CN111518179B

CN111518179B - Bacteriocin with antibacterial activity for various pathogenic bacteria

Info

Publication number: CN111518179B
Application number: CN202010433692.4A
Authority: CN
Inventors: 信丙越; 李峰; 刘舒; 曾化伟; 曾昕; 王光利; 张标; 徐大勇
Original assignee: Huaibei Normal University
Current assignee: Huaibei Normal University
Priority date: 2020-05-21
Filing date: 2020-05-21
Publication date: 2023-04-21
Anticipated expiration: 2040-05-21
Also published as: CN111518179A

Abstract

The invention discloses a bacteriocin XIN-1 with antibacterial activity to various pathogenic bacteria, which is a novel cyclic bacteriocin with a molecular weight of 5848.2032Da, and a nucleotide sequence of a precursor peptide of the bacteriocin is shown as SEQ ID NO:1, the amino acid sequence is shown as SEQ ID NO: 2. The bacteriocin XIN-1 is produced from Bacillus faciens XIN-1, and has high antibacterial activity on various pathogenic bacteria such as Bacillus cereus, listeria monocytogenes, staphylococcus aureus, etc.

Description

Bacteriocin with antibacterial activity for various pathogenic bacteria

Technical Field

The invention belongs to the field of microorganisms, and particularly relates to bacteriocin XIN-1 with antibacterial activity on various pathogenic bacteria.

Background

With the importance of people on food safety and self health, traditional preservation technologies such as chemical preservatives can cause adverse effects on blood pressure, heart, kidneys and the like, even some problems such as cancer induction, teratogenicity and the like can not meet the needs of people, and searching for natural and safe food preservatives becomes a research hotspot in the food industry.

Bacteriocins are a class of proteins or polypeptides with antibacterial activity produced by bacteria through the mechanism of ribosome synthesis. Bacteriocins themselves have many excellent properties: high antibacterial activity in vivo and in vitro; is nontoxic to human body or animal, and is easily degraded by some proteases in animal digestive tract; the selective sterilization effect is good; the biological transformation is easy, and different requirements of people are met; has thermal stability and acid and alkali resistance, and is convenient for storage; is odorless and does not affect the mouthfeel, taste, etc. of foods and feeds when used (Cotter et al, 2013). Therefore, the bacteriocin has wide application value and wide application prospect in the industries of foods, feeds, medicines and the like.

Bacillus is a gram-positive bacterium that forms spores widely distributed in a variety of ecological environments. It has been found that Bacillus bacteria (Bacillus) produce a wide variety of bacteriocins, such as the bacteriocin thurcin CD produced by Bacillus thuringiensis isolated from human fecal samples can specifically inhibit clostridium difficile, and does not cause imbalance of intestinal flora in human colon models, and is highly likely to become a novel drug for human fight clostridium difficile infection in the future (Rea et al, 2010). In addition, 3 novel lanthiobacterins, ticin A1, ticin A3 and Ticin A4, which have high-efficiency antibacterial activity against food-borne pathogenic bacteria bacillus cereus and listeria monocytogenes, have extremely strong heat-resistant and acid-base-resistant properties, and have application potential as novel food preservatives, are identified in bacillus thuringiensis BMB3201 (Xin et al 2015).

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a bacteriocin XIN-1 with antibacterial activity on various pathogenic bacteria. The bacteriocin XIN-1 provided by the invention has high-efficiency antibacterial activity on various pathogenic bacteria.

The bacteriocin XIN-1 with antibacterial activity to various pathogenic bacteria is a novel cyclic bacteriocin with molecular weight of 5848.2032Da (measured by monoisotope).

The nucleotide sequence of the precursor peptide of the bacteriocin XIN-1 is shown in a sequence table SEQ ID NO. 1, and the amino acid sequence is shown in a sequence table SEQ ID NO. 2.

The sequence table SEQ ID NO. 1 is the nucleotide sequence of the precursor peptide of baciclicin XIN-1, and consists of 195 nucleotides.

SEQ ID NO. 2 of the sequence Listing is the amino acid sequence of the precursor peptide of baciclicin XIN-1, which codes for 64 proteins in total.

The bacteriocin XIN-1 is produced from bacillus faciens XIN-1, and the classification of Xiang Shanya bacillus faciens XIN-1 is named as follows: bacillus xiangshan XIN-1, accession number: china Center for Type Culture Collection (CCTCC), address: chinese, wuhan, university of Wuhan, date of preservation: 4/2/2020, accession number: cctccc NO: m2020064.

According to the invention, the bacterial strain XIN-1 (Bacillus xiangshanXIN-1) can produce substances with antibacterial activity on various pathogenic bacteria (such as bacillus cereus ATCC14579, listeria monocytogenes ATCC19115 and staphylococcus aureus ATCC 29523) through antibacterial activity screening. The bacteriostasis active substance produced by extracting Xiang Shanya bacillus XIN-1 strain is a novel cyclic bacteriocin, and the bacteriocin substance is named as baciclicin XIN-1. The baciclicin XIN-1 has antibacterial activity against various gram-positive pathogenic bacteria (such as Bacillus cereus, listeria monocytogenes, staphylococcus aureus, etc.).

Drawings

Fig. 1: the results of the antibacterial activity of fermentation supernatants of Bacillus faciens XIN-1 strain on Bacillus cereus ATCC14579, listeria monocytogenes ATCC19115 and Staphylococcus aureus ATCC29523 at different growth periods were examined.

Fig. 2: HPLC analysis and mass spectrometry analysis result of bacteriocin-baciclicin XIN-1 produced by Bacillus faciens XIN-1 strain.

Fig. 3: comparison of synthetic Gene Cluster and precursor peptide sequences of baciclicin XIN-1. Reference numerals illustrate: panel A in FIG. 3 is the synthetic gene cluster of baciclicin XIN-1, and panel B in FIG. 3 is a functional analysis of each gene in the synthetic gene cluster of baciclicin XIN-1; panel C of FIG. 3 is an alignment analysis of the precursor peptide sequence of baciclicin XIN-1 with the reported cyclic bacteriocin precursor peptide.

Fig. 4: the structure of baciclicin XIN-1.

Detailed Description

Example 1:

1. detection of bacteriostatic activity of Bacillus faciens XIN-1 strain

Single colonies of Bacillus faciens XIN-1 were picked, inoculated in 5ml LB liquid medium and activated overnight at 30 ℃.1mL of the culture was transferred to 100mL of LB liquid medium (formulation: peptone 10g, yeast powder 5g, sodium chloride 10g, supplemented with distilled water to 1L, pH7.0, sterilized at 121℃for 30 min), and cultured at 220rpm/min at 30℃for 30h. 1mL of the culture medium was sampled in an ultra clean bench every 2 hours from inoculation, and the samples were continuously taken 12 times. After the culture solution is centrifuged at 12000rpm/min for 5min, the supernatant is transferred to a new centrifuge tube, and the antibacterial activity of the fermentation supernatant on the indicator bacteria is measured. The bacteriostatic activity of the fermentation supernatants was examined by agar diffusion (cinthas et al, 1995). Adding appropriate amount of indicator bacteria (bacterial count about 5×10) into non-coagulated agar medium ⁵ cfu/mL), mixing, and pouring into a plate. Bacillus cereus ATCC14579, listeria monocytogenes ATCC19115 and Staphylococcus aureus ATCC29523 (all of which were purchased from the American type culture Collection) were selected as indicator bacteria. And (5) punching by using a puncher with the aperture of 6mm after the solidification. After about 50 mu L of sample is added into each hole, the flat plate is firstly placed at 4 ℃ for about 2 hours to allow the sample to be tested to fully diffuse, then placed at 28 ℃ for culturing for 12 hours, and the antibacterial effect is observed (whether a transparent antibacterial ring appears or not is observed). As shown in figure 1, the fermentation supernatant of Bacillus faciens XIN-1 in 6-14h has obvious antibacterial activity on three indicator bacteria.

2. Identification of bacteriocin secreted by Bacillus faciens XIN-1 (baciclicin XIN-1)

(1) Whole genome sequencing of Bacillus faciens XIN-1 strain and prediction and analysis of antibacterial active substances

The Bacillus mountain XIN-1 strain was transferred to Beijing Nostoc source technologies Co., ltd for whole genome sequencing (done by an Illuminate Hiseq2500 sequencer). The sequencing used was double-ended sequencing, the sequencing read length was 125bp and the number of sequencing was 1G. And finally, completing genome splicing work of XIN-1 by using the sequencing data through genome splicing software PGCGAP.

Predictive analysis of the XIN-1 strain antibacterial active substance synthesis gene cluster is completed by online analysis software Antismath 3.0 and Bagel 3.0. As shown in panel A of FIG. 3, the genome of XIN-1 strain has a complete circular bacteriocin synthetic genome. The bacteriocin precursor peptide sequence in the gene cluster is as follows:

MLFELTGIGIGSGTAATIVNWIMWGMSAATILSLISGVASGGAWILAGAREALKAGGKKAAI AW。

the precursor peptide sequence was analyzed by BlastP and showed less than 36% homology to the amino acid sequence of the identified cyclic bacteriocin, indicating that it is a novel cyclic bacteriocin. The product secreted by this gene cluster was designated as baciclicin XIN-1 by the applicant.

(2) Preparation of bacteriocin-baciclicin XIN-1 secreted by Bacillus faciens XIN-1 strain

Single colonies of XIN-1 strain were picked and activated overnight in 5mL LB liquid medium. Transferring the strain into 10 bottles of 200mL LB culture solution according to the inoculum size of 1% (V/V), and culturing for 8h at 28 ℃ and 220 r/min; centrifuging the fermentation broth (12,000 r/min,10 min), and subjecting the obtained 2L supernatant to column chromatography with 200g macroporous adsorbent resin An Bo Lyte (Amberlite) XAD-7 HP; the column after adsorption is firstly treated with 1L ddH ₂ Washing with O, washing with 0.5L of 30% ethanol solution, and eluting with 0.5L of 80% ethanol (pH 2.0); concentrating the eluate at 40deg.C by rotary evaporator (note that pH of the eluate is adjusted and maintained at about 6.0 during concentration), spin-drying to about 5mL, collecting, and lyophilizing; dissolving the obtained dry powder in 50% acetonitrile (pH 5.0), centrifuging (12,000 r/min,10 min), and collecting supernatant as crude extract of antibacterial substance;

(3) Preparation of baciclicin XIN-1 pure product

Coarse liquid of antibacterial substance was obtained and analyzed by high pressure liquid chromatograph DionexUltimate3000 system:

the main technical parameters are as follows:

chromatographic column: agilent C18 reverse phase column (250 mm. Times.4.6 mm, 5. Mu.L);

mobile phase: ddH ₂ O (0.1% tfa) and acetonitrile;

mobile phase conditions: gradient elution is carried out for 0-20min and 10% -90% acetonitrile;

detection wavelength: 220nm

Flow rate: 1mL/min

Collecting the eluate eluted within 20min (20 times after 1 min), detecting antibacterial activity of the collected solution by agar diffusion, and judging antibacterial substance retention time. After the retention time of the bacteriostatic substances was determined, the collection was repeated a number of times, the spin-drying and freeze-drying treatments were carried out, the obtained powder was weighed and dissolved in 20% acetonitrile (pH 5.0), and its purity was checked under the same mobile phase conditions.

(4) Primary mass spectrometry of baciclicin XIN-1

The molecular weight of the pure antibacterial substance prepared above was measured by Mass spectrometer Agilent Technologies 6540UDH Accurate-Mass Q-TOF LC/MS.

Primary mass spectrometry conditions:

capillary voltage: 3,500V;

spray pressure: 35lb/in2 gauge;

drying gas flow rate: 9liters/min;

temperature: 350 ℃;

Q-TOF scan range: 100-3,000m/z;

data acquisition rate: 1 spoke/s.

As shown in FIG. 3, XIN-1 secreted active substance has a molecular weight of 5848.2032Da (monoisotopic peak). In contrast, the predicted cyclopeptide precursor peptide MLFELTGIGIGSGTAATIVNWIMWGMSAATILSLISGVASGGAWILAGAREALKAGGKKAAIAW was a mature peptide with a molecular weight of 5848.1792Da (measured by monoisotopic peaks) produced by cyclization of amino-and carboxy-termini of the remaining amino acid sequence LTGIGIGSGTAATIVNWIMWGMSAATILSLISGVASGGAWILAGAREALKAGGKKAAIAW after cleavage of the leader peptide MLFE. The molecular weight of the active substance is almost identical with that of the active substance secreted by XIN-1 at a molecular weight of 5848.2032Da, which proves that the active substance secreted by XIN-1 is baciclicin XIN-1.

(5) Primary mass spectrometry of polypeptide fragments after enzymatic hydrolysis of baciclicin XIN-1

To further demonstrate that the active substance secreted by XIN-1 is baciclicin XIN-1, we performed trypsin treatment on the active substance secreted by XIN-1 and performed mass spectrometry on the enzymatic fragment obtained. The specific operation is as follows: the active material pure product (about 0.4 mg) prepared above was dissolved in 0.1mL of 100mM ammonium bicarbonate buffer, trypsin (0.01 mg) was dissolved in 0.1mL of 100mM ammonium bicarbonate buffer, and the two were mixed and then treated at 37℃for 12 hours. The treated sample was subjected to mass spectrometry. The final polypeptide fragment was EALK, AGGK, AAIAWLTGIGIGSGTAATIVNWIMWGMSAATILSLISGVASGGAWILAGAR (see Table 1). All three fragments are polypeptide fragments existing in the baciclicin XIN-1, which further proves that the active substance secreted by XIN-1 is baciclicin XIN-1.

TABLE 1 Mass spectrometric analysis of enzymatic fragments of active substances secreted from XIN-1 after trypsin treatment

3. Determination of bacteriocylin XIN-1 bacteriostatic Activity

The thus obtained pure baciclicin XIN-1 was prepared into a test sample having a final concentration of (0.19,0.39,0.78,1.56,3.13,6.25, 12.5, 25, 50, 100. Mu.M). The bacteriocidal activity of baciclicin XIN-1 on 15 indicator bacteria at different concentrations was detected by the agar diffusion method described above. As shown in Table 2, baciclicin XIN-1 has bacteriostatic activity against Bacillus cereus ATCC14579, bacillus cereus ATCC49604, enterococcus faecalis ATCC29212, enterococcus faecalis ATCC51299, enterococcus faecium ATCC33186, listeria monocytogenes LM201, listeria monocytogenes CMCC54002, listeria monocytogenes ATCC19115, staphylococcus aureus ATCC29213, staphylococcus aureus ATCC43300, staphylococcus aureus ATCC6538, staphylococcus epidermidis CMCC26069, streptococcus pyogenes ATCC19615, streptococcus pneumoniae ATCC49619 and Streptococcus suis SC 19. The minimum inhibitory concentration of baciclicin XIN-1 against 15 pathogenic bacteria is in the range of 0.19-1.56. Mu.M.

TABLE 2 detection of bacicyclicin XIN-1 bacteriostatic Activity

^a NB, beef extract protein medium; LB, bacterial basal medium; TSB, trypticase soy peptone liquid medium; BHI, brain heart infusion culture medium

Reference to the literature

1.Cintas LM,Rodriguez JM,Fernandez MF,Sletten K,Nes IF,Hernandez PE,Holo H.Isolation and characterization of pediocin L50,a new bacteriocin from Pediococcusacidilactici with a broad inhibitory spectrum.Applied and environmental microbiology,1995,61:2643-8.

2.Cotter PD,Ross RP,Hill C.Bacteriocins-a viable alternative to antibioticsNature Reiewv Microbiology,2013,11:95-105.

3.Rea MC,Sit CS,Clayton E,O'Connor PM,Whittal RM,Zheng J,Vederas JC,Ross RP,Hill C.Thuricin CD,a posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile.Proceedings of the National Academy of Sciences of the United States of America,2010,107:9352-7.

4.Xin B,Zheng J,Xu Z,Li C,Ruan L,Peng D,Sun M.Three novel lantibiotics,ticins A1,A3,and A4,have extremely stable properties and are promising food biopreservatives.Applied.

Sequence listing

SEQ ID NO:1

The nucleotide sequence of the precursor peptide of the cyclic bacteriocin XIN-1 secreted by the Bacillus faciens XIN-1 strain: ATGTTATTCGAATTAACTGGTATTGGTATTGGCTCTGGTACAGCTGCAACTATTGTAAACTGGATTATGTGGGGAATGAGTGCTGCTACTATTCTTAGCTTAATTAGTGGAGTTGCAAGTGGTGGAGCATGGATCCTTGCAGGTGCTAGAGAAGCTCTTAAAGCAGGCGGTAAAAAAGCTGCTATTGCTTGGTAA

SEQ ID NO:2

Amino acid sequence of the precursor peptide of the cyclic bacteriocin XIN-1 secreted by the Bacillus faciens XIN-1 strain:

MLFELTGIGIGSGTAATIVNWIMWGMSAATILSLISGVASGGAWILAGAREALKAGGKKAAIAW

Organization Applicant

----------------------

Street :

City :

State :

Country :

PostalCode :

PhoneNumber :

FaxNumber :

EmailAddress :

<110> OrganizationName, university of North China

Application Project

-------------------

<120> Title bacteriocin XIN-1 having antibacterial Activity against various pathogenic bacteria

<130> AppFileReference :

<140> CurrentAppNumber :

<141> CurrentFilingDate : ____-__-__

Sequence

--------

<213> OrganismName : Bacillus xiangshan

<400> PreSequenceString :

atgttattcg aattaactgg tattggtatt ggctctggta cagctgcaac tattgtaaac 60

tggattatgt ggggaatgag tgctgctact attcttagct taattagtgg agttgcaagt 120

ggtggagcat ggatccttgc aggtgctaga gaagctctta aagcaggcgg taaaaaagct 180

gctattgctt ggtaa 195

<212> Type : DNA

<211> Length : 195

SequenceName : SEQ ID NO:1

SequenceDescription :

Sequence

--------

<213> OrganismName : Bacillus xiangshan

<400> PreSequenceString :

MLFELTGIGI GSGTAATIVN WIMWGMSAAT ILSLISGVAS GGAWILAGAR EALKAGGKKA 60

AIAW 64

<212> Type : PRT

<211> Length : 64

SequenceName : SEQ ID NO:2

SequenceDescription :

Claims

1. A bacteriocin XIN-1 having bacteriostatic activity against a plurality of pathogenic bacteria, characterized by:

the bacteriocin baciclicin XIN-1 is a cyclic bacteriocin with a molecular weight of 5848.2032 Da;

the nucleotide sequence of the precursor peptide of the bacteriocin XIN-1 is shown in a sequence table SEQ ID NO. 1.

2. The bacteriocin XIN-1 according to claim 1, wherein:

the amino acid sequence of the bacteriocin XIN-1 is shown in a sequence table SEQ ID NO. 2.

3. The bacteriocin XIN-1 according to any one of claims 1 or 2, characterized in that:

the bacteriocin Bacillus mucin XIN-1 is produced from Bacillus faciens XIN-1; the classification of Xiang Shanya Bacillus cell XIN-1 was named:Bacillus xiangshanXIN-1, accession number: china Center for Type Culture Collection (CCTCC), address: chinese, wuhan, university of Wuhan, date of preservation: 4/2/2020, accession number: cctccc NO: m2020064.