CN111518851A - Continuous preparation of immobilized enzyme14/15N]Method for producing L-citrulline - Google Patents
Continuous preparation of immobilized enzyme14/15N]Method for producing L-citrulline Download PDFInfo
- Publication number
- CN111518851A CN111518851A CN202010327490.1A CN202010327490A CN111518851A CN 111518851 A CN111518851 A CN 111518851A CN 202010327490 A CN202010327490 A CN 202010327490A CN 111518851 A CN111518851 A CN 111518851A
- Authority
- CN
- China
- Prior art keywords
- cys
- gly
- ala
- thr
- cipa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/10—Citrulline; Arginine; Ornithine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
Abstract
The application discloses a continuous preparation of immobilized enzyme14/ 15N]A method of-L-citrulline, belonging to the technical field of enzymology and enzyme engineering. The method is that the fusion protein containing the immobilized enzyme is suspended in a packed bed reactor; then will comprise14/15N]The solution of-L-arginine flows through a packed bed reactor at the flow rate of 0.3-0.5BV/h for reaction at the temperature of 20-55 ℃, and the reaction solution is separated and purified to obtain the [14/15N]-L-citrulline. The invention adopts the technical conception that the cipA immobilized fusion protein is used as a carrier to fix arginine deiminase arc on the inclusion body protein cipA, and the inclusion body protein cipA-arc with catalytic activity, namely the cipA-arc fusion protein, is generated. The application provides an immobilized cipA-arginine deiminase cipA-arc fusion protein with catalytic activityWhite, and can continuously react for more than 560 hours; simultaneously obtaining the product with isotope labeling14/15N]The L-citrulline provides an effective way for diagnosing and treating prostate diseases, cardiovascular diseases and the like.
Description
Technical Field
The application relates to a method for producing high-purity [ alpha ]14/15N]A method of decomposing (E) -L-citrulline, particularly a method of decomposing (E) by using a recombinant arginine deiminase14/15N]Production of high-purity [ alpha ], [ alpha ] -L-arginine14/15N]A method of-L-citrulline, belonging to the technical field of enzymology and enzyme engineering.
Background
L-citrulline (L-citrulline) is a specific amino acid. Participate in various metabolic processes in vivo, such as free radical removal, foreign body rejection effect indicators, vasodilation, blood pressure stabilization, rheumatoid arthritis diagnosis, oxidation resistance and the like, prevent prostate diseases, improve sexual functions, resist aging, enhance immunity and the like, and have very wide application prospects.
The method for producing L-citrulline comprises the following steps: chemical, fermentation, enzymatic methods. The chemical method is to hydrolyze L-arginine under alkaline condition to obtain L-citrulline, the control of the hydrolysis process is difficult, the product contains optical antipode D-citrulline, the product quality is influenced, and a large amount of waste water is generated in the production process to pollute the environment; the difficulty of the fermentation production is that the yield of the L-citrulline in unit volume is low, the operation process for extracting the L-citrulline from the fermentation liquor is complex, the yield is low, and the cost is high; the enzyme production refers to that under the action of arginine deiminase, L-arginine is converted into L-citrulline, and the method has the advantages of strong specificity and high product concentration, but the method also has the defect of low catalyst utilization rate, namely, thallus is prepared by re-fermentation after each secondary delivery, so that a large amount of raw materials are consumed, a large amount of wastewater is generated, and the environmental protection treatment cost is increased; and impurities (a large amount of bacteria, protein, various metal ions and other impurities remained in the fermentation liquor) brought into a reaction system by an enzyme catalyst, so that in the L-citrulline post-treatment process, the product is separated and purified by a series of process steps of removing bacteria, removing protein, separating and exchanging columns and the like, and the production cost is further increased.
The chemical method, the fermentation method or the enzymatic method for producing the L-citrulline have a plurality of defects, so that the production cost is high, and great difficulty is brought to practical popularization and application.
In order to overcome the problems, a solution of immobilized enzymes or cells is proposed, and the preparation methods of the immobilized enzymes or cells include two major types, namely physical methods and chemical methods. The physical methods include physical adsorption, entrapment and the like. The physical method for fixing the enzyme has the advantages that the enzyme does not participate in chemical reaction, the whole structure is kept unchanged, and the catalytic activity of the enzyme is well reserved. However, since the inclusion or semi-permeable membrane has a steric or steric hindrance, it is not suitable for some reactions. The chemical method includes a binding method and a crosslinking method. The combination between the chemical enzyme and the carrier is tight, the chemical enzyme is not easy to fall off, the stability is good, but the reaction condition is violent, the operation is complex, the control condition is harsh, and the activity loss is large.
Continuous preparation of L-citrulline [ J ] from Zhengpu (bright day, Zhang Qi.) in 2008 by immobilized pseudomonas cells in packed bed reactor]Food and biotechnology newspaper, 2008, 27 (5): 1673--1The operation is continuously carried out for 54d under the condition of (gram citrulline produced by each gram of cells per hour), but the fermentation production process of the thalli is complex, the time of immobilized cells is too long, the concentration of a substrate is low, the yield is not high, the immobilized cells are simple, but the problems of cell body breakage and release of hybrid protein and other organic substances in the thalli still exist, the difficulty of separation and purification of products in a reaction system is increased, the step of operation is also increased in cell immobilization, and the production cost is increased.
Disclosure of Invention
According to a first aspect of the present application, there is provided a continuous preparation of an immobilized enzyme14/15N]-L-citrulline, said method comprising the steps of:
(1) suspending the fusion protein containing the immobilized enzyme in a packed bed reactor;
(2) will comprise14/15N]The solution of the L-arginine flows through a packed bed reactor at the temperature of 20-55 ℃ and the flow rate of 0.3-0.5 BV/h.
Alternatively, the fusion protein comprising an immobilized enzyme in step (1) is 9000-12000U, preferably 10000U, and the fusion protein comprising an immobilized enzyme isThe step (2) comprises14/15N]In a solution of (E) -L-arginine14/15N]The concentration of the-L-arginine is 1.0-2.5 mol/L.
Optionally, the packed bed reactor in the step (1) is a glass column with a diameter-height ratio of 15-40 and a volume of 450-.
Optionally, the composition comprises14/15N]In a solution of (E) -L-arginine14/15N]The concentration of the-L-arginine is 1.0-2.5 mol/L.
Optionally, the fusion protein containing the immobilized enzyme in step (1) is inclusion body protein cipA-arc obtained by immobilizing arginine deiminase arc on inclusion body protein cipA by using cipA as a carrier, namely, the fusion protein of cipA-arc.
Alternatively, the cipA-arc fusion protein is prepared by:
(1) preparing corynebacterium glutamicum competent cells;
(2) transforming the corynebacterium glutamicum competent cells in the step (1) by adopting a recombinant plasmid pXMJ19-cipA-arc electric shock to obtain a recombinant strain;
(3) and (3) carrying out ultrasonic crushing and centrifugation on the recombinant bacteria obtained in the step (2) to obtain a recombinant bacteria whole cell through the induction expression of the genetic engineering bacteria, and obtaining a precipitate, namely the cipA-arc fusion protein.
Alternatively, the corynebacterium glutamicum competent cell is prepared by the following method:
culturing Corynebacterium glutamicum ATCC13032 in a LBG-containing solid culture medium, selecting a fresh strain, inoculating the fresh strain into an LBG liquid culture medium, culturing, transferring an activated bacterial liquid into the LBG culture medium according to the inoculum size of 0.8-1.5%, and continuously culturing until OD600 is 0.8-1.0; precooling and centrifuging the bacterial liquid by using an ice-water mixture, sucking out supernatant, adding glycerol, blowing and sucking until thalli are suspended, centrifuging again, sucking out supernatant, adding glycerol, blowing and sucking until thalli are suspended, and thus obtaining the corynebacterium glutamicum competent cells.
Preferably, the Corynebacterium glutamicum ATCC13032 is streaked on a plate containing LBG solid culture medium, cultured in an incubator, a fresh strain is picked up after thalli grow out and inoculated in an LBG liquid culture medium, and cultured for 12-24h in a shaking table with the temperature of 20-40 ℃ and the rotating speed of 150-300 r/min; transferring the activated bacteria liquid to LBG culture medium according to 1% inoculation amount, and culturing in a shaking table at the temperature of 20-40 ℃ and the rotating speed of 150-; placing the bacterial liquid in an ice water mixture for precooling for 15-20min, subpackaging the precooled bacterial liquid in a super clean bench into sterilized centrifuge tubes, centrifuging at 6000g at 4 ℃ for 30s, and placing ice water for 2 min; sucking out the supernatant in the centrifuge tube, adding precooled 10% glycerol into the centrifuge tube respectively, and slowly sucking the mixture by using a pipette gun until the bacteria are suspended; the suspension is centrifuged at 6000g for 30s at 4 ℃, the supernatant in the centrifuge tube is sucked out, precooled 10% glycerol is added into the centrifuge tube, and the suspension is slowly sucked by a pipette gun until the thalli are suspended.
Optionally, the temperature of the culture is 30 ℃; the rotating speed during the culture is 200 r/min.
Alternatively, the recombinant plasmid pXMJ19-cipA-arc shock-transformed competent cells were prepared by the following method:
uniformly mixing the corynebacterium glutamicum competent cells and the recombinant plasmid pXMJ19-cipA-arc, cooling on ice, and performing electric shock for 1-10ms under the same temperature condition with the voltage of 1-5 kV; adding an LBG liquid culture medium at room temperature, transferring the liquid culture medium into a centrifuge tube, carrying out shake culture, taking the obtained liquid, coating the liquid on a chloramphenicol-resistant plate, selecting a single colony to extract a plasmid, confirming the insertion of a target fragment through double enzyme digestion and PCR, and inoculating the obtained recombinant bacteria.
Taking the competent cells and the recombinant plasmid pXMJ19-cipA-arc as a preferable scheme, mixing uniformly, and cooling for 10min on ice; rapidly adding an ice-cold electric shock cup for electric shock, wherein the electric shock condition is that the voltage is 2-4kV, and the time is 3-7 ms; taking out the electric shock cup as soon as possible after the pulse is finished, adding the LBG liquid culture medium at room temperature, transferring the electric shock cup into a centrifuge tube, carrying out soft shaking culture for 2 hours, and coating the obtained liquid on a chloramphenicol resistant plate containing 20 mu g/mL; and selecting a single colony to extract a plasmid, and confirming the insertion of the target fragment by double enzyme digestion or PCR.
Optionally, the voltage of the electric shock is 2.5 kV; the shock time is 5 ms.
Optionally, the method for inducing expression of the genetically engineered bacteria is as follows:
inoculating the recombinant bacteria into an LBG culture medium containing chloramphenicol, adding isopropyl-beta-D-thiogalactoside when the OD600 value of the bacteria reaches 0.8-1.0 through shaking table culture, centrifugally collecting the whole cells of the recombinant bacteria after induction overnight, washing the bacteria with Tris-HCl buffer solution, then re-suspending in phosphate buffer solution, ultrasonically breaking the cells, then centrifuging again, and precipitating to obtain the cipA-arc fusion protein.
Preferably, the successfully identified recombinant bacteria are inoculated into an LBG culture medium containing chloramphenicol with the final concentration of 20 mu g/mL, the culture temperature is set to be 20-40 ℃, the rotating speed of a shaking table is 150-; and (3) centrifugally collecting recombinant bacterial cells at 4 ℃, washing the bacterial cells by using a buffer solution, then suspending the bacterial cells in another buffer solution, ultrasonically breaking the cells, then centrifugally collecting the cells at 4 ℃, and precipitating to obtain the cipA-arc fusion protein.
Optionally, the temperature of both the culturing and the inducing is 30 ℃; the rotating speed during the culture is 200 r/min; the rotating speed during induction is 180 r/min.
Optionally, the wash buffer is Tris-HCl; the other resuspended buffer is phosphate buffer;
preferably, the pH value of the Tris-HCl is 7.0;
preferably, the phosphate buffer has a pH of 6.5.
Optionally, the genetically engineered bacteria express arginine deiminase.
Optionally, the genetically engineered bacterium is constructed by the following method:
1) introducing a HindIII site into a cipA gene sequence at the end of DNA5 ', introducing a SalI site into the end of 3' to obtain a fragment with a gene sequence of SEQ ID NO.1, sequencing the synthesized fragment, performing double enzyme digestion on a target gene and an expression vector pXMJ19 by HindIII/SalI, recovering a digestion product through gel, connecting the target fragment and the vector, and transforming escherichia coli DH5 alpha competent cells by the connection product to obtain a positive transformant pXMJ 19-cipA;
2) introducing an arc gene sequence into an XhoI site at the end of DNA5 ', introducing a SacI site at the end of 3' to obtain a fragment with a gene sequence of SEQ ID NO.2, sequencing the synthesized fragment, performing double enzyme digestion on a target gene and an expression vector pXMJ19-cipA by using XhoI/SacI, recovering an enzyme digestion product through gel, connecting the target fragment and the vector, and transforming a Escherichia coli DH5 alpha competent cell by using the connection product to obtain a positive transformant pXMJ19-cipA-arc, namely the genetic engineering bacteria containing arginine deiminase.
The genetically engineered bacterium containing arginine deiminase is preserved as Corynebacterium glutamicum SUMHS-2020.01, and is classified and named as Corynebacterium glutamicum, and the strain is preserved in China general microbiological culture Collection center of China institute of microbiology, national academy of sciences, China, institute of microbiology, No.1, 3, of the south China area of the West Lu, No.1, of the Chaoyang district, in 2020, 1 month and 17 days, and the preservation number of the strain preservation center is CGMCC No. 19404.
The invention also provides a technical scheme for expressing the arginine deiminase in the genetic engineering bacteria containing the arginine deiminase.
Optionally, the composition comprises14/15N]The solution of L-arginine also comprises a buffered solution of ammonium acetate, a buffered solution of ammonium formate, an aqueous solution of ammonium chloride, an aqueous solution of ammonium bicarbonate or an aqueous solution.
Preferably, the composition comprises14/15N]The solution of L-arginine also comprises a buffer solution of ammonium acetate, ammonium formate, aqueous ammonium chloride or aqueous ammonium bicarbonate.
Optionally, the concentration of the ammonium acetate buffer solution is 0.2mol/L, and the pH is 6.0; the concentration of the ammonium formate buffer solution is 0.2mol/L, and the pH value is 6.0; the concentration of the ammonium chloride aqueous solution is 0.3mol/L, and the pH value is 4.5; the concentration of the ammonium bicarbonate aqueous solution is 0.3mol/L, and the pH value is 8.5; the pH of the aqueous solution was 7.5.
Optionally, the method further comprises14/15N]Separation and purification of L-citrulline.
Optionally, the separation and purification steps are as follows:
1) collecting reaction liquid flowing out of the packed bed reactor, removing buffer salt through nanofiltration, returning to a reaction system for recycling, and collecting a product concentrated solution;
2) vacuum concentrating, crystallizing and drying the reaction solution obtained in the step 1) to obtain white powdery solid with the purity of more than 99.5%14/15N]-L-citrulline.
In the present application, the "cipA gene sequence" refers To the sequence of the cipA gene reported by Kirsten Jung et al (Wang Y, Heermann R, JungK. CipA and CipB as scans folds To organic Proteins into crystals Inclusions [ J ]. ACS Synthetic Biology,2017,6,826 one 836).
In the present application, the term "arc gene sequence" refers to the arginine deiminase (arc) gene sequence reported by Kim et al (Kim J E, Jeong D W, Lee HJ. expression, Purification, and characterization of arc deiminase from Lactococcus lactis ssp. lactis ATCC 7962in Escherichia coli BL21[ J ]. protein expression and Purification,2007,53(1): 0-15).
In the present application, "pXMJ 19" refers to a vector carrying a gene expression protein in corynebacterium glutamicum.
The beneficial effects that this application can produce include:
1) the gene of the arginine deiminase is synthesized and cloned, a high-yield arginine deiminase engineering bacterium is constructed, and the arginine deiminase is expressed in corynebacterium glutamicum;
2) the application fixes the arginine deiminase on the inclusion body protein cipA to generate the inclusion body protein cipA-arc (namely the cipA-arc fusion protein) with catalytic activity, and the immobilization mode is simple and quick, low in cost, high in efficiency and convenient to use;
3) the immobilized cipA-arginine deiminase (cipA-arc) fusion protein with catalytic activity provided by the application can continuously react for more than 560 hours;
4) the inclusion body protein cipA-arc, arc-cipA immobilized fusion protein provided by the application can catalyze [ alpha ], [ alpha ] -alpha-amino acid14/15N]Conversion of (E) -L-arginine to (2)14/15N]The L-citrulline is prepared by a fixed bed reactor, has simple post-treatment, convenient product separation and purification, low cost and easy scale-up production, and is prepared by an enzyme method14/15N]-L-citrullineA new way is added to acid;
5) the isotopically labeled [ alpha ], [14/15N]The L-citrulline provides an effective way for diagnosing and treating prostate diseases, cardiovascular diseases and the like.
Detailed Description
The present application will be described in detail with reference to examples, but the present application is not limited to these examples.
Unless otherwise indicated, the materials in the examples of the present application were obtained from the discovery platform by purchase of plasmid pXMJ19 from Wuhan vast Ling Biotech, Inc.
Corynebacterium glutamicum ATCC13032 was purchased from the Collection of microorganisms of Guangdong province.
[14/15N]-L-citrulline assay method: the product [ 2 ] was measured by HPLC14/15N]L-citrulline, a chromatographic column C18, 5 μm, 250mm × 4.6.6 mm, a mobile phase of 5% methanol, a flow rate of 1mL/min, a detection wavelength of 290nm, and a column temperature of room temperature.
The enzyme activity of the cipA-arginine deiminase is defined as catalysis [ alpha ] per minute at 37 ℃ and pH6.014/15N]Conversion of the-L-arginine to 1. mu. mol of14/15N]The enzyme amount of L-citrulline is defined as one unit of enzyme activity ((1U).
Specific enzyme activity definition: the amount of enzyme activity per mg of protein (U/mg). Protein concentration was determined by the Bradford method.
According to an embodiment of the application, mainly include: 1) chemically synthesizing a target gene (cipA, arc); 2) continuously connecting the synthesized cipA and arc with a vector pXMG19 to construct an expression vector pXMJ 19-cipA-arc; 3) introducing pXMJ19-cipA-arc into Corynebacterium glutamicum ATCC13032 by electrotransformation; 4) inducing expression and separating inclusion body protein cipA-arc (namely, cipA-arc fusion protein); 5) the inclusion body protein cipA-arc is utilized to continuously catalyze the arginine synthesis in a packed bed reactor14/15N]-L-citrulline.
In the examples of the present application, [ 2 ]14/15N]The conversion of L-citrulline is calculated on the basis of carbon moles.
EXAMPLE 1 construction of arginine-containing deiminase Gene-engineered bacteria
1.1 Synthesis of coding region DNA optimized according to the codon preference of C.glutamicum by the cipA gene sequence reported by Kirsten Jung et al (2017). Chemical synthesis was performed by Suzhou Jinzhi Biotech. The cipA gene sequence is as follows:
ATGATCAACGACATGCACCCATCCCTGATCAAGGACAAGGACATGATGGACGACGTTATGCTGCGCTCCTGCAAGATCATCGCTATGAAGATCATGCCAGACAAGGTTATGCAGGTTATGGTTACCGTTCTGATGCTGGACGGCACCTCCGAGGAGATGCTGCTGAAGTGGAACCTGCTGGACAACCGCGGCATGGCTATCTACAAGGTTCTGATGGAGGCTCTGTGCGGCAAGAAGGACGTTAAGATCGGCACCGTTGGCAAGGTTGGCCCACTGGGCTGCGACTACATCAACTGCGTTGAGATCTCCATG
the synthesized gene sequence (SEQ ID NO.1) is introduced into a HindIII site at the end of DNA5 ', a SalI site at the end of 3', the synthesized fragment is subjected to sequencing, a target gene and an expression vector pXMJ19 (biowind) are subjected to double enzyme digestion by HindIII/SalI, after enzyme digestion products are recovered through gel, the target fragment and the vector are connected, the connection products are converted into escherichia coli DH5 alpha competent cells, and the obtained positive transformant is named as pXMJ19-cipA after successful identification.
1.2 Synthesis of coding region DNA optimized according to the codon preference of Corynebacterium glutamicum by the chemical synthesis of the arginine deiminase (arc) gene sequence reported by Kim et al (2007). Chemical synthesis was performed by Suzhou Jinzhi Biotech. The sequence of the arc gene is as follows:
ATGAACAACGGCATCAACGTTAACTCCGAGATCGGCAAGCTGAAGTCCGTTCTGCTGCACCGCCCAGGCGCTGAGGTTGAGAACATCACCCCAGACACCATGAAGCAGCTGCTGTTCGACGACATCCCATACCTGAAGATCGCTCAGAAGGAGCACGACTTCTTCGCTCAGACCCTGCGCGACAACGGCGCTGAGACCGTTTACATCGAGAACCTGGCTACCGAGGTTTTCGAGAAGTCCTCCGAGACCAAGGAGGAGTTCCTGTCCCACCTGCTGCACGAGGCTGGCTACCGCCCAGGCCGCACCTACGACGGCCTGACCGAGTACCTGACCTCCATGTCCACCAAGGACATGGTTGAGAAGATCTACGCTGGCGTTCGCAAGAACGAGCTGGACATCAAGCGCACCGCTCTGTCCGACATGGCTGGCTCCGACGCTGAGAACTACTTCTACCTGAACCCACTGCCAAACGCTTACTTCACCCGCGACCCACAGGCTTCCATGGGCGTTGGCATGACCATCAACAAGATGACCTTCCCAGCTCGCCAGCCAGAGTCCCTGATCACCGAGTACGTTATGGCTAACCACCCACGCTTCAAGGACACCCCAATCTGGCGCGACCGCAACCACACCACCCGCATCGAGGGCGGCGACGAGCTGATCCTGAACAAGACCACCGTTGCTATCGGCGTTTCCGAGCGCACCTCCTCCAAGACCATCCAGAACCTGGCTAAGGAGCTGTTCGCTAACCCACTGTCCACCTTCGACACCGTTCTGGCTGTTGAGATCCCACACAACCACGCTATGATGCACCTGGACACCGTTTTCACCATGATCAACCACGACCAGTTCACCGTTTTCCCAGGCATCATGGACGGCGCTGGCAACATCAACGTTTTCATCCTGCGCCCAGGCAAGGACGACGAGGTTGAGATCGAGCACCTGACCGACCTGAAGGCTGCTCTGAAGAAGGTTCTGAACCTGTCCGAGCTGGACCTGATCGAGTGCGGCGCTGGCGACCCAATCGCTGCTCCACGCGAGCAGTGGAACGACGGCTCCAACACCCTGGCTATCGCTCCAGGCGAGATCGTTACCTACGACCGCAACTACGTTACCGTTGAGCTGCTGAAGGAGCACGGCATCAAGGTTCACGAGATCCTGTCCTCCGAGCTGGGCCGCGGCCGCGGCGGCGCTCGCTGCATGTCCCAGCCACTGTGGCGCGAGGACCTGTAA
introducing XhoI site at the DNA5 'end of the synthesized gene sequence (SEQ ID NO.2), introducing SacI site at the 3' end, sequencing the synthesized fragment, performing double enzyme digestion on the target gene and an expression vector pXMJ19-cipA by using XhoI/SacI, recovering the enzyme digestion product through gel, connecting the target fragment and the vector, transforming Escherichia coli DH5 alpha competent cells by using the connection product, successfully identifying the obtained positive transformant, and then naming the transformant as pXMJ19-cipA-arc, namely the arginine-containing deiminase gene engineering bacterium.
The genetically engineered bacterium containing arginine deiminase is preserved as Corynebacterium glutamicum SUMHS-2020.01, and is classified and named as Corynebacterium glutamicum, and the strain is preserved in China general microbiological culture Collection center of China institute of microbiology, national academy of sciences, China, institute of microbiology, No.1, 3, of the south China area of the West Lu, No.1, of the Chaoyang district, in 2020, 1 month and 17 days, and the preservation number of the strain preservation center is CGMCC No. 19404.
Example 2 expression of the fusion protein cipA-arc
2.1 preparation of competent cells of Corynebacterium glutamicum
The Corynebacterium glutamicum ATCC13032 is streaked on a plate containing LBG solid culture medium, cultured in a 300C incubator, a fresh strain is selected and inoculated in the LBG liquid culture medium after the thalli grow out, and cultured for 12-24h in a shaking table with the temperature of 30 ℃ and the rotating speed of 200 r/min. The activated bacteria solution was transferred to LBG medium at 1% inoculum size and cultured in a shaker at 30 ℃ and 200r/min until OD600 was about 0.9. Placing the bacterial liquid in an ice water mixture for precooling for 15-20min, then subpackaging the precooled bacterial liquid in a super clean bench into a sterilized 50mL centrifuge tube, centrifuging at 4 ℃ for 30s at 6000g, and placing the ice water for 2 min. The supernatant in the centrifuge tube was aspirated, 2.5mL of pre-cooled 10% glycerol was added to each centrifuge tube quickly, and the suspension was aspirated slowly by pipette. Centrifuging the suspension at 6000g at 4 ℃ for 30s, sucking out the supernatant in a centrifuge tube, quickly adding 500 mu L of precooled 10% glycerol into the centrifuge tube, slowly sucking the glycerol by using a pipette gun until the cells are suspended, and repeating the operation for three times to obtain the corynebacterium glutamicum competent cells.
2.2 recombinant plasmid pXMJ19-cipA-arc electroporation transformation of competent cells
Mixing 80 μ L competent cells and 2 μ L recombinant plasmid pXMJ19-cipA-arc, and cooling on ice for 10 min; an ice-cold electric shock cup is rapidly added for electric shock under the condition of voltage of 2.5kV and time of 5 ms. After the pulse was completed, the cuvette was removed as soon as possible, lmL of LBG liquid medium was added at room temperature, the cuvette was transferred to a centrifuge tube and incubated at 30 ℃ for 2h with gentle shaking, and 200. mu.L of the medium was spread on a chloramphenicol-resistant plate containing 20. mu.g/mL. And selecting a single colony to extract a plasmid, and confirming the insertion of the target fragment by double enzyme digestion or PCR.
2.3 inducible expression of genetically engineered bacteria
And (3) inoculating the successfully identified recombinant bacteria into an LBG culture medium containing chloramphenicol with the final concentration of 20 mu g/mL, setting the culture temperature at 30 ℃, rotating the shaking table at 200r/min, adding IPTG with the final concentration of 1mM when the OD600 value of the bacteria reaches 0.9, and inducing overnight at the temperature of 30 ℃ and the rotating speed of 180 r/min. And (3) centrifuging at 4 ℃ to collect recombinant thallus whole cells, washing the thallus twice by 50mM Tris-HCl with pH 7.0, then resuspending 50mM phosphate buffer with pH 6.5, ultrasonically breaking the cells, centrifuging at 4 ℃ again, and precipitating to obtain the obtained inclusion body protein cipA-arc (namely the cipA-arc fusion protein).
2.4 spectrophotometric determination of the activity of the cipA-arc fusion protein
The enzyme activity of the cipA-arginine deiminase fusion protein is determined by utilizing the specific color reaction of L-citrulline and diacetyl monoxime in a strong acid solution and the linear relation between the absorbance of a reaction compound at 490nm and the concentration of the L-citrulline. Preparing a solution containing 200mM of the final concentration14/15N]Substrate buffer for L-arginine ((pH 6.0,50mM phosphate buffer), 2.8mL of substrate solution was takenThen, 0.2mL of the enzyme solution was added and the reaction was carried out at 37 ℃ for 10 min. The enzyme reaction mixture was diluted by an appropriate amount (10 to 100 times), and 2mL of the diluted reaction mixture was added with 3mL of a mixed acid (volume ratio H)2SO4:H3PO41:3), 0.5 diacetyl-oxime, thiosemicarbazide, shaking up, immediately boiling in a water bath for 10min, and measuring the absorbance at 530 nm. The enzyme activity of the cipA-arginine deiminase fusion protein is defined as catalysis [ alpha ], [ beta ] -arginine deiminase at 37 ℃ and pH6.0 per minute14/15N]The amount of enzyme that converts L-arginine to 1. mu. mol citrulline is defined as one unit of enzyme activity ((1U), fusion protease activity is 10000 U.specific enzyme activity is defined as the amount of enzyme activity contained per mg of protein (U/mg). protein concentration is measured by Bradford method.
Example 3 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as those of example 2 except that the temperature of the culture in step 2.1 was 20 ℃ and the rotation speed during the culture was 300r/min, and the culture was carried out until the OD600 was about 0.3.
Example 4 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as those of example 2 except that the temperature of the culture in step 2.1 was 37 ℃ and the rotation speed during the culture was 150r/min, and the culture was carried out until the OD600 was about 1.0.
Example 5 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as those of example 2 except that the temperature of the culture in step 2.1 was 40 ℃ and the rotation speed during the culture was 180r/min, and the culture was carried out until the OD600 was about 0.72.
The effect of different implementation conditions on the preparation of competent cells of Corynebacterium glutamicum
| Examples | Culture temperature (. degree.C.) | Rotating speed (r/min) | OD600 | Number of competent cells |
| Examples 2 to 2.1 | 30 | 200 | 0.9 | Is normal |
| Example 3 | 20 | 300 | 0.3 | Weak (weak) |
| Example 4 | 37 | 150 | 1.0 | Is normal |
| Example 5 | 40 | 180 | 0.72 | Weak (weak) |
Example 6 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as in example 2 except that the voltage of the shock in step 2.2 was 1kV and the time of the shock was 10 ms.
Example 7 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as in example 2 except that the voltage of the shock in step 2.2 was 5kV and the time of the shock was 1 ms.
Influence on the transformation efficiency of corynebacterium glutamicum competent cells under different electric shock conditions
Example 8 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as those in example 2 except that the culture temperature in step 2.3 was 30 ℃ and the rotation speed during culture was 200r/min until the OD600 was about 0.9, the concentration of the inducer was 1.0mM, the induction temperature was 30 ℃ and the rotation speed during induction was 180 r/min.
Example 9 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as those in example 2 except that the culture temperature in step 2.3 was 20 ℃, the rotation speed during culture was 300r/min, the culture was carried out until the OD600 was about 0.5, the concentration of the inducer was 0.5mM, the induction temperature was 20 ℃, and the rotation speed during induction was 200 r/min.
Example 10 expression of the fusion protein cipA-arc
The experimental conditions and experimental procedures were the same as those in example 2 except that the culture temperature in step 2.3 was 25 ℃, the rotation speed during culture was 150r/min, the culture was carried out until the OD600 was about 1.0, the concentration of the inducer was 1.5mM, the induction temperature was 35 ℃, and the rotation speed during induction was 220 r/min.
Effect on the expression efficiency of the recombinant Corynebacterium glutamicum fusion protein cipA-arc under different culture conditions
Example 11 conversion [ alpha ], [ alpha ]14/15N]Production of (E) -L-arginine14/15N]-L-citrulline
Step one, suspending the immobilized fusion protein cipA-arc in a glass column reactor:
an organic glass column with the height-diameter ratio of 15 is taken as a packed column, and the immobilized fusion protein cipA-arc is filled into the packed column.
Step two, catalytic synthesis of the immobilized fusion protein cipA-arc packed column14/15N]-L-citrulline:
will 214/15N]L arginine in a mass concentration of 2.5mol/L ammonium acetate buffer solution (0.2mol/L, pH6.0) at a flow rate of 0.3BV/h at a temperature of 30 ℃. Under the reaction conditions, the [ alpha ], [14/15N]The conversion rate of the-L-arginine was 99.8%, and it was contained in each liter of the fermentation liquid14/15N]435g of L-citrulline, and the catalytic activity of the immobilized fusion protein cipA-arc is still stable after 520h of transformation of the immobilized fusion protein cipA-arc, namely the service life of the immobilized fusion protein cipA-arc is 520 h.
Step three, 214/15N]-separation and purification of L-citrulline, comprising the following three steps:
a. collecting reaction liquid flowing out of the packed column, removing buffer salt through nanofiltration, returning to a reaction system for recycling, and collecting product concentrated solution;
b. vacuum concentrating the reaction solution after step a, and crystallizing to obtain product with purity of 99.8% or more14/15N]-L-citrulline, spray dried to give a white powdery solid.
Example 12 conversion [ alpha ], [ alpha ]14/15N]Production of (E) -L-arginine14/15N]-L-citrulline
Step one, suspending the immobilized fusion protein cipA-arc in a glass column reactor:
an organic glass column with the height-diameter ratio of 25 is taken as a packed column, and the immobilized fusion protein cipA-arc is filled into the packed column.
Step two, catalyzing and synthesizing L-citrulline by using an immobilized fusion protein cipA-arc packed column:
will 214/15N]An ammonium formate buffer solution (0.2mol/L, pH6.0) with a mass concentration of 2.0mol/L of L-arginine at a temperature of 35 ℃ toThe flow rate was 0.4BV/h through the packed column. Under the reaction conditions, the [ alpha ], [14/15N]The conversion rate of the-L-arginine was 98.8%, and it was contained in each liter of the fermentation liquid14/15N]348g of L-citrulline, and 560h after the immobilized fusion protein cipA-arc is transformed, the catalytic activity of the fusion protein cipA-arc is still stable, i.e. the service life of the immobilized fusion protein cipA-arc is 560 h.
Step three, 214/15N]-separation and purification of L-citrulline, comprising the following three steps:
a. collecting reaction liquid flowing out of the packed column, removing buffer salt through nanofiltration, returning to a reaction system for recycling, and collecting product concentrated solution;
b. vacuum concentrating the reaction solution after step a, and crystallizing to obtain product with purity of 99.5% or more14/15N]-L-citrulline, spray dried to give a white powdery solid.
Example 13 conversion [ alpha ], [ alpha ]14/15N]Production of (E) -L-arginine14/15N]-L-citrulline
Step one, suspending the immobilized fusion protein cipA-arc in a glass column reactor: :
an organic glass column with the height-diameter ratio of 30 is taken as a packed column, and the immobilized fusion protein cipA-arc is filled into the packed column.
Step two, catalytic synthesis of the immobilized fusion protein cipA-arc packed column14/15N]-L-citrulline:
will 214/15N]An aqueous ammonium chloride solution (0.3mol/L, pH4.5) having a mass concentration of 1.5mol/L of L-arginine was passed through the column at a flow rate of 0.5BV/h at a temperature of 40 ℃. Under the reaction conditions, the [ alpha ], [14/15N]The conversion rate of the-L-arginine was 99.5%, and it was contained in each liter of the fermentation liquid14/15N]261g of L-citrulline, and the catalytic activity of the immobilized fusion protein cipA-arc is still stable after the immobilized fusion protein cipA-arc is transformed for 530h, namely the service life of the immobilized fusion protein cipA-arc is 530 h.
Step three, 214/15N]-separation and purification of L-citrulline, comprising the following three steps:
a. collecting reaction liquid flowing out of the packed column, removing buffer salt through nanofiltration, returning to a reaction system for recycling, and collecting product concentrated solution;
b. vacuum concentrating the reaction liquid after step a, and crystallizing to obtain product with purity of 99.6% or higher14/15N]-L-citrulline, spray dried to give a white powdery solid.
Example 14 conversion [ alpha ], [ alpha ]14/15N]Production of (E) -L-arginine14/15N]-L-citrulline
Step one, suspending the immobilized fusion protein cipA-arc in a glass column reactor: :
an organic glass column with the height-diameter ratio of 40 is taken as a packed column, and the immobilized fusion protein cipA-arc is filled into the packed column.
Step two, catalytic synthesis of the immobilized fusion protein cipA-arc packed column14/15N]-L-citrulline:
will 214/15N]An aqueous solution (pH7.5) of L-arginine having a mass concentration of 1.0mol/L and flowing through the column at a flow rate of 0.3BV/h at a temperature of 55 ℃. Under the reaction conditions, the [ alpha ], [14/15N]The conversion rate of the-L-arginine was 95%, and the L.alpha.14/15N]174g of L-citrulline, and the catalytic activity of the immobilized fusion protein cipA-arc is still stable after 480h of conversion, namely the service life of the immobilized fusion protein cipA-arc is 480 h.
Step three, 214/15N]-separation and purification of L-citrulline, comprising the following three steps:
a. collecting reaction liquid flowing out of the packed column, removing buffer salt through nanofiltration, returning to a reaction system for recycling, and collecting product concentrated solution;
b. vacuum concentrating the reaction solution after step a, and crystallizing to obtain product with purity of 99.5% or more14/15N]-L-citrulline, spray dried to give a white powdery solid.
Example 15 conversion [ alpha ], [ alpha ]14/15N]Production of (E) -L-arginine14/15N]-L-citrulline
Step one, suspending the immobilized fusion protein cipA-arc in a glass column reactor: :
an organic glass column with the height-diameter ratio of 35 is taken as a packed column, and the immobilized fusion protein cipA-arc is filled into the packed column.
Step two, catalytic synthesis of the immobilized fusion protein cipA-arc packed column14/15N]-L-citrulline:
will 214/15N]An aqueous ammonium bicarbonate solution (0.3mol/L, pH8.5) having a mass concentration of 1.8mol/L of L-arginine was passed through the column at a flow rate of 0.3BV/h at a temperature of 20 ℃. Under the reaction conditions, the [ alpha ], [14/15N]The conversion rate of the-L-arginine was 98%, and the L-arginine contained in each liter of the fermentation liquid14/15N]313g of L-citrulline, and the catalytic activity of the immobilized fusion protein cipA-arc is still stable after 450h of transformation of the immobilized fusion protein cipA-arc, namely the service life of the immobilized fusion protein cipA-arc is 450 h.
Step three, 214/15N]-separation and purification of L-citrulline, comprising the following three steps:
a. collecting reaction liquid flowing out of the packed column, removing buffer salt through nanofiltration, returning to a reaction system for recycling, and collecting product concentrated solution;
b. vacuum concentrating the reaction solution after step a, and crystallizing to obtain product with purity of 99.7% or more14/15N]-L-citrulline, spray dried to give a white powdery solid.
Although the present application has been described with reference to a few embodiments, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the application as defined by the appended claims.
Sequence listing
<110> Shanghai health medical college
<120> method for continuously preparing [14/15N ] -L-citrulline by immobilized enzyme
<150>2019110775729
<151>2019-11-06
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1567
<212>PRT
<213> method for continuously preparing [14/15N ] -L-citrulline by using immobilized enzyme (Corynebacterium glutamicum)
<400>1
Ser Glu Gln Glu Asn Cys Glu Leu Ile Ser Thr Ile Asn Gly Asn Leu
1 5 10 15
Pro Arg Thr Ala Thr Gly Ala Thr Cys Ala Ala Cys Gly Ala Cys Ala
20 25 30
Thr Gly Cys Ala Cys Cys Cys Ala Thr Cys Cys Cys Thr Gly Ala Thr
35 4045
Cys Ala Ala Gly Gly Ala Cys Ala Ala Gly Gly Ala Cys Ala Thr Gly
50 55 60
Ala Thr Gly Gly Ala Cys Gly Ala Cys Gly Thr Thr Ala Thr Gly Cys
65 70 75 80
Thr Gly Cys Gly Cys Thr Cys Cys Thr Gly Cys Ala Ala Gly Ala Thr
85 90 95
Cys Ala Thr Cys Gly Cys Thr Ala Thr Gly Ala Ala Gly Ala Thr Cys
100 105 110
Ala Thr Gly Cys Cys Ala Gly Ala Cys Ala Ala Gly Gly Thr Thr Ala
115 120 125
Thr Gly Cys Ala Gly Gly Thr Thr Ala Thr Gly Gly Thr Thr Ala Cys
130 135 140
Cys Gly Thr Thr Cys Thr Gly Ala Thr Gly Cys Thr Gly Gly Ala Cys
145 150 155 160
Gly Gly Cys Ala Cys Cys Thr Cys Cys Gly Ala Gly Gly Ala Gly Ala
165 170 175
Thr Gly Cys Thr Gly Cys Thr Gly Ala Ala Gly Thr Gly Gly Ala Ala
180 185 190
Cys Cys Thr Gly Cys Thr Gly Gly Ala Cys Ala Ala Cys Cys Gly Cys
195 200 205
Gly Gly Cys Ala Thr Gly Gly Cys Thr Ala Thr Cys Thr Ala Cys Ala
210 215 220
Ala Gly Gly Thr Thr Cys Thr Gly Ala Thr Gly Gly Ala Gly Gly Cys
225 230 235 240
Thr Cys Thr Gly Thr Gly Cys Gly Gly Cys Ala Ala Gly Ala Ala Gly
245 250 255
Gly Ala Cys Gly Thr Thr Ala Ala Gly Ala Thr Cys Gly Gly Cys Ala
260 265 270
Cys Cys Gly Thr Thr Gly Gly Cys Ala Ala Gly Gly Thr Thr Gly Gly
275 280 285
Cys Cys Cys Ala Cys Thr Gly Gly Gly Cys Thr Gly Cys Gly Ala Cys
290 295 300
Thr Ala Cys Ala Thr Cys Ala Ala Cys Thr Gly Cys Gly Thr Thr Gly
305 310 315 320
Ala Gly Ala Thr Cys Thr Cys Cys Ala Thr Gly Pro Arg Thr Ala Thr
325 330 335
Gly Ala Ala Cys Ala Ala Cys Gly Gly Cys Ala Thr Cys Ala Ala Cys
340 345 350
Gly Thr Thr Ala Ala Cys Thr Cys Cys Gly Ala Gly Ala Thr Cys Gly
355 360 365
Gly Cys Ala Ala Gly Cys Thr Gly Ala Ala Gly Thr Cys Cys Gly Thr
370 375 380
Thr Cys Thr Gly Cys Thr Gly Cys Ala Cys Cys Gly Cys Cys Cys Ala
385 390 395 400
Gly Gly Cys Gly Cys Thr Gly Ala Gly Gly Thr Thr Gly Ala Gly Ala
405 410 415
Ala Cys Ala Thr Cys Ala Cys Cys Cys Cys Ala Gly Ala Cys Ala Cys
420 425 430
Cys Ala Thr Gly Ala Ala Gly Cys Ala Gly Cys Thr Gly Cys Thr Gly
435 440 445
Thr Thr Cys Gly Ala Cys Gly Ala Cys Ala Thr Cys Cys Cys Ala Thr
450 455 460
Ala Cys Cys Thr Gly Ala Ala Gly Ala Thr Cys Gly Cys Thr Cys Ala
465 470 475 480
Gly Ala Ala Gly Gly Ala Gly Cys Ala Cys Gly Ala Cys Thr Thr Cys
485 490 495
Thr Thr Cys Gly Cys Thr Cys Ala Gly Ala Cys Cys Cys Thr Gly Cys
500 505 510
Gly Cys Gly Ala Cys Ala Ala Cys Gly Gly Cys Gly Cys Thr Gly Ala
515 520 525
Gly Ala Cys Cys Gly Thr Thr Thr Ala Cys Ala Thr Cys Gly Ala Gly
530 535 540
Ala Ala Cys Cys Thr Gly Gly Cys Thr Ala Cys Cys Gly Ala Gly Gly
545 550 555 560
Thr Thr Thr Thr Cys Gly Ala Gly Ala Ala Gly Thr Cys Cys Thr Cys
565 570 575
Cys Gly Ala Gly Ala Cys Cys Ala Ala Gly Gly Ala Gly Gly Ala Gly
580 585 590
Thr Thr Cys Cys Thr Gly Thr Cys Cys Cys Ala Cys Cys Thr Gly Cys
595 600 605
Thr Gly Cys Ala Cys Gly Ala Gly Gly Cys Thr Gly Gly Cys Thr Ala
610 615 620
Cys Cys Gly Cys Cys Cys Ala Gly Gly Cys Cys Gly Cys Ala Cys Cys
625 630 635 640
Thr Ala Cys Gly Ala Cys Gly Gly Cys Cys Thr Gly Ala Cys Cys Gly
645 650 655
Ala Gly Thr Ala Cys Cys Thr Gly Ala Cys Cys Thr Cys Cys Ala Thr
660 665 670
Gly Thr Cys Cys Ala Cys Cys Ala Ala Gly Gly Ala Cys Ala Thr Gly
675 680 685
Gly Thr Thr Gly Ala Gly Ala Ala Gly Ala Thr Cys Thr Ala Cys Gly
690 695 700
Cys Thr Gly Gly Cys Gly Thr Thr Cys Gly Cys Ala Ala Gly Ala Ala
705 710 715 720
Cys Gly Ala Gly Cys Thr Gly Gly Ala Cys Ala Thr Cys Ala Ala Gly
725 730 735
Cys Gly Cys Ala Cys Cys Gly Cys Thr Cys Thr Gly Thr Cys Cys Gly
740 745 750
Ala Cys Ala Thr Gly Gly Cys Thr Gly Gly Cys Thr Cys Cys Gly Ala
755 760 765
Cys Gly Cys Thr Gly Ala Gly Ala Ala Cys Thr Ala Cys Thr Thr Cys
770 775 780
Thr Ala Cys Cys Thr Gly Ala Ala Cys Cys Cys Ala Cys Thr Gly Cys
785 790 795 800
Cys Ala Ala Ala Cys Gly Cys Thr Thr Ala Cys Thr Thr Cys Ala Cys
805 810 815
Cys Cys Gly Cys Gly Ala Cys Cys Cys Ala Cys Ala Gly Gly Cys Thr
820 825 830
Thr Cys Cys Ala Thr Gly Gly Gly Cys Gly Thr Thr Gly Gly Cys Ala
835 840 845
Thr Gly Ala Cys Cys Ala Thr Cys Ala Ala Cys Ala Ala Gly Ala Thr
850 855 860
Gly Ala Cys Cys Thr Thr Cys Cys Cys Ala Gly Cys Thr Cys Gly Cys
865 870 875 880
Cys Ala Gly Cys Cys Ala Gly Ala Gly Thr Cys Cys Cys Thr Gly Ala
885 890 895
Thr Cys Ala Cys Cys Gly Ala Gly Thr Ala Cys Gly Thr Thr Ala Thr
900 905 910
Gly Gly Cys Thr Ala Ala Cys Cys Ala Cys Cys Cys Ala Cys Gly Cys
915 920 925
Thr Thr Cys Ala Ala Gly Gly Ala Cys Ala Cys Cys Cys Cys Ala Ala
930 935 940
Thr Cys Thr Gly Gly Cys Gly Cys Gly Ala Cys Cys Gly Cys Ala Ala
945 950 955 960
Cys Cys Ala Cys Ala Cys Cys Ala Cys Cys Cys Gly Cys Ala Thr Cys
965 970 975
Gly Ala Gly Gly Gly Cys Gly Gly Cys Gly Ala Cys Gly Ala Gly Cys
980 985 990
Thr Gly Ala Thr Cys Cys Thr Gly Ala Ala Cys Ala Ala Gly Ala Cys
995 1000 1005
Cys Ala Cys Cys Gly Thr Thr Gly Cys Thr Ala Thr Cys Gly Gly Cys
1010 1015 1020
Gly Thr Thr Thr Cys Cys Gly Ala Gly Cys Gly Cys Ala Cys Cys Thr
1025 1030 1035 1040
Cys Cys Thr Cys Cys Ala Ala Gly Ala Cys Cys Ala Thr Cys Cys Ala
1045 1050 1055
Gly Ala Ala Cys Cys Thr Gly Gly Cys Thr Ala Ala Gly Gly Ala Gly
1060 1065 1070
Cys Thr Gly Thr Thr Cys Gly Cys Thr Ala Ala Cys Cys Cys Ala Cys
1075 1080 1085
Thr Gly Thr Cys Cys Ala Cys Cys Thr Thr Cys Gly Ala Cys Ala Cys
1090 1095 1100
Cys Gly Thr Thr Cys Thr Gly Gly Cys Thr Gly Thr Thr Gly Ala Gly
1105 1110 1115 1120
Ala Thr Cys Cys Cys Ala Cys Ala Cys Ala Ala Cys Cys Ala Cys Gly
1125 1130 1135
Cys Thr Ala Thr Gly Ala Thr Gly Cys Ala Cys Cys Thr Gly Gly Ala
1140 1145 1150
Cys Ala Cys Cys Gly Thr Thr Thr Thr Cys Ala Cys Cys Ala Thr Gly
1155 1160 1165
Ala Thr Cys Ala Ala Cys Cys Ala Cys Gly Ala Cys Cys Ala Gly Thr
1170 1175 1180
Thr Cys Ala Cys Cys Gly Thr Thr Thr Thr Cys Cys Cys Ala Gly Gly
1185 1190 1195 1200
Cys Ala Thr Cys Ala Thr Gly Gly Ala Cys Gly Gly Cys Gly Cys Thr
1205 1210 1215
Gly Gly Cys Ala Ala Cys Ala Thr Cys Ala Ala Cys Gly Thr Thr Thr
1220 1225 1230
Thr Cys Ala Thr Cys Cys Thr Gly Cys Gly Cys Cys Cys Ala Gly Gly
1235 1240 1245
Cys Ala Ala Gly Gly Ala Cys Gly Ala Cys Gly Ala Gly Gly Thr Thr
1250 1255 1260
Gly Ala Gly Ala Thr Cys Gly Ala Gly Cys Ala Cys Cys Thr Gly Ala
1265 1270 1275 1280
Cys Cys Gly Ala Cys Cys Thr Gly Ala Ala Gly Gly Cys Thr Gly Cys
1285 1290 1295
Thr Cys Thr Gly Ala Ala Gly Ala Ala Gly Gly Thr Thr Cys Thr Gly
1300 1305 1310
Ala Ala Cys Cys Thr Gly Thr Cys Cys Gly Ala Gly Cys Thr Gly Gly
1315 1320 1325
Ala Cys Cys Thr Gly Ala Thr Cys Gly Ala Gly Thr Gly Cys Gly Gly
1330 1335 1340
Cys Gly Cys Thr Gly Gly Cys Gly Ala Cys Cys Cys Ala Ala Thr Cys
1345 1350 1355 1360
Gly Cys Thr Gly Cys Thr Cys Cys Ala Cys Gly Cys Gly Ala Gly Cys
1365 1370 1375
Ala Gly Thr Gly Gly Ala Ala Cys Gly Ala Cys Gly Gly Cys Thr Cys
1380 1385 1390
Cys Ala Ala Cys Ala Cys Cys Cys Thr Gly Gly Cys Thr Ala Thr Cys
1395 1400 1405
Gly Cys Thr Cys Cys Ala Gly Gly Cys Gly Ala Gly Ala Thr Cys Gly
1410 1415 1420
Thr Thr Ala Cys Cys Thr Ala Cys Gly Ala Cys Cys Gly Cys Ala Ala
1425 1430 1435 1440
Cys Thr Ala Cys Gly Thr Thr Ala Cys Cys Gly Thr Thr Gly Ala Gly
1445 1450 1455
Cys Thr Gly Cys Thr Gly Ala Ala Gly Gly Ala Gly Cys Ala Cys Gly
1460 1465 1470
Gly Cys Ala Thr Cys Ala Ala Gly Gly Thr Thr Cys Ala Cys Gly Ala
1475 1480 1485
Gly Ala Thr Cys Cys Thr Gly Thr Cys Cys Thr Cys Cys Gly Ala Gly
1490 1495 1500
Cys Thr Gly Gly Gly Cys Cys Gly Cys Gly Gly Cys Cys Gly Cys Gly
1505 1510 1515 1520
Gly Cys Gly Gly Cys Gly Cys Thr Cys Gly Cys Thr Gly Cys Ala Thr
1525 1530 1535
Gly Thr Cys Cys Cys Ala Gly Cys Cys Ala Cys Thr Gly Thr Gly Gly
1540 1545 1550
Cys Gly Cys Gly Ala Gly Gly Ala Cys Cys Thr Gly Thr Ala Ala
1555 1560 1565
Claims (10)
1. Continuous preparation of immobilized enzymePreparation [ 2 ]14/15N]-L-citrulline, characterized in that it comprises the following steps:
(1) suspending the fusion protein containing the immobilized enzyme in a packed bed reactor;
(2) will comprise14/15N]The solution of the L-arginine flows through a packed bed reactor at the flow rate of 0.3 to 0.5BV/h for reaction at the temperature of between 20 and 55 ℃, and the reaction solution is separated and purified to obtain the product14/15N]-L-citrulline.
2. The immobilized enzyme of claim 1, which is continuously produced14/15N]-L-citrulline, characterized in that said immobilized enzyme-containing fusion protein in step (1) is a catalytically active inclusion body protein cipA-arc obtained by immobilizing arginine deiminase arc on inclusion body protein cipA using cipA as a carrier, i.e. a cipA-arc fusion protein, said cipA-arc fusion protein being prepared by the steps of:
(1) preparing corynebacterium glutamicum competent cells;
(2) transforming the corynebacterium glutamicum competent cell in the step (1) by adopting recombinant plasmid pXMJ19-cipA-arc electric shock to obtain a recombinant thallus whole cell;
(3) and (3) carrying out ultrasonic crushing and centrifugation on the recombinant bacteria obtained in the step (2) to obtain a recombinant bacteria whole cell through the induction expression of the genetic engineering bacteria, and obtaining a precipitate, namely the cipA-arc fusion protein.
3. The immobilized enzyme of claim 2, which is continuously produced14/15N]-L-citrulline, characterized in that said c.glutamicum competent cells are prepared as follows:
culturing Corynebacterium glutamicum ATCC13032 in a LBG-containing solid culture medium, selecting a fresh strain, inoculating the fresh strain into an LBG liquid culture medium, culturing, transferring an activated bacterial liquid into the LBG culture medium according to the inoculum size of 0.8-1.5%, and continuously culturing until OD600 is 0.8-1.0; precooling and centrifuging the bacterial liquid by using an ice-water mixture, sucking out supernatant, adding glycerol, blowing and sucking until thalli are suspended, centrifuging again, sucking out supernatant, adding glycerol, blowing and sucking until thalli are suspended, and thus obtaining the corynebacterium glutamicum competent cells.
4. The immobilized enzyme of claim 3, which is continuously produced14/15N]-method for L-citrulline, characterized in that said recombinant plasmid pXMJ19-cipA-arc shock transformed competent cells are prepared as follows:
uniformly mixing the corynebacterium glutamicum competent cells and the recombinant plasmid pXMJ19-cipA-arc, cooling on ice, and performing electric shock for 1-10ms under the same temperature condition with the voltage of 1-5 kV; adding an LBG liquid culture medium at room temperature, transferring the liquid culture medium into a centrifuge tube, carrying out shake culture, taking the obtained liquid, coating the liquid on a chloramphenicol-resistant plate, selecting a single colony to extract a plasmid, confirming the insertion of a target fragment through double enzyme digestion and PCR, and inoculating the obtained recombinant bacteria.
5. The immobilized enzyme of claim 4, which is continuously produced14/15N]The method for inducing and expressing the L-citrulline is characterized in that the method for inducing and expressing the genetically engineered bacteria comprises the following steps:
inoculating the recombinant bacteria into an LBG culture medium containing chloramphenicol, adding isopropyl-beta-D-thiogalactoside when the OD600 value of the bacteria reaches 0.8-1.0 through shaking table culture, centrifugally collecting the whole cells of the recombinant bacteria after induction overnight, washing the bacteria with Tris-HCl buffer solution, then re-suspending in phosphate buffer solution, ultrasonically breaking the cells, then centrifuging again, and precipitating to obtain the cipA-arc fusion protein.
6. The immobilized enzyme of claim 2, which is continuously produced14/15N]-method for L-citrulline, characterized in that said recombinant plasmid pXMJ19-cipA-arc is prepared by the following method:
(1) introducing a HindIII site into a CipA gene sequence at the end of DNA5 ', introducing a SalI site into the end of 3' to obtain a fragment with the gene sequence of SEQ ID NO.1, sequencing the synthesized fragment, performing double enzyme digestion on a target gene and an expression vector pXMJ19 by HindIII/SalI, recovering an enzyme digestion product through gel, connecting the target fragment and the vector, and transforming escherichia coli DH5 alpha competent cells by the connection product to obtain a positive transformant expression vector pXMJ 19-cipA;
(2) introducing an XhoI site into an arginine deiminase arc gene sequence at the end of DNA5 ', introducing a SacI site into the end of 3' to obtain a fragment with a gene sequence of SEQ ID NO.2, sequencing the synthesized fragment, performing double digestion on a target gene and an expression vector pXMJ19-cipA by using XhoI/SacI, recovering a digestion product through gel, connecting the target fragment and the vector, transforming escherichia coli DH5 alpha competent cells by using the connection product, and obtaining a positive transformant recombinant plasmid pXMJ19-cipA-arc, namely the genetic engineering bacterium containing the arginine deiminase.
7. The immobilized enzyme of claim 6, which is continuously produced14/15N]The method for preparing L-citrulline is characterized in that the preservation name of the genetically engineered bacteria containing arginine deiminase is Corynebacterium glutamicum SUMHS-2020.01, the genetically engineered bacteria are classified and named Corynebacterium glutamicum, the strain is preserved in China general microbiological culture Collection center of China institute of microbiology, No.1 Hokkaido, No. 3 Hokkaido, North Asia City, Beijing, China, 1 month and 17 days of 2020, and the preservation number of the strain preservation center is CGMCC No. 19404.
8. The immobilized enzyme of claim 7, which is continuously produced14/15N]The method for producing L-citrulline is characterized in that the arginine deiminase is expressed in the genetic engineering bacteria containing the arginine deiminase.
9. The immobilized enzyme of claim 1, which is continuously produced14/15N]The process of (E) -L-citrulline, characterized in that the activity of the fusion protease comprising the immobilized enzyme in step (1) is 9000-14/15N]In a solution of (E) -L-arginine14/15N]The concentration of the-L-arginine is 1.0-2.5 mol/L.
10. The immobilized enzyme of claim 1, which is continuously produced14/15N]-L-citrulline, characterized in thatThe composition comprises14/15N]-the solution of L-arginine further comprises any one of a buffered solution of ammonium acetate, a buffered solution of ammonium formate, an aqueous solution of ammonium chloride, an aqueous solution of ammonium bicarbonate or a pure aqueous solution;
preferably, the composition comprises14/15N]The solution of L-arginine further comprises any one of a buffered solution of ammonium acetate, a buffered solution of ammonium formate, an aqueous solution of ammonium chloride or an aqueous solution of ammonium bicarbonate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2020/120720 WO2021088604A1 (en) | 2019-11-06 | 2020-10-13 | Method for continuously preparing [14/15n]-l-citrulline by means of immobilized enzyme |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2019110775729 | 2019-11-06 | ||
| CN201911077572 | 2019-11-06 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111518851A true CN111518851A (en) | 2020-08-11 |
| CN111518851B CN111518851B (en) | 2023-05-23 |
Family
ID=71904277
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010327490.1A Active CN111518851B (en) | 2019-11-06 | 2020-04-23 | Immobilized enzyme continuous preparation 14/15 N]Process for preparing L-citrulline |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN111518851B (en) |
| WO (1) | WO2021088604A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117025697B (en) * | 2023-10-10 | 2024-01-30 | 开平牵牛生化制药有限公司 | Method for producing adenosylmethionine by hydroxy resin immobilized enzyme method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996013524A1 (en) * | 1994-10-27 | 1996-05-09 | Yeda Research And Development Co. Ltd. | Modified cellulose-binding domain (cbd) proteins and use thereof |
| CN1292417A (en) * | 2000-08-11 | 2001-04-25 | 中国科学院武汉病毒研究所 | Method for controlling space orientation of immobilized enzyme |
| US20050106700A1 (en) * | 2001-10-11 | 2005-05-19 | Tsuyoshi Nomura | Method of purifying recombinant fused protein and method of producing protein using the same |
| US20100204445A1 (en) * | 2007-08-27 | 2010-08-12 | Katakura Industries Co., Ltd. | Dockerin polypeptide and method of purifying recombinant fused protein using the same |
| CN107858384A (en) * | 2017-11-08 | 2018-03-30 | 厦门大学 | A kind of method that optical voidness L Terleus are prepared using inactive inclusion body |
| CN108623696A (en) * | 2018-04-20 | 2018-10-09 | 江南大学 | A method of merging enzyme using cellulose fixed CBD-EndoS |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101993867B (en) * | 2009-08-24 | 2012-07-11 | 浙江海正药业股份有限公司 | Immobilization method using chitosan as carrier |
| US9255262B2 (en) * | 2013-03-06 | 2016-02-09 | Vision Global Holdings Ltd. | Albumin-binding arginine deminase and the use thereof |
-
2020
- 2020-04-23 CN CN202010327490.1A patent/CN111518851B/en active Active
- 2020-10-13 WO PCT/CN2020/120720 patent/WO2021088604A1/en active Application Filing
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996013524A1 (en) * | 1994-10-27 | 1996-05-09 | Yeda Research And Development Co. Ltd. | Modified cellulose-binding domain (cbd) proteins and use thereof |
| CN1292417A (en) * | 2000-08-11 | 2001-04-25 | 中国科学院武汉病毒研究所 | Method for controlling space orientation of immobilized enzyme |
| US20050106700A1 (en) * | 2001-10-11 | 2005-05-19 | Tsuyoshi Nomura | Method of purifying recombinant fused protein and method of producing protein using the same |
| US20100204445A1 (en) * | 2007-08-27 | 2010-08-12 | Katakura Industries Co., Ltd. | Dockerin polypeptide and method of purifying recombinant fused protein using the same |
| CN107858384A (en) * | 2017-11-08 | 2018-03-30 | 厦门大学 | A kind of method that optical voidness L Terleus are prepared using inactive inclusion body |
| CN108623696A (en) * | 2018-04-20 | 2018-10-09 | 江南大学 | A method of merging enzyme using cellulose fixed CBD-EndoS |
Non-Patent Citations (6)
| Title |
|---|
| JONG-EUN KIM等: ""Expression, purification, and characterization of arginine deiminase from Lactococcus lactisssp. Lactis ATCC 7962 in Escherichia coli BL21"", 《PROTEIN EXPRESSION AND PURIFICATION》 * |
| YANG WANG等: ""CipA and CipB as Scaffolds To Organize Proteins into Crystalline Inclusions"", 《ACS SYTHETIC BIOLOGY》 * |
| YI-XIN HUO等: ""CipA-mediating enzyme self-assembly to enhance the biosynthesis of pyrogallol in Escherichia coli"", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| 林康等: ""戊二醛固定化脂肪酶活性包涵体的性质研究"", 《中国药学杂志》 * |
| 蒋航宇等: ""固定化精氨酸脱亚胺酶的制备与性质研究"", 《生物工程》 * |
| 郑璞等: ""填充床反应器中固定化假单胞菌细胞连续制备L-瓜氨酸"", 《食品与生物技术学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021088604A1 (en) | 2021-05-14 |
| CN111518851B (en) | 2023-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754610B (en) | Recombinant engineering bacterium for surface display expression of glutamate decarboxylase and construction method and application thereof | |
| CN107641622A (en) | Hydrolyzable para-Phthalonitrile prepares the nitrilase of paracyanobenzoic acid | |
| CN107217048A (en) | It is a kind of to catalyze and synthesize aminopeptidase of carnosine and its preparation method and application | |
| CN107099516A (en) | 7 β hydroxy sterols dehydrogenase mutants and its application in ursodesoxycholic acid synthesis | |
| CN105624128B (en) | Immobilized monoamine oxidase and application thereof in synthesis of chiral azabicyclo compound | |
| CN109266630A (en) | A kind of lipase and its preparing the application in Bu Waxitan intermediate | |
| CN108752479B (en) | Recombinant beta-glucosidase, expression and purification method thereof and immobilization application thereof | |
| CN111518851B (en) | Immobilized enzyme continuous preparation 14/15 N]Process for preparing L-citrulline | |
| CN111394289B (en) | Genetically engineered bacterium and application thereof, and method for producing prostaglandin E2 | |
| JP2023133181A (en) | Production methods of recombinant escherichia coli and high purity ursodeoxycholic acid | |
| CN110358751A (en) | A kind of recombinant lipase mutant, encoding gene, recombination engineering and application | |
| CN113801239B (en) | Polypeptide tag, highly soluble recombinant nitrilase and application thereof in synthesis of medicinal chemicals | |
| CN114592027A (en) | Method for preparing tauroursodeoxycholic acid by two-step method | |
| CN111254180B (en) | Method for preparing (S) -1,2,3, 4-tetrahydroisoquinoline-3-formic acid by enzymatic resolution | |
| CN111254181B (en) | Method for preparing (S) -1,2,3, 4-tetrahydroisoquinoline-3-formic acid by chemical enzyme method | |
| CN111394295B (en) | Preparation of immobilized arginine deiminase and production thereof 14/15 N]Method for producing L-citrulline | |
| CN112063644A (en) | Efficient prokaryotic expression vector of cyclic dipeptide synthetase and application thereof | |
| CN114672525A (en) | Biosynthesis method and application of N-acetyl-5-methoxytryptamine | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN110923223A (en) | Novel nitrilase and application thereof | |
| WO2021128432A1 (en) | L-arabinose isomerase isomer and application thereof | |
| CN111518789B (en) | Recombinant lipase mutant, gene, vector and application thereof | |
| WO2023102816A1 (en) | Genetically engineered bacterium and method for preparing l-ornithine from genetically engineered bacterium | |
| CN117417923A (en) | Nitrilase mutant and application thereof | |
| CN112680485A (en) | Method for converting L-valine into alpha-ketovaline by immobilized recombinant escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |