producing beta-nicotinamide ribose and construction method and application thereof
CN113755415B (en) Novel recombinant microorganism with NMN synthesis path and production method thereof
CN114107143A (en) Method for producing 5' -cytidylic acid
CN116254279B (en) Method for catalyzing xylitol to biosynthesize L-xylose by using double-enzyme cascade recombinant escherichia coli
CN114214376B (en) Method for synthesizing L-fructose by whole cell transformation
CN117106680B (en) Recombinant microorganism and method for producing cytosine
CN111607548B (en) Recombinant escherichia coli for producing mannan and application thereof
CN108823137B (en) Method for improving abamectin yield and production strain
CN116179459A (en) Multienzyme synergistic expression recombinant genetic engineering bacterium and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant