CN111518208A - anti-CD 47 antibodies and uses thereof - Google Patents

anti-CD 47 antibodies and uses thereof Download PDF

Info

Publication number
CN111518208A
CN111518208A CN201910104772.2A CN201910104772A CN111518208A CN 111518208 A CN111518208 A CN 111518208A CN 201910104772 A CN201910104772 A CN 201910104772A CN 111518208 A CN111518208 A CN 111518208A
Authority
CN
China
Prior art keywords
antibody
ser
gly
thr
tyr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910104772.2A
Other languages
Chinese (zh)
Other versions
CN111518208B (en
Inventor
王岩
郑倩倩
高新
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qichen Baitai Beijing Pharmaceutical Technology Co ltd
Original Assignee
Qichen Baitai Beijing Pharmaceutical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qichen Baitai Beijing Pharmaceutical Technology Co ltd filed Critical Qichen Baitai Beijing Pharmaceutical Technology Co ltd
Priority to CN201910104772.2A priority Critical patent/CN111518208B/en
Publication of CN111518208A publication Critical patent/CN111518208A/en
Application granted granted Critical
Publication of CN111518208B publication Critical patent/CN111518208B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present application provides recombinant anti-CD 47 antibodies and uses thereof. The anti-CD 47 antibody can be specifically bound with CD47, has the effects of blocking the binding of CD47 and SIRPa, promoting the phagocytosis of tumor cells by macrophages, inhibiting the growth of tumors and the like, and can be used for treating CD47 related diseases, such as CD47 related tumors.

Description

anti-CD 47 antibodies and uses thereof
Technical Field
The present application relates to the field of antibodies, and more specifically, the present application relates to antibodies against CD47 and uses thereof.
Background
CD47 is a transmembrane glycoprotein that is widely expressed on the cell surface, particularly highly expressed on the surface of tumor cells. CD47 belongs to a self-recognition protein that activates a signaling pathway by binding to a ligand signaling regulatory protein alpha (sirpa) expressed on macrophages and dendritic cells to prevent phagocytosis of macrophages, allowing tumor cells to evade immune surveillance. The use of anti-CD 47 antibodies can prevent the binding of CD47 to SIRPa, thereby restoring macrophage phagocytic function to tumor cells.
Therefore, the development of anti-CD 47 antibodies capable of specifically blocking the binding of CD47 to SIRPa is expected to be useful for the treatment of CD 47-related diseases including tumors.
Summary of The Invention
In a first aspect, the present application provides an antibody or antigen-binding portion thereof that specifically binds CD47, comprising HCDR1, HCDR2 and/or HCDR3 of the heavy chain variable region.
In some embodiments, the HCDR1 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 1-8. In some embodiments, the HCDR2 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 9-17. In some embodiments, the HCDR3 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 18-25. In alternative embodiments, the antigen binding portion is selected from a Fab fragment, a Fab 'fragment, a F (ab')2 fragment, an Fv fragment, an scFv fragment, or an Fd fragment.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 further comprises a light chain variable region, wherein the light chain variable region comprises LCDR1, LCDR2, and/or LCDR 3.
In some embodiments, the LCDR1 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 26-33. In some embodiments, the LCDR2 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 34-38. In some embodiments, the LCDR3 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 39-43.
In some embodiments, the amino acid sequence of the heavy chain variable region of the antibody or antigen-binding portion thereof that specifically binds CD47 is selected from the group consisting of the amino acid sequence set forth in any one of SEQ ID NOs:44-53, or an amino acid sequence having at least 80% homology thereto.
In some specific embodiments, the amino acid sequence of the heavy chain variable region of the antibody or antigen-binding portion thereof that specifically binds CD47 is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 44-49.
In some embodiments, the amino acid sequence of the light chain variable region of the antibody or antigen-binding portion thereof that specifically binds CD47 is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs:54-62, or an amino acid sequence having at least 80% homology thereto.
In some specific embodiments, the amino acid sequence of the light chain variable region of the antibody or antigen-binding portion thereof that specifically binds CD47 is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 54-59.
In some embodiments, the antibody that specifically binds CD47 comprises a heavy chain variable region selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs 44-53 and a light chain variable region selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs 54-62.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 is capable of specifically binding to human CD 47.
In some embodiments, the antibody that specifically binds CD47 is a full-length antibody, a single chain antibody, a single domain antibody, or a bispecific antibody.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 is capable of blocking the binding of CD47 to sirpa.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 is capable of promoting phagocytosis of tumor cells by macrophages.
In some embodiments, the antibody that specifically binds CD47 is a monoclonal antibody.
In some embodiments, the antibody that specifically binds CD47 is murine or humanized.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 further comprises a heavy chain constant region selected from the group consisting of an IgG1 subtype, an IgG2 subtype, an IgG3 subtype, or an IgG4 subtype. In some preferred embodiments, the heavy chain constant region is of the IgG1 subtype or of the IgG2a subtype.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 further comprises a light chain constant region selected from the group consisting of kappa-type or lambda-type. In some preferred embodiments, the light chain constant region is of the kappa type.
In a second aspect, the present application provides a nucleic acid molecule encoding an antibody or antigen-binding portion thereof according to the first aspect that specifically binds CD 47.
In a third aspect, the present application provides an expression vector comprising the nucleic acid molecule of the second aspect.
In a fourth aspect, the present application provides a host cell comprising the nucleic acid molecule of the second aspect or the expression vector of the third aspect.
In a fifth aspect, the present application provides a pharmaceutical composition comprising an antibody or antigen-binding portion thereof according to the first aspect that specifically binds CD47 and a pharmaceutically acceptable carrier.
In some embodiments, the pharmaceutical composition further comprises one or more additional active ingredients. In some embodiments, the active ingredient is an anti-tumor drug.
In some embodiments, the pharmaceutical composition is for treating a CD 47-associated disease.
In a sixth aspect, the present application provides the use of an antibody or antigen-binding portion thereof that specifically binds to CD47 of the first aspect, or a pharmaceutical composition of the fifth aspect, in the preparation of a medicament for the prevention and/or treatment of a CD 47-associated disease, such as a tumor.
In some embodiments, the drug is an antibody-conjugated drug.
In some embodiments, the tumor is selected from one or more of the following: leukemia, lymphoma, breast cancer, lung cancer, gastric cancer, intestinal cancer, esophageal cancer, ovarian cancer, cervical cancer, renal cancer, bladder cancer, pancreatic cancer, glioma, and melanoma.
In other aspects, the present application provides a detection reagent or kit comprising an antibody or antigen-binding portion thereof according to the first aspect that specifically binds CD 47.
In other aspects, the present application also provides methods of preventing and/or treating a CD 47-associated disease, comprising administering to an individual in need thereof an antibody or antigen-binding portion thereof that specifically binds to CD47 as described in the first aspect, or a pharmaceutical composition as described in the fifth aspect.
An antibody or antigen-binding portion thereof of the present application that specifically binds to CD47 is capable of binding to CD47 with one or more of the following effects: can bind with human CD47 expressed by membrane cells in natural conformation, and promote phagocytosis of CD47 expression cells by macrophages; the compound has higher affinity, can effectively block the combination of CD47 and SIRP alpha, and promotes the phagocytosis of tumor cells by macrophages; blocking and inhibiting the combination of CD47 and SIPR alpha under the condition of not causing serious erythrocyte agglutination, and promoting the phagocytosis of macrophages; and/or capable of inhibiting the growth of tumors, and the like.
Drawings
FIG. 1 shows the ability of each anti-human CD47 monoclonal antibody to bind to CD47 on the cell surface as analyzed by FACS.
FIG. 2 shows that each anti-human CD47 monoclonal antibody was analyzed by FACS for its ability to block the binding of SIRPa to CD47 on the cell surface.
FIG. 3 shows the ability of each anti-human CD47 monoclonal antibody to promote phagocytosis by macrophages analyzed by the ATP method.
FIG. 4 shows the ability of each anti-human CD47 monoclonal antibody to inhibit tumor growth.
Detailed Description
The present application provides novel anti-CD 47 antibodies, or antigen-binding portions thereof, that specifically bind CD 47. In a preferred embodiment, the antibody or antigen binding portion thereof of the present application binds to CD47 expressed on the surface of the cell membrane, blocks the binding of CD47 to sipra, and promotes phagocytosis of CD47 expressing cells by macrophages. Also provided are nucleic acids encoding the antibodies or antigen-binding portions thereof, expression vectors comprising the nucleic acids, host cells comprising the nucleic acids or expression vectors, methods of making and purifying the antibodies, and medical and biological applications of the antibodies or antigen-binding portions thereof, such as the prevention and/or treatment of CD 47-associated diseases or disorders. The application also encompasses a detection reagent or kit comprising the antibody or antigen-binding portion thereof.
To facilitate understanding of the present application, certain terms used herein are first defined.
As used herein, the term "antibody" refers to an immunoglobulin molecule comprising four polypeptide chains, two heavy (H) and two light (L) chains interconnected by a disulfide bond, as well as multimers thereof (e.g., IgM). Each heavy chain comprises a heavy chain variable region (abbreviated VH) and a heavy chain constant region (abbreviated CH). The heavy chain constant region comprises three domains, CH1, CH2, and CH 3. Each light chain comprises a light chain variable region (abbreviated VL) and a light chain constant region (abbreviated CL). The light chain constant region comprises a domain (CL 1). The VH and VL regions can be further subdivided into hypervariable regions known as Complementarity Determining Regions (CDRs) into which conserved regions known as Framework Regions (FRs) are interspersed.
As used herein, the term "antigen-binding portion" of an antibody refers to a portion or segment of an intact antibody molecule that is responsible for binding to an antigen. The antigen binding domain may comprise a heavy chain variable region (VH), a light chain variable region (VL), or both. The antigen-binding portion of the antibody may be prepared from the intact antibody molecule using any suitable standard technique, including proteolytic digestion or recombinant genetic engineering techniques, among others. Non-limiting examples of antigen-binding moieties include: a Fab fragment; a F (ab')2 fragment; (ii) a fragment of Fd; (iv) an Fv fragment; single chain fv (scFv) molecules; a single domain antibody; a dAb fragment and the smallest recognition unit (e.g., an isolated CDR) that consists of amino acid residues that mimic a hypervariable region of an antibody. The term "antigen-binding portion" also includes other engineered molecules, such as diabodies, triabodies, tetrabodies, minibodies, and the like.
It is well known to those skilled in the art that the complementarity determining regions (CDRs, usually CDR1, CDR2, and CDR3) are the regions of the variable region that have the greatest impact on the affinity and specificity of an antibody. There are two common definitions of CDR Sequences for VH or VL, namely the Kabat definition and Chothia definition, see, for example, Kabat et al, "Sequences of Proteins of immunological Interest", National Institutes of Health, Bethesda, Md. (1991); A1-Lazikani et al, J.Mol.biol.273:927-948 (1997); and Martin et al, Proc.Natl.Acad.Sci.USA86: 9268-. For a given antibody variable region sequence, can according to Kabat definition or Chothia definition to determine VH and VL sequence in CDR sequence. In embodiments of the present application, the CDR sequences are defined using Kabat. Herein, CDR1, CDR2 and CDR3 of the heavy chain variable region are abbreviated as HCDR1, HCDR2 and HCDR3, respectively; CDR1, CDR2, and CDR3 of the light chain variable region are abbreviated as LCDR1, LCDR2, and LCDR3, respectively.
The CDR sequences in the variable region sequences can be analyzed in a variety of ways for the variable region sequences of a given antibody, such as can be determined using the online software Abysis (http:// www.abysis.org /).
The term "specific binding," as used herein, refers to a non-random binding reaction between two molecules, e.g., binding of an antibody to an epitope of an antigen, e.g., the ability of an antibody to bind to a specific antigen with at least two times greater affinity than its affinity for a non-specific antigen. It will be appreciated, however, that an antibody is capable of specifically binding to two or more antigens associated with a sequence. For example, an antibody of the invention can specifically bind to CD47 in humans and non-humans (e.g., non-human primates).
As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations in a small number of individuals. The monoclonal antibodies described herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the heavy and/or light chain is identical or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, and also include fragments of such antibodies, so long as they exhibit the desired biological activity (see, U.S. Pat. No. 4,816,567; and Morrison et al, Proc. Natl. Acad. Sci. USA 81:6851-6855 (1984)).
The term "homology", as used herein, is defined as the percentage of residues in an amino acid or nucleotide sequence variant that are identical, if necessary to the maximum percentage, after alignment and the introduction of gaps in the sequence. Methods and computer programs for alignment are well known in the art. As used herein, "at least 80% homology" means any value of 80% to 100% homology, e.g., 85%, 90%, 95%, or 99%, etc.
As used herein, the term "CD 47-associated disease" includes diseases and/or symptoms associated with the CD47 signaling pathway. Exemplary CD 47-associated diseases or disorders include tumors, such as leukemia, lymphoma, breast cancer, lung cancer, stomach cancer, intestinal cancer, esophageal cancer, ovarian cancer, cervical cancer, kidney cancer, bladder cancer, pancreatic cancer, glioma, and melanoma, among others.
As used herein, the term "EC 50" refers to the concentration of the half maximal effect (concentration for 50% of the maximum effect, EC50), and refers to the concentration that causes 50% of the maximal effect.
As used herein, the term "KD" refers to the equilibrium dissociation constant of a particular antibody-antigen interaction.
The use of degenerate bases (other than the A, T, C, G conventional base) is referred to in the nucleic acid sequences presented herein and has the same meaning as commonly understood by one of skill in the art. For example, R represents A or G; y represents C or T; m represents A or C; k represents G or T; s represents C or G; w represents A or T; h represents A or C or T; b represents C or G or T; v represents A or C or G; d represents A or G or T; n represents A or C or G or T.
In a first aspect, the present application provides an antibody or antigen-binding portion thereof that specifically binds CD47, comprising HCDR1, HCDR2 and/or HCDR3 of the heavy chain variable region. The CDRs, heavy chain variable region amino acid sequences, and light chain variable region amino acid sequences suitable for use in the antibodies disclosed herein are exemplarily set forth in tables 1-4 below. In certain embodiments, the anti-CD 47 antibody or antigen-binding portion thereof comprises HCDR1, HCDR2, and/or HCDR3 independently selected from any one of the HCDR1, HCDR2, or HCDR3 sequences shown in table 1. In certain embodiments, the anti-CD 47 antibodies of the present application may further comprise LCDR1, LCDR2, and/or LCDR3 independently selected from any one of the LCDR1, LCDR2, or LCDR3 sequences shown in table 2. For example, an anti-CD 47 antibody of the present application may comprise any of the heavy chain variable regions shown in table 3, optionally paired with any of the light chain variable regions shown in table 4.
Table 1: sequence numbers of the heavy chain CDR amino acid sequences of exemplary anti-CD 47 antibodies
Antibody numbering HCDR1 corresponding sequence number HCDR2 corresponding sequence number HCDR3 corresponding sequence number
A1 SEQ ID NO:1 SEQ ID NO:9 SEQ ID NO:18
A2 SEQ ID NO:2 SEQ ID NO:10 SEQ ID NO:19
A3 SEQ ID NO:3 SEQ ID NO:11 SEQ ID NO:20
A4 SEQ ID NO:4 SEQ ID NO:12 SEQ ID NO:21
A5 SEQ ID NO:5 SEQ ID NO:13 SEQ ID NO:22
A6 SEQ ID NO:6 SEQ ID NO:14 SEQ ID NO:23
A7 SEQ ID NO:5 SEQ ID NO:15 SEQ ID NO:22
A8 SEQ ID NO:7 SEQ ID NO:16 SEQ ID NO:24
A9 SEQ ID NO:8 SEQ ID NO:17 SEQ ID NO:25
A10 SEQ ID NO:5 SEQ ID NO:13 SEQ ID NO:22
Table 2: sequence numbers of light chain CDR amino acid sequences of exemplary anti-CD 47 antibodies
Figure BDA0001966459280000071
Figure BDA0001966459280000081
Table 3: heavy chain variable region amino acid sequence of exemplary anti-CD 47 antibody and sequence number of its coding sequence
Figure BDA0001966459280000082
Table 4: light chain variable region amino acid sequence of exemplary anti-CD 47 antibody and sequence number of its coding sequence
Figure BDA0001966459280000083
In some embodiments, the HCDR1 of an antibody or antigen-binding portion thereof disclosed herein comprises the amino acid sequence set forth in any one of SEQ ID NOs: 1-8. In some embodiments, the HCDR2 of an antibody or antigen-binding portion thereof disclosed herein comprises the amino acid sequence set forth in any one of SEQ ID NOs 9-17. In some embodiments, the HCDR3 sequence of an antibody or antigen-binding portion thereof disclosed herein comprises the amino acid sequence set forth in any one of SEQ ID NOs: 18-25.
In alternative embodiments, the antigen binding portion is selected from a Fab fragment, a Fab 'fragment, a F (ab')2 fragment, an Fv fragment, an scFv fragment, or an Fd fragment.
The antibodies or antigen-binding portions thereof disclosed herein may further comprise a light chain variable region in addition to the heavy chain variable region.
In some embodiments, the LCDR1 of an antibody or antigen-binding portion thereof disclosed herein comprises the amino acid sequence set forth in any one of SEQ ID NOs: 26-33. In some embodiments, the LCDR2 of an antibody or antigen-binding portion thereof disclosed herein comprises the amino acid sequence set forth in any one of SEQ ID NOs: 34-38. In some embodiments, the LCDR3 sequence of the antibodies or antigen-binding portions thereof disclosed herein comprises the amino acid sequence set forth in any one of SEQ ID NOs: 39-43.
In particular embodiments, the amino acid sequence of the heavy chain variable region of the antibodies, or antigen-binding portions thereof, disclosed herein is an amino acid sequence that is at least 80% homologous, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous, to an amino acid sequence selected from the group consisting of those shown in any one of SEQ ID NOs: 44-53. In particular embodiments, the amino acid sequence of the heavy chain variable region of the antibodies or antigen-binding portions thereof disclosed herein is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 44-53. In a more specific embodiment, the amino acid sequence of the heavy chain variable region of the antibodies or antigen-binding portions thereof disclosed herein is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 44-49.
In particular embodiments, the amino acid sequence of the light chain variable region of an antibody, or antigen-binding portion thereof, disclosed herein is an amino acid sequence that is at least 80% homologous, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous, to an amino acid sequence selected from the group consisting of those shown in any one of SEQ ID NOs: 54-62. In particular embodiments, the amino acid sequence of the light chain variable region of the antibodies or antigen-binding portions thereof disclosed herein is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 54-62. In a more specific embodiment, the amino acid sequence of the light chain variable region of the antibodies or antigen binding portions thereof disclosed herein is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 54-59.
In some embodiments, the heavy chain variable region or the light chain variable region of the antibodies disclosed herein may be substituted, deleted, or added with at least one amino acid based on the respective corresponding specific amino acid sequences listed above, and the resulting variants still retain the activity of binding to CD 47.
In certain embodiments, the number of amino acid substitutions, deletions or additions described above is any number between 1 and 30 or between 1 and 30, preferably between 1 and 20, more preferably between 1 and 10. In preferred embodiments, the sequence variant differs from the original amino acid sequence by substitutions, deletions and/or additions of about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids. In more preferred embodiments, the sequence variant differs from the original amino acid sequence by a substitution, deletion or addition of about 1, 2, 3, 4 or 5 amino acids. In particular embodiments, the amino acid substitution is a conservative substitution.
In some embodiments, the antibodies disclosed herein are full-length antibodies, single chain antibodies, single domain antibodies, or bispecific antibodies.
In some embodiments, the antibodies disclosed herein are monoclonal antibodies.
In some embodiments, the antibodies disclosed herein are murine or humanized.
In some embodiments, an antibody or antigen-binding portion thereof disclosed herein is capable of specifically binding to CD 47. In particular embodiments, the antibodies, or antigen-binding portions thereof, disclosed herein specifically bind to primate CD47, or CD47 of any species having high homology to primate CD 47. In preferred embodiments, the antibodies disclosed herein, or antigen binding portions thereof, specifically bind to human CD 47. In some embodiments, an antibody or antigen-binding portion thereof disclosed herein specifically binds monkey CD 47.
In some embodiments, an antibody or antigen-binding portion thereof disclosed herein is capable of blocking the binding of CD47 to sirpa. In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 is capable of promoting phagocytosis of tumor cells by macrophages.
For example, in vitro and in vivo biological experiments performed by the inventors on the anti-CD 47 antibody disclosed herein indicate that the antibody binds well to CD47 molecule, blocks the binding of CD47 to sirpa, promotes phagocytosis of tumor cells by macrophages, and/or inhibits tumor growth.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 further comprises a heavy chain constant region selected from the group consisting of an IgG1 subtype, an IgG2 subtype, an IgG3 subtype, or an IgG4 subtype. In some preferred embodiments, the heavy chain constant region is of the IgG1 subtype or of the IgG2a subtype.
In some embodiments, the antibody or antigen-binding portion thereof that specifically binds CD47 further comprises a light chain constant region selected from the group consisting of kappa-type or lambda-type. In some preferred embodiments, the light chain constant region is of the kappa type.
The present application also provides nucleic acid molecules encoding the antibodies disclosed herein, or antigen-binding portions thereof, expression vectors comprising the nucleic acid molecules, host cells comprising the nucleic acid molecules or expression vectors, and methods of making and purifying the antibodies.
In some embodiments, the nucleic acid encoding the antibody, or antigen-binding portion thereof, is operably linked to regulatory sequences that are recognized by a host cell transformed with the expression vector.
In some embodiments, any suitable expression vector may be used in the present application. For example, the expression vector may be any one of pcDNA3.3-TOPO, pTT5, pUC57, pDR1, pcDNA3.1(+), pDFFF and pCHO 1.0. Expression vectors may include fusion DNA sequences with appropriate transcriptional and translational regulatory sequences attached.
In some embodiments, useful host cells are cells containing the above-described expression vectors, which may be eukaryotic cells, such as yeast, insect cells, or mammalian cell culture systems, can be used for expression of the antibodies or antigen-binding portions thereof of the present application. For example, HEK293E cells and CHO cells can be used in the present invention. The host cell may be a prokaryotic cell containing the expression vector, and may be, for example, Escherichia coli. In some specific embodiments, the mammalian cell is preferably a HEK293E cell or a CHO cell.
In some embodiments, the methods of making an anti-CD 47 monoclonal antibody disclosed herein comprise: culturing the host cell under expression conditions such that the anti-CD 47 monoclonal antibody is expressed; the expressed anti-CD 47 monoclonal antibody was isolated and purified. Using the above method, the recombinant protein can be purified as a substantially homogeneous substance, for example, as a single band on SDS-PAGE electrophoresis.
In some embodiments, the anti-CD 47 antibodies disclosed herein can be isolated and purified using affinity chromatography, and the anti-CD 47 antibodies bound to the affinity column can be eluted using conventional methods, such as high salt buffers, pH changes, and the like, depending on the nature of the affinity column being used.
In particular embodiments, the murine anti-CD 47 monoclonal antibodies disclosed herein are obtained by the following method:
obtaining hybridoma cell strains (lines) capable of expressing anti-human CD47 antibodies by immunizing mice with human, mouse and monkey CD47 extracellular region fusion proteins and hybridoma technology, screening candidate hybridoma cell strains by in vitro ELISA and FACS methods, carrying out experimental verification of combination, blocking and cross reaction of antibodies expressed by the candidate hybridoma cell strains and human CD47 proteins, carrying out experimental verification of affinity and in vitro functions, and carrying out subsequent in vivo experiments on anti-mouse Raji lymphoma growth. Based on the above experimental results, a completely new murine anti-human CD47 antibody was finally obtained.
In an exemplary embodiment, the method for obtaining an anti-CD 47 monoclonal antibody of the present invention comprises the steps of:
(1) human CD47 extracellular region fusion protein (hCD47-ECD-6His) and a positive control antibody protein were prepared by expression.
For example, the amino acid sequence of the extracellular domain of the human CD47 protein is fused with the amino acid sequence of the linker peptide-6 His. And (2) carrying out codon artificial optimization on an amino acid sequence corresponding to the human CD47 protein extracellular region fusion protein (hCD47-ECD-6His), artificially synthesizing a DNA sequence, inserting the DNA sequence into an expression vector through an enzyme cutting site, and finally obtaining an expression plasmid pcDNA3.3-hCD47-ECD-6 His. Using FreeStyleTM293F cells were transiently expressed in Freestyle medium, followed by purification of the fusion protein using a nickel column (Ni) to finally obtain a purified human hCD47-ECD-6His fusion protein.
(2) The anti-human CD47 monoclonal antibody was obtained by mouse immunization and hybridoma technology.
Vortex and mix the purified antigen and Freund's complete adjuvant according to the dosage, to 6 weeks old BalB/C female mouse after complete emulsificationThe first immunization is carried out. One week later, a second immunization was performed and the antigen was emulsified with Freund's incomplete adjuvant, and the amount of antigen injected per mouse was 10. mu.g, and the immunization frequency was once per week. After 3 times of immunization, orbital blood collection is carried out on the mouse, a small amount of blood sample is taken for serum titer detection, and the mouse is boosted after the serum titer reaches 1:200000 or above through indirect ELISA method detection. After three days of booster immunization, mice were sacrificed, lymph node B cells were isolated and counted, and myeloma cells (p3x63ag8.653) prepared in advance were mixed uniformly in a ratio of 1:2, and after treatment with pronase, high-voltage electrofusion was performed, the fused cells were cultured in 1/2HA medium containing 20% FBS for 7 days and 10 days, respectively, and then the culture broth was changed, ELISA screening of hybridoma lines was performed after the change of the culture broth, and the obtained positive lines were subcloned in hybridoma medium containing 20% FBS using a limiting dilution method. Monoclonal well supernatants were subjected to ELISA and FACS assays to detect binding of monoclonal antibodies to human, murine, and monkey CD47, respectively. Transferring hybridoma cell strain with ELISA and FACS detection as double positive from 96-well into 24-well, culturing, transferring into 25cm after full growth2And carrying out amplification culture in a culture flask.
(3) The anti-human CD47 monoclonal antibody is prepared and purified.
Recovering the monoclonal hybridoma cell strain, carrying out subculture expansion, carrying out centrifugal collection on the cell culture supernatant after the cell culture supernatant is expanded to about 200ml, purifying by a Protein A affinity chromatography method after filtering, and carrying out purity identification by SDS-PAGE electrophoresis.
The present application provides pharmaceutical compositions comprising an antibody, or antigen-binding portion thereof, disclosed herein and a pharmaceutically acceptable carrier. The above-described anti-CD 47 antibody (e.g., anti-human CD47 monoclonal antibody) disclosed herein can be formulated into a pharmaceutical preparation together with a pharmaceutically acceptable carrier, thereby exerting the therapeutic effect more stably. In some embodiments, these formulations can ensure the conformational integrity of the amino acid core sequence of an anti-CD 47 antibody disclosed herein (e.g., an anti-human CD47 monoclonal antibody), while also protecting the multifunctional groups of the protein from degradation (including but not limited to aggregation, deamidation, or oxidation). In some embodiments, for liquid formulations, it may be generally stable for at least one year at 2 ℃ to 8 ℃. In some embodiments, for a lyophilized formulation, it remains stable at 30 ℃ for at least six months. In some embodiments, the pharmaceutical composition further comprises one or more additional active ingredients. In some embodiments, the active ingredient is an anti-tumor drug.
The present application also provides methods of preventing and/or treating a CD 47-associated disease comprising administering to an individual an anti-CD 47 antibody, or a pharmaceutical composition comprising an anti-CD 47 antibody (e.g., an anti-human CD47 monoclonal antibody). In some embodiments, the anti-tumor effect is evident upon administration to animals, including humans. Specifically, the anti-CD 47 antibody disclosed herein can effectively prevent and/or treat tumors, and can be used as an antitumor drug.
The application also provides application of the anti-CD 47 antibody or a pharmaceutical composition containing the anti-CD 47 antibody in preparation of medicines for preventing and/or treating CD47 related diseases or symptoms. In some embodiments, the drug is an antibody-conjugated drug. In some embodiments, the CD 47-associated disease or condition is a tumor.
In some embodiments, the tumor is leukemia, lymphoma, breast cancer, lung cancer, stomach cancer, intestinal cancer, esophageal cancer, ovarian cancer, cervical cancer, renal cancer, bladder cancer, pancreatic cancer, glioma, or melanoma, and the like.
The anti-human CD47 antibody and its pharmaceutical composition disclosed herein can be administered to animals including human, and the dosage of administration varies depending on the age and body weight of the individual, the nature and severity of the disease and the route of administration, and the total dose cannot exceed a certain range with reference to the results and general conditions of animal experiments.
The dosage and frequency of administration of the antibody or composition thereof may vary depending on the prevention and/or treatment of the disease. In prophylactic applications, a composition comprising an antibody or antigen-binding portion thereof of the present application is administered to a patient who is not already in a disease state to enhance the patient's resistance, this amount being defined as a "prophylactically effective dose". In this use, the specific dosage will again depend on the health of the patient and the systemic immunity. Relatively low doses are typically administered at relatively infrequent intervals for extended periods of time. In therapeutic applications, it is sometimes desirable to administer relatively high doses at relatively short intervals until disease progression is slowed or terminated, and preferably until the patient shows partial or complete improvement in disease symptoms. Thereafter, a prophylactic regimen may be administered to the patient. The specific dosage and frequency can be readily determined by one of ordinary skill in the art based on the actual need.
The present application also provides a detection reagent or kit comprising an antibody or antigen-binding portion thereof disclosed herein.
As used herein, the term "subject" refers to mammals, including, but not limited to, primates, cows, horses, pigs, sheep, goats, dogs, cats, and rodents such as rats and mice. Preferably, the mammal is a non-human primate or human. A particularly preferred mammal is a human.
In the present description and claims, the words "comprise", "comprises" and "comprising" mean "including but not limited to", and are not intended to exclude other moieties, additives, components or steps.
It should be understood that features, characteristics, components or steps described in a particular aspect, embodiment or example of the present application may be applied to any other aspect, embodiment or example described herein unless incompatible therewith.
The above disclosure generally describes the present application and the following examples are further illustrative of the present application and are not to be construed as limiting the present application. The examples do not include detailed descriptions of conventional methods such as those for constructing vectors and plasmids, methods for inserting genes encoding proteins into vectors and plasmids, or methods for introducing plasmids into host cells. Such methods are well known to those of ordinary skill in the art and are described in numerous publications, see, for example, Sambrook, j., Fritsch, e.f. and maniis, T. (1989) Molecular Cloning: the Laboratory Manual, 2nd edition, Cold spring Harbor Laboratory Press.
Examples
Example 1: preparation of recombinant proteins
The amino acid sequence of the extracellular region of the human, murine and monkey CD47 protein is fused with the amino acid sequence of the linker peptide-6 His. The amino acid sequence of the human, mouse and monkey CD47 protein extracellular region fusion protein (hCD47-ECD-6His) is subjected to codon artificial optimization, and a DNA sequence for encoding the amino acid sequence of the human, mouse and monkey CD47 protein extracellular region fusion protein (hCD47-ECD-6His) is synthesized. The DNA sequence coding the amino acid sequence of the human, murine and monkey CD47 protein extracellular region fusion protein (hCD47-ECD-6His) was inserted into the expression vector pcDNA3.3-TOPO by enzymatic cleavage site, and finally the recombinant expression vector pcDNA3.3-hCD47-ECD-6His was obtained. FreeStyle medium was treated with recombinant expression vector pcDNA3.3-hCD47-ECD-6HisTM293F cells were expressed by transient transfection. Then the fusion protein hCD47-ECD-6His was purified by using a nickel column (Ni), and finally purified human, murine, monkey hCD47-ECD-6His fusion protein was obtained.
The amino acid sequence of the positive control antibody P02 was obtained with reference to the disclosure of U.S. patent application No. US 2013/0224188, and gene synthesis was performed based on the amino acid sequence of the positive control antibody and cloned into the expression vector pcDNA3.3-TOPO, to finally obtain the recombinant expression vector pcDNA3.3-P02. FreeStyle culture medium with recombinant expression vector pcDNA3.3-P02 for FreestyleTM293F cells were expressed by transient transfection. P02 was then purified using a Protein A column (Protein purification liquid chromatography System/AKTA Purifier 10, GE) according to the manufacturer's instructions to obtain the purified positive control antibody P02.
Example 2: preparation of monoclonal hybridomas
1. Immunization of BalB/C mice:
and (3) mixing the purified hCD47-ECD-6His fusion protein antigen and Freund's complete adjuvant uniformly by dose vortex, and immunizing a 6-week-old BalB/C female mouse for the first time after complete emulsification. Mice were immunized in 2 groups of 5 mice each, with a single injection of 10 μ g of antigen at the plantar aspect of the hind limb. One week after the first immunization, the mice are subjected to the second plantar immunization by using Freund incomplete adjuvant, and the dosage of the immunizing antigen is the same as that of the first immunization. Mice were then immunized plantar once a week thereafter, with the same adjuvant and antigen doses as the second immunization.
After the first immunization, a small amount of blood collection is carried out on the mouse in every three weeks, serum titer detection is carried out, and after the serum titer reaches 1:200000 or more through indirect ELISA method, the mouse for fusion is strengthened.
2. Preparation of cells for fusion (myeloma cells)
Myeloma cells P3X63Ag8.653 used for fusion were cultured for two weeks in DMEM medium containing 1X 8-azaguanine and 10% fetal calf serum, and then cultured for one week in DMEM medium containing 10% fetal calf serum, maintaining the density of P3X63Ag8.653 at 70% -80% until the day of fusion.
3. Cell fusion and HAT screening:
b lymphocyte harvesting and preparation: 2 mice which are strengthened and immunized in the step 1 are taken, immune serum is collected, killed and soaked in 75% alcohol for 2-3 minutes. The skin of the flank of the abdomen and the inner side of the hind limb of the immunized mouse was cut open, and the lymph nodes were exposed. The lymph nodes are picked up by using sharp-pointed tweezers, ground by using a grinding rod, filtered by a cell screen to prepare a single cell suspension, and the living cells are counted.
Cell fusion pretreatment: myeloma cells P3X63Ag8.653 in the culture flask were collected, centrifuged at 1000rpm/5min, the supernatant was discarded, and viable myeloma cells were counted after resuspension.
Cell fusion, mixing cells at the ratio of B lymphocyte P3X63Ag8.653 to 1:2, centrifuging at 2000rpm/5min, discarding supernatant, shaking to disperse cell precipitate, and mixing at 400 μ l/1 × 108Adding Pronase (Pronase) 1mg/ml into B lymphocytes, incubating for 15 s, adding fetal calf serum 10ml to stop reaction, supplementing electrotransfer solution (ECF), centrifuging to remove supernatant, resuspending with ECF, counting viable cells, and adjusting B lymphocyte density to 2 × 106Individual cells/ml. And adding the cell suspension with the adjusted density into an electric fusion tank, and operating an electric transfer instrument to perform cell fusion to obtain the mouse hybridoma. The mouse hybridoma cell suspension was transferred from the fusion tank to 1/2HAT medium and allowed to stand for 3 hours before cell plating.
HAT cultureScreening culture medium, preparing HAT screening culture medium containing 1/2HAT, 1 × penicillin-streptomycin, 20% fetal calf serum and 80% DMEM culture medium, re-suspending mouse hybridoma cells with the HAT screening culture medium, mixing well, and adding 1 × 106Density of individual B cells/plate, 200 μ l/well, cell suspension was added to 96 well cell culture plates and incubated in a 37 ℃ cell incubator. After 1 week of culture, the medium was changed with HAT screening medium for the first time, and the cells were further cultured in a cell culture chamber at 37 ℃ for 3 days, and then changed with HAT screening medium for the second time.
4. Screening of Positive hybridoma cell lines
2 weeks after fusion, taking cell supernatant to perform ELISA and FACS experiments, detecting the binding condition of the cell supernatant and human CD47 protein, screening out hybridoma cells which have positive ELISA and FACS results and can block the combination of SIRP alpha and CD47, and then subcloning and expanding the hybridoma cells.
5. Expanding culture
Transferring hybridoma cell strain with ELISA and FACS positive detection into 24-well plate from 96-well plate, culturing, transferring into 25cm after full growth2The culture flask of (3) was cultured.
6. Subcloning by limiting dilution method
After a small amount of positive hybridoma cells are sucked for viable cell counting, about 200 positive hybridoma cell strains are added into 80ml of complete culture medium and evenly mixed, and 4 pieces of 96 pore plates are inoculated, wherein the density is 0.5 cell/pore. Another approximately 400 positive hybridoma cells were pipetted into 80ml of complete medium and mixed well and seeded into 4 96-well plates at a density of 1 cell/well. Another 1000 positive hybridoma cells were pipetted into 20mL of complete medium and mixed well and seeded into 1 96 well plate at a density of 10 cells/well. The 96-well plate was placed at 37 ℃ in 5% CO2Culturing in an incubator.
7. Clone detection and expanded culture
Monoclonal well supernatants were subjected to ELISA and FACS assays to detect binding of monoclonal antibodies to human CD 47. Transferring hybridoma cells which are detected to be positive by ELISA and FACS from a 96-well plate into a 24-well plate for culture, and transferring into 25cm after the hybridoma cells grow to be full2The culture flask of (3) was cultured.
8. Identification of cell subsets
96-well plates were coated with goat anti-mouse IgG1 type antibody, goat anti-mouse IgG2a type antibody, goat anti-mouse IgG2b type antibody, goat anti-mouse IgG2c type antibody, goat anti-mouse IgG3 type antibody, goat anti-mouse IgM type antibody, and goat anti-mouse IgGA type antibody, respectively, 50 ng/100. mu.l/well, overnight at 4 ℃ and then blocked with BSA at room temperature. And adding a supernatant of the hybridoma cell to be detected, incubating for 2 hours at room temperature, adding an enzyme-labeled secondary antibody goat anti-mouse IgG type antibody, a goat anti-mouse kappa type antibody and a goat anti-mouse lambda type antibody for developing, reading at 450nm after stopping reaction, and judging the subclass of the hybridoma cell strain to be detected to be an IgG1 subtype, an IgG2a subtype or a kappa type.
9. Cell cryopreservation
The frozen stock contained 90% fetal bovine serum and 10% DMSO.
Resuspending the cells in the flask, counting the cells, centrifuging at 1000rpm for 5min, discarding the supernatant, pipetting with 10% DMSO in fetal calf serum, and resuspending at 5 × 106The density of individual cells/tubes was frozen in a freezer at-80 ℃ overnight and transferred into liquid nitrogen the next day.
10. Monoclonal hybridoma gene preservation
Collecting positive monoclonal hybridoma cell strain, adding Trizol lysate for cell lysis, extracting RNA and reverse transcribing into cDNA, and storing at-80 deg.c.
Example 3: murine monoclonal antibody gene sequencing
After immunization, fusion and monoclonality, 10 monoclonal antibody hybridoma cells with the numbers of CD47-1, CD47-2, CD47-3, CD47-4, CD47-5, CD47-6, CD47-7, CD47-8, CD47-9 and CD47-10 were selected for total RNA extraction based on ELISA, FACS and blocking experiments. cDNA synthesis was performed using the Takara PrimeScriptII 1st Srand cDNA synthesis kit, followed by G-addition treatment of the 5 'end of the synthesized cDNA template and PCR by 5' end primers and heavy and light chain constant region primers (HC-R and LC-R) to amplify the heavy and light chain variable regions of the antibody. The sequences of HC-R and LC-R are as follows:
5' end primer: CCCCCCCCCCCCCCCCCC (SEQ ID NO:82)
HC-R：CTCAGGGAARTARCCYTTGAC(SEQ ID NO:83)
LC-R：TCACTGCCATCAATCTTCCAC(SEQ ID NO:84)
And (3) carrying out agarose gel electrophoresis detection on the PCR products of the amplified heavy chain variable region and the amplified light chain variable region, then carrying out sample sequencing, and identifying the primers and the amplification primers. Finally determining the amino acid sequence of the heavy chain variable region as shown in SEQ ID NOs: 44-53; the light chain variable region amino acid sequence is shown in SEQ ID NOs: 54-62; encoding the polypeptide shown as SEQ ID NOs:44-53 are as shown in SEQ ID NOs: 63-72; encoding the polypeptide shown as SEQ ID NOs:54-62 are as shown in SEQ ID NOs: 73-81.
Example 4: ELISA binding experiment of anti-human CD47 monoclonal antibody and human CD47 protein
Monoclonal antibody hybridoma cells numbered CD47-1 to CD47-10 were expanded and expressed with antibodies, each monoclonal antibody hybridoma cell obtained 1L of expression supernatant, and anti-human CD47 monoclonal antibody was purified by ProteinA and numbered A1-A10, respectively.
The hCD47-ECD-6His fusion protein was diluted with PBS buffer pH7.4, 0.01M, and coated in 96-well plates at 50 ng/50. mu.l/well overnight at 4 ℃. The plate was washed 3 times with 200. mu.l/well PBST (1 ‰ Tween 20) and blocked by adding 250. mu.l/well of 3% PBS-BSA at 37 ℃ for 2 hours. After three washes, the best 6 anti-human CD47 monoclonal antibodies A1-A6 (50. mu.l/well) were added in a gradient dilution with the highest concentration of monoclonal antibody being 10. mu.g/ml, 2-fold gradient dilution, each monoclonal antibody diluted in a total of 12 concentration gradients, and incubated at room temperature for 1 hour. The plate was then washed 5 times and then a further portion of the plate was washed with 3% BSA at 5000: goat anti-mouse IgG-HRP secondary antibodies diluted at a ratio of 1 were incubated for 1h at room temperature. After washing the plate 4 times, the plate was developed with TMB color development kit (50. mu.l/well), protected from light at room temperature for 2 minutes, and developed with 2M H2SO4(50. mu.l/well) the color development was stopped. Readings were taken at 450nm and 630nm using a microplate reader, respectively. Results of the experiments shown in Table 5, the EC50 values of the binding curves of A1-A6 were 0.016, 0.007, 0.010, 0.076, 0.016 and 0.010. mu.g/ml, respectively, for all tested monoclonalsThe antibody can be well combined with the human CD47, and the affinity of each monoclonal antibody is not very different.
TABLE 5 EC50 values for ELISA binding of anti-human CD47 monoclonal antibody
Anti-human CD47 monoclonal antibody numbering EC50(μg/ml)
A1 0.016
A2 0.007
A3 0.010
A4 0.076
A5 0.016
A6 0.010
Example 5 binding experiment of anti-human CD47 monoclonal antibody to cell membrane-expressed human CD47 protein
Culturing Jurkat cells expressing human CD47 protein on the surface of cell membrane to total amount of cells required for experiment, diluting the cells to 1 × 10% BSA/PBS solution6Cell/ml, and 1 × 105Cells/100. mu.l/well were plated onto a 96-well U-shaped plate, centrifuged at 1500rpm for 4 minutes, and the supernatant was discarded. The anti-human CD47 sheet to be detectedThe clone antibody A1-A6 and the positive control antibody P02 were diluted in 3-fold gradient at an initial concentration of 10. mu.g/ml for 12 concentration points, resuspended Jurkat cells at 100. mu.l per well, and incubated at 4 ℃ for 1 hour. Following centrifugation at 1500rpm for 4 minutes, the supernatant was discarded and the cells were washed 2 times with 180. mu.l of 1% BSA/PBS solution. After the supernatant was discarded in the last washing, 100. mu.l of a 100-fold diluted goat anti-mouse IgG Fc-conjugated FITC fluorescent secondary antibody was added to each well, and the mixture was incubated at 4 ℃ for 0.5 hour. After the secondary antibody incubation was completed, the supernatant was discarded after centrifugation at 1500rpm for 4 minutes. Cells were washed 2 times with 180. mu.l per well of 1% BSA/1xPBS, centrifuged at 1500rpm for 4 minutes each time and the supernatant discarded. After the final wash, the cells were resuspended in 100. mu.l/well of 1% BSA/PBS and the binding of the anti-human CD47 monoclonal antibody to the cell membrane surface-expressed human CD47 protein was determined on a BD flow cytometer. The results are shown in fig. 1, the EC50 values of the binding curves of a1-a6 are 0.016, 0.017, 0.018, 0.017, 0.013 and 0.015 μ g/ml respectively, the EC50 value of the binding curve of P02 is 0.018 μ g/ml, and the anti-human CD47 monoclonal antibody can bind to human CD47 in the native conformation expressed by the cells.
Example 6 anti-human CD47 monoclonal antibody blocks the binding experiment of human SIRP alpha and cell membrane expressing human CD47 protein
Culturing Jurkat cells expressing human CD47 protein on the surface of cell membrane to total amount of cells required for experiment, diluting the cells to 1 × 10 with 1% BSA/PBS solution6Cell/ml, and 1 × 105The anti-human CD47 monoclonal antibody A1-A6 and the positive control antibody P02 to be detected are diluted by 12 concentration points in A3-fold gradient at an initial concentration of 10 mu g/ml and a final concentration of 0.1 mu g/ml, the anti-human CD47 monoclonal antibody with each concentration gradient is premixed with SIRP α with a final concentration of 0.1 mu g/ml, only 0.1 mu g/ml SIRP α is added to 12 parallel wells, JURKAT cells are resuspended by 100 mu l each, the JURKAT cells are incubated at 4 ℃ for 1 hour, then the cells are centrifuged at 1500rpm for 4 minutes, the supernatant is discarded, the cells are resuspended and washed by 180 mu l of 1% PBS solution for 2 times, after the supernatant is washed by the last time, 100 mu l of anti-His antibody coupling PE fluorescence is added to each well, the secondary antibody at 4 ℃ is incubated for 0.5 hour, and after the incubation is finished, the secondary antibody coupling PE at 1500rpm is centrifugedAfter the last washing, cells were resuspended in 100. mu.l/well 1% BSA/PBS solution, and binding of SIRP α and cell membrane surface expressed human CD47 protein was determined to be blocked by anti-human CD47 monoclonal antibody on BD flow cytometer, as shown in FIG. 2, the IC50 values of the inhibition curves for A1-A6 were 0.08, 0.15, 0.25, 0.17, 0.07 and 0.18. mu.g/ml, and the IC50 value of the inhibition curve for P02 was 0.13. mu.g/ml, and anti-human CD47 monoclonal antibody was able to effectively block binding of SIRP α to cell surface CD 47.
Example 7 species crossover experiment of anti-human CD47 monoclonal antibody and human, murine, monkey CD47 protein
Respectively culturing CT26-hCD47 cells, CT26-mCD47 cells and CT26-cCD47 cells which express human, mouse and monkey CD47 proteins on the surface of cell membranes until the total amount of the cells reaches the experimental requirements, and diluting the cells to 1 × 10 by using 1% BSA/PBS solution6Cells/ml, at 100. mu.l (1 × 10)5Density of individual cells)/well, centrifuge at 1500rpm for 4 minutes, discard the supernatant. Primary antibodies of the anti-human CD47 monoclonal antibodies (A1-A6 and the positive control antibody P02) to be tested were diluted to two concentration points of 5. mu.g/ml and 1. mu.g/ml, respectively, and the resuspended cells were added in a volume of 100. mu.l per well and incubated at 4 ℃ for 1 hour. The cells were then washed 2 times with 180. mu.l of 1% BSA/PBS, the supernatant discarded from the last wash, 100. mu.l/well of a 100-fold dilution of goat anti-mouse IgG Fc conjugated FITC fluorescent secondary antibody was added, and the cells were incubated for 0.5 h at 4 ℃. After incubation, the cells were washed 2 times, and 100. mu.l of 1% BSA/PBS solution was added to each well to resuspend the cells, and binding of the anti-human CD47 monoclonal antibody to human, murine, and monkey CD47 protein expressed on the cell membrane surface was measured on a BD flow cytometer. Wherein NC is primary antibody replaced by PBS, and secondary antibody is added in parallel; the blank control is primary antibody, the secondary antibody is not added, and only the background fluorescence value of the cells is detected. As a result, as shown in table 6, the anti-human CD47 antibody could bind to human CD47 protein and monkey CD47 protein expressed on the surface of the cell membrane, but did not recognize murine CD47 protein expressed on the surface of the cell membrane.
TABLE 6 species crossover experiment of anti-human CD47 monoclonal antibody with human, murine, monkey CD47
Figure BDA0001966459280000221
Example 8 determination of affinity of anti-human CD47 monoclonal antibody by FACS
Culturing CT26-hCD47 cells expressing human CD47 protein on the surface of cell membrane until the total cell amount reaches the experimental requirement, and diluting the cells to 1 × 10 degree by 1% BSA/PBS solution6Cells/ml, at 100. mu.l (1 × 10)5Density of individual cells)/well, centrifuge at 1500rpm for 4 minutes, discard the supernatant. The anti-human CD47 monoclonal antibody (A1-A6, positive control antibody P02) was initially at a concentration of 10. mu.g/ml, diluted 2-fold in gradient at 11 points, resuspended in cells by adding 100. mu.l/well of monoclonal antibody, duplicate wells of each concentration were set up, and incubated at 4 ℃ for 1 hour. After centrifugation at 1500rpm for 4 minutes, the supernatant was discarded, the cells were washed 2 times with 1% BSA/PBS solution, 100. mu.l/well of a goat anti-mouse IgG Fc conjugated FITC fluorescent secondary antibody was added at 100-fold dilution, and the mixture was incubated at 4 ℃ for 0.5 hour. After the incubation was completed, the mixture was centrifuged at 1500rpm for 4 minutes, and the supernatant was discarded. Cells were washed 1 time with 1% BSA/1xPBS solution, centrifuged to discard the supernatant, and then resuspended in 100. mu.l of 1% BSA/1xPBS solution per well and examined on a BD flow cytometer. As shown in Table 7, the detected anti-human CD47 monoclonal antibody has better affinity than the positive control antibody P02.
TABLE 7 affinity between anti-human CD47 monoclonal antibody and human CD47 protein expressed on cell membrane surface
Figure BDA0001966459280000231
Example 9 anti-human CD47 monoclonal antibody promotes macrophage phagocytosis experiment
Preparation of C57BL murine peritoneal Primary macrophage
Killing C57BL mouse by introducing neck, immersing the whole mouse in 75% alcohol in a biological safety cabinet for 5 s, placing on a dissecting table, fixing limbs with needles, holding surgical scissors and forceps with two hands, tearing skin, pulling to two sides, exposing peritoneum, scrubbing peritoneal wall with 75% alcohol, and injecting into abdominal cavity with syringe8-10ml of pre-cooled DPBS, and simultaneously, the abdomen wall is kneaded and pressed by fingers, so that the liquid can fully flow in the abdominal cavity. The abdominal wall was gently lifted with a needle while the C57BL mouse was slightly tilted, so that the fluid in the abdominal cavity was collected under the needle and sucked into the needle tube. Carefully remove the needle, fill the liquid into the centrifuge tube, centrifuge at 4 ℃ for 3 minutes at 1000rpm, remove the supernatant, add 2ml of DMEM medium (DMEM + 10% FBS + 1% PS), count the cells, centrifuge at 1000rpm for 3 minutes, remove the supernatant, add 2ml of DMEM medium, place at 37 ℃, 5% CO2Culturing in incubator overnight, changing liquid the next day, digesting with pancreatin after two days, performing cell counting, inoculating into 96-well plate with 4 × 10 per well4Cells/well (100. mu.l), 5% CO at 37 ℃2Incubate in incubator for 18 hours.
2. Macrophage phagocytosis assay
Removing supernatant of the incubated macrophages, adding 100 mu l/hole of 1640 serum-free culture medium, starving at 37 ℃ for 2 hours, diluting 10 concentration points of the anti-human CD47 monoclonal antibody (A1-A6 and a positive control antibody P02) to be detected with the serum-free 1640 culture medium at the initial concentration of 10 mu g/ml by 3 times of concentration gradient, adding the diluted 10 concentration points into the prepared starved macrophages (50 mu l/hole), preparing Raji cells in advance, and performing 2 × 10-time cell selection on the cells4Individual cells/well were mixed into macrophages and anti-human CD47 monoclonal antibody at 37 ℃ with 5% CO2Incubate in incubator for 24 hours or more. Add 100. mu.l ATP solution/well, mix well for 2 minutes in dark, stand for 8 minutes at room temperature, and detect. The results are shown in fig. 3, the EC50 values of the phagocytosis promotion curves of a1-a6 are 0.004394, 0.004622, 0.003910, 0.007386, 0.006648 and 0.005675 micrograms/ml, the EC50 value of the phagocytosis promotion curve of P02 is 0.009951 micrograms/ml, and the detected anti-human CD47 monoclonal antibodies can promote the phagocytosis of Raji cells by macrophages, and the effects of the antibodies are superior to those of positive control antibodies.
Example 10 anti-human CD47 monoclonal antibody animal tumor inhibition experiment
32 six week-old immunodeficient (NPG) mice of comparable body weight were taken and randomly divided intoFour groups of eight mice each, positive control antibody group (P02), A1 antibody administration group (A1), A5 antibody administration group (A5) and blank control group (PBS), all immunodeficient mice were inoculated with 100. mu.l of 1 × 10 density subcutaneously6Raji cells of one cell/ml, mice were observed for neoplasia at day 6 after tumor bearing (tumor volume about 50-150 mm)3) Administration is initiated. The administration concentrations of the positive control antibody and the monoclonal antibody of the anti-human CD47 to be detected are both 20mg/kg, and the positive control antibody and the monoclonal antibody of the anti-human CD47 to be detected are administered to the abdominal cavity once every 3 days. The body weights of the individual groups of mice and the tumor volumes in the individual groups were also measured every two days. After the administration, the tumors in the mice were detached, weighed, and the tumor inhibition ratios of the antibody administration groups were calculated, and the results are shown in table 8 and fig. 4, in which the tumor inhibition ratios of the anti-human CD47 monoclonal antibodies to be tested administered at the same doses were equivalent to those of the positive control antibodies.
TABLE 8 tumor inhibition rate of anti-human CD47 monoclonal antibody
Figure BDA0001966459280000241
Figure BDA0001966459280000251
It will be understood that, although the invention herein has been described in the foregoing specific forms, these inventions are not to be limited to the particulars described in these specific forms. It will be obvious to those skilled in the art that various equivalent changes may be made in the technical features of the invention involved therein without departing from the spirit of the invention described in the present application, and these changes should be construed as being within the scope of the invention.
Sequence listing
<110> Qichen Baitai (Beijing) pharmaceutical science and technology Co., Ltd
<120> anti-CD 47 antibody and use thereof
<160>84
<170>SIPOSequenceListing 1.0
<210>1
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>1
Asn Tyr Val Leu His
1 5
<210>2
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>2
Gly Tyr Phe Met Asn
1 5
<210>3
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>3
Asn Tyr Trp Met Asn
1 5
<210>4
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>4
Tyr Tyr Val Met His
1 5
<210>5
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>5
Gly Tyr Thr Met His
1 5
<210>6
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>6
Asp Ser Glu Met His
1 5
<210>7
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>7
Ser Tyr Trp Met Asn
1 5
<210>8
<211>5
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>8
Asn Tyr Val Met His
1 5
<210>9
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>9
Tyr PheAsn Pro Tyr Asn Asp Asp Ser Lys Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>10
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>10
Arg Ile Asn Pro Tyr Asn Gly Asp Thr Phe Tyr Asn Gln Lys Phe Lys
1 5 10 15
Gly
<210>11
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>11
Asn Ile Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys
1 5 10 15
Asp
<210>12
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>12
Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>13
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>13
Leu Ile Asn Pro Tyr Thr Gly Gly Thr Asn Tyr Asn Gln Lys Phe Lys
1 5 10 15
Gly
<210>14
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>14
Val Ile Asp Pro Glu Thr Gly Asn Ser Ala Tyr Asn Gln Lys Phe Lys
1 5 10 15
Gly
<210>15
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>15
Leu Ile Asn Pro Tyr Thr Asp Gly Thr Asn Tyr Asn Gln Asn Phe Lys
1 5 10 15
Gly
<210>16
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>16
Asn Ile Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Arg
15 10 15
Asp
<210>17
<211>17
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>17
Tyr Ile Asn Pro Tyr Asn Asn Asp Ile Lys Ser Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>18
<211>8
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>18
Gly Gly Tyr Tyr Ser Met Asp Tyr
1 5
<210>19
<211>8
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>19
Gly Gly Tyr Gly Gly Met Asp Tyr
1 5
<210>20
<211>8
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>20
Trp Arg Gly Tyr Ala Leu Asp Tyr
1 5
<210>21
<211>8
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>21
Gly Gly Thr Thr Ala Pro Asp Tyr
1 5
<210>22
<211>8
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>22
Met Gly Leu Ala Trp Phe Ala Tyr
1 5
<210>23
<211>10
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>23
Gly Gly Val Phe Gly Tyr Pro Phe Asp Tyr
1 5 10
<210>24
<211>8
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>24
Trp Arg Gly Tyr Ala Met Asp Tyr
1 5
<210>25
<211>8
<212>PRT
<213> Artificial sequence (artificacial sequence)
<400>25
Gly Gly Leu Phe Ser Met Asp Tyr
1 5
<210>26
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>26
Arg Ala Ser Gln Ser Leu Ala His Ser Asn Gly Tyr Thr Tyr Leu Gln
1 5 10 15
<210>27
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>27
Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu
1 5 10 15
<210>28
<211>11
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>28
Arg Ala Ser Lys Ser Ile Ser Lys Phe Leu Ala
1 5 10
<210>29
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>29
Arg Tyr Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu
1 5 10 15
<210>30
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>30
Arg Ser Ser Gln Ser Leu Val His Ser Asn Gly Asn Thr Tyr Phe His
1 5 10 15
<210>31
<211>12
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>31
Ser Ala Thr Ser Ser Val Arg Ser Ser Tyr Leu His
1 5 10
<210>32
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>32
Arg Ser Ser Gln Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His
1 5 10 15
<210>33
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>33
Arg Ser Ser Gln Ser Ile Val His Ile Lys Gly Asn Thr Tyr Leu Glu
1 5 10 15
<210>34
<211>7
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>34
Lys Val Ser Lys Arg Phe Ser
1 5
<210>35
<211>7
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>35
Lys Val Ser Asn Arg Phe Ser
1 5
<210>36
<211>7
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>36
Ser Gly Ser Thr Leu Gln Ser
1 5
<210>37
<211>7
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>37
Lys Val Ser Ile Arg Phe Ser
1 5
<210>38
<211>7
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>38
Arg Thr Ser Asn Leu Ala Ser
1 5
<210>39
<211>9
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>39
Ser Gln Ser Thr His Val Pro Tyr Thr
1 5
<210>40
<211>9
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>40
Phe Gln Gly Ser His Val Pro Tyr Thr
1 5
<210>41
<211>9
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>41
Gln Gln His Asn Glu Tyr Pro Trp Thr
1 5
<210>42
<211>9
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>42
Phe Gln Gly Ser His Val Pro Trp Thr
1 5
<210>43
<211>9
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>43
Gln Gln Trp Arg Gly Tyr Pro Tyr Thr
1 5
<210>44
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>44
Glu Phe Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Val Leu His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Phe Asn Pro Tyr Asn Asp Asp Ser Lys Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Thr Ser Glu Asp SerAla Val Tyr Tyr Cys
85 90 95
Ala Arg Gly Gly Tyr Tyr Ser Met Asp Tyr Trp Gly Gln Gly Thr Thr
100 105 110
Val Thr Val Ser Ser
115
<210>45
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>45
Glu Val Gln Val Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr
20 25 30
Phe Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile
35 40 45
Gly Arg Ile Asn Pro Tyr Asn Gly Asp Thr Phe Tyr Asn Gln Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala His
65 70 75 80
Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Gly Arg Gly Gly Tyr Gly Gly Met Asp Tyr Trp Gly Gln Gly Thr Ser
100 105 110
Val Thr Val Ser Ser
115
<210>46
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>46
Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala
1 5 10 15
Ser Val Lys Leu Ser Cys Lys Ala Ser Gly His Thr Phe Thr Asn Tyr
20 25 30
Trp Met Asn Trp Ile Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asn Ile Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe
50 55 60
Lys Asp Lys Ala Ile Leu Thr Val Gly Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Ile Trp Arg Gly Tyr Ala Leu Asp Tyr Trp Gly Gln Gly Thr Ser
100 105 110
Val Thr Val Ser Ser
115
<210>47
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>47
Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Tyr
20 25 30
Val Met His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Gly Gly Thr Thr Ala Pro Asp Tyr Trp Gly Gln Ala Thr Thr
100 105 110
Leu Thr Val Ser Ser
115
<210>48
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>48
Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Met Arg Met Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr
20 25 30
Thr Met His Trp Val Lys Gln Ser His Gly Thr Asn Leu Glu Trp Ile
35 40 45
Gly Leu Ile Asn Pro Tyr Thr Gly Gly Thr Asn Tyr Asn Gln Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Leu Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Phe Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Met Gly Leu Ala Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu
100 105 110
Val Thr Val Ser Ala
115
<210>49
<211>119
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>49
Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Ala
1 5 10 15
Ser Val Thr Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Asp Ser
20 25 30
Glu Met His Trp Val Lys Gln Thr Pro Val Tyr Gly Leu Glu Trp Thr
35 40 45
Gly Val Ile Asp Pro Glu Thr Gly Asn Ser Ala Tyr Asn Gln Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Asn Thr Ala Tyr
65 70 75 80
Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Thr Arg Gly Gly Val Phe Gly Tyr Pro Phe Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Leu Thr Val Ser Ser
115
<210>50
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>50
Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 510 15
Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr
20 25 30
Thr Met His Trp Val Lys Gln Ser His Gly Asn Asn Leu Glu Trp Ile
35 40 45
Gly Leu Ile Asn Pro Tyr Thr Asp Gly Thr Asn Tyr Asn Gln Asn Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Leu Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Met Gly Leu Ala Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu
100 105 110
Val Thr Val Ser Ala
115
<210>51
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>51
Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala
1 5 10 15
Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Trp Met Asn Trp Val Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asn Ile Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe
50 55 60
Arg Asp Lys Ala Ile Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Ile Trp Arg Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser
100 105 110
Val Thr Val Ser Ser
115
<210>52
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>52
Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Val Met His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Asn Pro Tyr Asn Asn Asp Ile Lys Ser Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Thr Thr Ala Phe
65 70 75 80
Met Asp Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Gly Gly Leu Phe Ser Met Asp Tyr Trp Gly Gln Gly Thr Ser
100 105 110
Val Thr Val Ser Ser
115
<210>53
<211>117
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>53
Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Met Arg Met Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr
20 25 30
Thr Met His Trp Val Lys Gln Ser His Gly Thr Asn Leu Glu Trp Ile
35 40 45
Gly Leu Ile Asn Pro Tyr Thr Gly Gly Thr Asn Tyr Asn Gln Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Leu Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Met Gly Leu Ala Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu
100 105 110
Val Thr Val Ser Ala
115
<210>54
<211>111
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>54
Asp Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly Asp
1 5 10 15
Gln Ala Ser Ile Ser Cys Arg Ala Ser Gln Ser Leu Ala His Ser Asn
20 25 30
Gly Tyr Thr Tyr Leu Gln Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro
35 40 45
Lys Leu Leu Ile Tyr Lys Val Ser Lys Arg Phe Ser Gly Val Pro Asp
50 55 60
Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser
65 70 75 80
Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser Thr
85 90 95
His Val Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>55
<211>112
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>55
Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly
85 90 95
Ser His Val Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210>56
<211>108
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>56
Cys Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro
1 5 10 15
Gly Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Ser Lys
20 25 30
Phe Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Asn Leu Leu
35 40 45
Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser
50 55 60
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu
65 70 75 80
Pro Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Glu Tyr Pro
85 90 95
Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105
<210>57
<211>112
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>57
Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Arg Arg Tyr Ser Gln Ser Ile Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Ile Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly
85 90 95
Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210>58
<211>112
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>58
Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Phe His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser
85 90 95
Thr His Val Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Met Lys
100 105 110
<210>59
<211>111
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>59
Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Ile Met Ala Ala
1 5 10 15
Ser Leu Gly Gln Lys Val Thr Met Thr Cys Ser Ala Thr Ser Ser Val
20 25 30
Arg Ser Ser Tyr Leu His Trp Tyr Gln Gln Lys Ser Gly Ala Ser Pro
35 40 45
Lys Pro Leu Ile His Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ala
50 55 60
Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser
65 70 75 80
Ser Val Glu Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Gln Gln Trp Arg
85 90 95
Gly Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210>60
<211>112
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>60
Asp Phe Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser
85 90 95
Thr His Val Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210>61
<211>108
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>61
Cys Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro
1 5 10 15
Gly Glu Pro Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Ser Lys
20 25 30
Phe Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn His Leu Leu
35 40 45
Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser
50 55 60
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu
65 70 75 80
Pro Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Glu Tyr Pro
85 90 95
Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105
<210>62
<211>112
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>62
Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His Ile
20 25 30
Lys Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly
85 90 95
Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100105 110
<210>63
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>63
gagttccagc tgcagcagag cggaccagaa ctggtgaagc caggagccag cgtgaagatg 60
tcttgcaagg ccagcggcta caccttcacc aactacgtgc tgcattgggt gaagcagaag 120
ccaggacagg gactcgagtg gatcggatac ttcaacccct acaacgacga cagcaagtac 180
aacgagaagt tcaagggcaa ggccaccctg accagcgata agagcagcag caccgcctac 240
atggagctgt ctagcctgac cagcgaggac tcagccgtgt actattgcgc cagaggcgga 300
tactacagca tggactattg gggccaggga acaacagtga cagtgtccag c 351
<210>64
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>64
gaggttcagg tgcagcagtc tggacctgag ctggtgaagc ctggggcttc agtgaagata 60
tcctgcaagg cttctggtta ctcatttact ggctacttta tgaactgggt gaagcagagc 120
catggaaaga gccttgagtg gattggacgt attaatcctt acaatggtga tactttctac 180
aaccagaagt tcaagggcaa ggccacattg actgtagaca aatcctctag cacagcccac 240
atggagctcc tgagcctgac atctgaggac tctgcagtct attattgtgg aagggggggc 300
tacggaggaa tggactactg gggtcaagga acctcagtca ccgtctcctc a 351
<210>65
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>65
caggtccaac tgcagcagcc tggggctgag ctggtgaggc ctggggcttc agtgaagctg 60
tcctgcaagg cttctggcca cacgttcacc aactactgga tgaactggat taaacagagg 120
cctgagcaag gccttgagtg gattggaaat attgatcctt acgatagtga aactcactac 180
aatcaaaagt tcaaggacaa ggccatattg actgtcggca aatcctccag cacagcctac 240
atgcaactca gcagcctgac atctgaggac tctgcggtct attactgtgc aatatggaga 300
ggctatgctt tggactactg gggtcaagga acctcagtca ccgtctcctc a 351
<210>66
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>66
gaggtccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg 60
tcctgcaagg cttctggata cacattcact tactatgtta tgcactgggt gaagcagaag 120
cctgggcagg gccttgagtg gattggatat attaatcctt acaatgatgg tactaagtac 180
aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcctccag cacagcctac 240
atggagctca gcagcctgac ctctgaggac tctgcggtct attactgtgc aagagggggt 300
actacggccc ccgactactg gggccaagcc accactctca cagtctcctc a 351
<210>67
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>67
gaggtccagc tgcaacagtc tggacctgag ctggtgaagc ctggagcttc aatgaggatg 60
tcctgcaagg cttctggtta ctcgttcact ggctacacca tgcactgggt gaagcagagc 120
cacggaacga accttgagtg gattggactt attaatcctt acactggtgg tactaactac 180
aaccagaagt tcaagggcaa ggccacatta actttagaca agtcatccag cacagcctac 240
atggagctcc tcagtctgac atctgaggac tttgcagtct attactgtgc aagaatgggc 300
ctggcctggt ttgcttactg gggccaaggg actctggtca ctgtctctgc a 351
<210>68
<211>357
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>68
caggttcaac tgcagcagtc tggggctgaa ctggtgaggc ctggggcttc agtgacgctg 60
tcctgcaagg cttcgggcta ctcatttact gactctgaaa tgcactgggt gaagcagaca 120
cctgtgtatg gcctggaatg gactggagtt attgatcctg aaactggaaa tagtgcctac 180
aatcagaagt tcaagggcaa ggccacactg actgcagaca aatcctccaa cacagcctac 240
atggaactcc gcagcctgac atctgaggac tctgccgtct attactgtac aagaggaggg 300
gttttcggct acccctttga ctactggggc caaggcacca ctctcacagt ctcctca 357
<210>69
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>69
gaggtccagc tgcaacagtc tggacctgag ctggtgaagc ctggagcttc aatgaagatc 60
tcctgcaagg cttctggtta ctcattcact ggctacacca tgcactgggt gaaacagagc 120
catggaaaca accttgagtg gattggactt attaatcctt acactgatgg tactaactac 180
aaccagaact tcaagggcaa ggccacatta actttagaca agtcatccag cacagcctac 240
atggagctcc tcagtctgac atctgaggac tctgcagtct attactgtgc aagaatgggc 300
ctggcctggt ttgcttactg gggccaaggg actctggtca ctgtctcagc a 351
<210>70
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>70
caggtccaac tgcagcagcc tggggctgag ctggtgaggc ctggggcttc agtgaagctg 60
tcctgcaagg cttctggcta cacgttcacc agctactgga tgaactgggt taagcagagg 120
cctgagcaag gccttgagtg gattggaaat attgatcctt acgatagtga aactcactac 180
aatcaaaagt tcagggacaa ggccatattg actgtcgaca aatcctccag cacagcctac 240
atgcaactca gcagcctgac atctgaggac tctgcggtct attactgtgc aatatggaga 300
ggctatgcta tggactactg gggtcaagga acctcagtca ccgtctcctc a 351
<210>71
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>71
gaggtccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg 60
tcctgcaagg cttctggata cacattcact aactatgtta tgcactgggt gaagcagaag 120
cctgggcagg gccttgagtg gattggatat attaatcctt acaataatga tattaagtcc 180
aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcctccac cacagccttc 240
atggacctca gcagcctgac ctctgaggac tctgcggtct attactgtgc aaaagggggg 300
ctattctcta tggactactg gggtcaagga acctcagtca ccgtctcctc a 351
<210>72
<211>351
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>72
gaggtccagc tgcaacagtc tggacctgag ctggtgaagc ctggagcttc aatgaggatg 60
tcctgcaagg cttctggtta ctcgttcact ggctacacca tgcactgggt gaagcagagc 120
catggaacga accttgagtg gattggactt attaatcctt acactggtgg tactaactac 180
aaccagaagt tcaagggcaa ggccacatta actttagaca agtcatccag cacagcctac 240
atggagctcc tcagtctgac atctgaggac tctgcagtct attactgtgc aagaatgggc 300
ctggcctggt ttgcttactg gggccaaggg actctggtca ctgtctctgc a 351
<210>73
<211>333
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>73
gacgtgatga cccagacccc tctgtctctgccagtgtctc tgggagacca ggcctctatc 60
tcttgcagag ccagccagtc tctggcccat agcaacggct acacctacct ccagtggtat 120
ctgcagaagc caggccagag ccctaaactg ctgatctaca aggtgtccaa gcggttcagc 180
ggcgtgccag atagattcag cggaagcgga agcggcaccg acttcaccct gaagatcagc 240
agagtggagg ccgaggatct gggagtgtac ttctgcagcc agagcaccca cgtgccttac 300
acattcggcc agggcaccaa ggtggagatc aag 333
<210>74
<211>336
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>74
gatgttttga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60
atctcttgca gatctagtca gagcattgta catagtaatg gaaacaccta tttagaatgg 120
tacctgcaga aaccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300
tacacgttcg gaggggggac caagctggaa ataaaa 336
<210>75
<211>324
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>75
tgtgatgtcc agataaccca gtctccatct tatcttgctg catctcctgg agaaaccatt 60
actattaatt gcagggcaag taagagcatt agcaaatttt tagcctggta tcaagagaaa 120
cctgggaaaa ctaataacct tcttatctac tctggatcca ctttgcaatc tggaattcca 180
tcaaggttca gtggcagtgg atctggtaca gatttcactc tcaccatcag tagcctggag 240
cctgaagatt ttgcaatgta ttactgtcaa cagcataatg aatacccgtg gacgtttggt 300
ggaggcacca agctggaaat caaa 324
<210>76
<211>336
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>76
gatgttttga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60
atctctcgca gatatagtca gagcattgta catagtaatg gaaacaccta tttagaatgg 120
tacctgcaga aaccaggcca gtctccaaag ctcctgattt acaaagtttc catccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300
tggacgttcg gtggaggcac caagctggaa atcaaa 336
<210>77
<211>336
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>77
gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60
atctcttgca gatctagtca gagccttgta cacagtaatg gaaacaccta ttttcattgg 120
tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttccg 300
tacacgttcg gaggggggac caaactggaa atgaaa 336
<210>78
<211>333
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>78
tccagaggag aaaatgtgct cacccagtct ccagcaataa tggctgcctc tctggggcag 60
aaggtcacca tgacctgcag tgccacctca agtgtaaggt ccagttactt gcactggtac 120
cagcagaagt caggcgcttc ccccaaaccc ttgattcata ggacatccaa cctggcttct 180
ggagtcccag ctcgcttcag tggcagtggg tctgggacct cttactctct cacaatcagc 240
agcgtggagg ctgaagatga tgcaacttat tactgccagc agtggagagg ttacccgtac 300
acgttcggag gggggaccaa gctggaaata aaa 333
<210>79
<211>336
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>79
gattttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggcga tcaagcctcc 60
atctcttgca gatctagtca gagccttgta cacagtaatg gcaacaccta tttacattgg 120
tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttccg 300
tacacgttcg gaggggggac caagctggaa ataaaa 336
<210>80
<211>324
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>80
tgtgatgtcc agataaccca gtctccatct tatcttgctg catctcctgg agaacccatt 60
actattaatt gcagggcaag taagagcatt agcaaatttt tagcctggta tcaagagaaa 120
cctgggaaaa ctaatcacct tcttatctac tctggatcca ctttgcaatc tggaattcca 180
tcaaggttca gtggcagtgg atctggtaca gatttcactc tcaccatcag tagcctggag 240
cctgaagatt ttgcaatgta ttactgtcaa cagcataatg aatacccgtg gacgttcggt 300
ggaggcacca agctggaaat caaa 324
<210>81
<211>336
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>81
gatgttttga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60
atctcttgca gatctagtca gagcattgta catattaagg gaaacaccta tttagaatgg 120
tacctgcaga aaccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agtagagtgg aggctgagga tctgggagtt tattattgtt ttcaaggttc acatgttccg 300
tggacgttcg gtggaggcac caagctggaa atcaaa 336
<210>82
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>82
cccccccccc cccccccc 18
<210>83
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>83
ctcagggaar tarccyttga c 21
<210>84
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>84
tcactgccat caatcttcca c 21

Claims (15)

1. An antibody or antigen-binding portion thereof that specifically binds CD47, comprising HCDR1, HCDR2 and/or HCDR3 of the heavy chain variable region, wherein the HCDR1 comprises the amino acid sequence set forth in any one of SEQ ID NOs 1-8; the HCDR2 comprises an amino acid sequence shown in any one of SEQ ID NOs: 9-17; and/or the HCDR3 comprises the amino acid sequence shown in any one of SEQ ID NOs: 18-25; preferably, the antigen binding portion is selected from a Fab fragment, a Fab 'fragment, a F (ab')2 fragment, an Fv fragment, an scFv fragment or an Fd fragment.
2. The antibody or antigen binding portion thereof of claim 1, wherein the amino acid sequence of the heavy chain variable region is selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs:44-53, or an amino acid sequence having at least 80% homology thereto.
3. The antibody or antigen binding portion thereof of claim 1 or 2, further comprising a light chain variable region, wherein the light chain variable region comprises LCDR1, LCDR2, and/or LCDR3, wherein the LCDR1 comprises the amino acid sequence set forth in any one of SEQ ID NOs 26-33; the LCDR2 comprises an amino acid sequence shown in any one of SEQ ID NOs: 34-38; and/or the LCDR3 comprises the amino acid sequence shown in any one of SEQ ID NOs: 39-43.
4. The antibody or antigen binding portion thereof of claim 3, wherein the light chain variable region has an amino acid sequence selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs:54-62, or an amino acid sequence having at least 80% homology thereto.
5. The antibody, or antigen-binding portion thereof, of any one of claims 1-4, wherein the antibody comprises a heavy chain variable region selected from the amino acid sequence set forth in any one of SEQ ID NOs:44-53 and a light chain variable region selected from the amino acid sequence set forth in any one of SEQ ID NOs: 54-62.
6. The antibody or antigen binding portion thereof of any one of claims 1-5, wherein the antibody or antigen binding portion thereof is capable of specifically binding to human CD 47;
optionally, the antibody is a full-length antibody, a single chain antibody, a single domain antibody, or a bispecific antibody;
preferably, the antibody, or antigen-binding portion thereof, is capable of blocking the binding of CD47 to sirpa and/or promoting phagocytosis of tumor cells by macrophages.
7. The antibody or antigen binding portion thereof of any one of claims 1-6, wherein the antibody is a monoclonal antibody;
optionally, the antibody is murine or humanized.
8. The antibody or antigen binding portion thereof of any one of claims 1-7, further comprising a heavy chain constant region selected from the group consisting of an IgG1 subtype, an IgG2 subtype, an IgG3 subtype, or an IgG4 subtype, and/or further comprising a light chain constant region selected from the group consisting of a kappa type or a lambda type;
preferably, the heavy chain constant region is of the IgG1 subtype or the IgG2a subtype and the light chain constant region is of the kappa type.
9. A nucleic acid molecule encoding the antibody or antigen-binding portion thereof of any one of claims 1-8.
10. An expression vector comprising the nucleic acid molecule of claim 9.
11. A host cell comprising the nucleic acid molecule of claim 9 or the expression vector of claim 10;
preferably, the host cell is a prokaryotic cell, a yeast, an insect cell, or a mammalian cell;
more preferably, the prokaryotic cell is escherichia coli; and/or the mammalian cell is a HEK293E cell or a CHO cell.
12. A pharmaceutical composition comprising the antibody or antigen-binding portion thereof of any one of claims 1-8 and a pharmaceutically acceptable carrier;
optionally, the pharmaceutical composition further comprises one or more other active ingredients.
13. Use of the antibody or antigen-binding portion thereof of any one of claims 1-8, or the pharmaceutical composition of claim 12, for the manufacture of a medicament for the prevention and/or treatment of a CD 47-related disease; preferably, the drug is an antibody-conjugated drug.
14. The use according to claim 13, wherein the disease is a tumor;
preferably, the tumour is selected from one or more of the following: leukemia, lymphoma, breast cancer, lung cancer, gastric cancer, intestinal cancer, esophageal cancer, ovarian cancer, cervical cancer, renal cancer, bladder cancer, pancreatic cancer, glioma, and melanoma.
15. A detection reagent or kit comprising the antibody or antigen-binding portion thereof of any one of claims 1-8.
CN201910104772.2A 2019-02-01 2019-02-01 anti-CD 47 antibodies and uses thereof Active CN111518208B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910104772.2A CN111518208B (en) 2019-02-01 2019-02-01 anti-CD 47 antibodies and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910104772.2A CN111518208B (en) 2019-02-01 2019-02-01 anti-CD 47 antibodies and uses thereof

Publications (2)

Publication Number Publication Date
CN111518208A true CN111518208A (en) 2020-08-11
CN111518208B CN111518208B (en) 2024-03-15

Family

ID=71900217

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910104772.2A Active CN111518208B (en) 2019-02-01 2019-02-01 anti-CD 47 antibodies and uses thereof

Country Status (1)

Country Link
CN (1) CN111518208B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112442123A (en) * 2019-09-03 2021-03-05 中山康方生物医药有限公司 anti-CD47 monoclonal antibody and application thereof
WO2023046071A1 (en) * 2021-09-23 2023-03-30 江苏恒瑞医药股份有限公司 Anti-klb antibodies and uses

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106084052A (en) * 2016-06-17 2016-11-09 长春金赛药业有限责任公司 Anti-CD47 monoclonal antibody and application thereof
WO2018095428A1 (en) * 2016-11-28 2018-05-31 江苏恒瑞医药股份有限公司 Cd47 antibody, antigen-binding fragment and medical use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106084052A (en) * 2016-06-17 2016-11-09 长春金赛药业有限责任公司 Anti-CD47 monoclonal antibody and application thereof
US20200079869A1 (en) * 2016-06-17 2020-03-12 Changchun Genescience Pharmaceuticals Corp. Anti-CD47 monoclonal antibody and use thereof
WO2018095428A1 (en) * 2016-11-28 2018-05-31 江苏恒瑞医药股份有限公司 Cd47 antibody, antigen-binding fragment and medical use thereof
CN108779179A (en) * 2016-11-28 2018-11-09 江苏恒瑞医药股份有限公司 CD47 antibody, its antigen-binding fragment and its medical usage

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
鞠宝辉等: "抗CD47单克隆抗体对卵巢癌细胞靶向治疗的体外研究", 中国肿瘤临床 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112442123A (en) * 2019-09-03 2021-03-05 中山康方生物医药有限公司 anti-CD47 monoclonal antibody and application thereof
WO2023046071A1 (en) * 2021-09-23 2023-03-30 江苏恒瑞医药股份有限公司 Anti-klb antibodies and uses

Also Published As

Publication number Publication date
CN111518208B (en) 2024-03-15

Similar Documents

Publication Publication Date Title
US11512129B2 (en) TIGIT antibody, antigen-binding fragment thereof, and medical use thereof
CN112601762B (en) anti-CD 47 antibodies and uses thereof
JP2019518459A (en) LAG-3 antibodies, antigen binding fragments thereof and their pharmaceutical uses
EP3712170A1 (en) Cd96 antibody, antigen-binding fragment and pharmaceutical use thereof
WO2021058000A1 (en) Anti-human claudin 18.2 antibody and application thereof
CN112500485B (en) anti-B7-H3 antibody and application thereof
CN114729033B (en) Antibodies against alpha-hemolysin and uses thereof
CN113563470B (en) Antibody combined with TIGIT antigen and preparation method and application thereof
CN113906053B (en) anti-CEA antibodies and uses thereof
WO2023125888A1 (en) Gprc5d antibody and application thereof
CN114106182B (en) Antibodies against TIGIT and uses thereof
CN111518208B (en) anti-CD 47 antibodies and uses thereof
JP4690196B2 (en) Neutralizing human antibodies against anthrax toxin produced by the resurrection technique
CN114478769B (en) anti-TIGIT antibody, and pharmaceutical composition and use thereof
CN112876563B (en) Pharmaceutical composition, preparation method and application thereof
TW202200620A (en) Anti-flt3 antibodies and compositions
CN114276451A (en) Antibodies or antigen binding fragments thereof targeting CD3e/g, preparation and uses thereof
CN115386006A (en) anti-GPRC 5D antibody, preparation method and application thereof
CN107586339A (en) A kind of BLyS antibody and its preparation method and application
CN114685658A (en) OX40 targeted antibody and preparation method and application thereof
TW202413405A (en) Antibody, antigen-binding fragment thereof, and pharmaceutical use thereof
CN114437215A (en) Anti-human CD38 antibody and preparation method and application thereof
CN115197323A (en) SN38 antibody or antigen binding fragment thereof and application thereof
CN112079924A (en) PD-L1 targeted binding agents and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant