CN111500635A - Kit comprising a vector carrying a nucleic acid molecule - Google Patents

Abstract

The present application relates to a kit comprising a) a vector carrying a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID No. 11 and b) a pharmaceutically acceptable excipient. The vector has good expression effect, high expression speed and more stable expression strength. The application also provides cells and pharmaceutical compositions comprising the nucleic acid molecules, and their use in the manufacture of a medicament.

Description

Kit comprising a vector carrying a nucleic acid molecule

Technical Field

The application relates to the field of biomedicine, in particular to a nucleic acid molecule for treating crystalline retinal degeneration and a kit containing the nucleic acid molecule.

Background

Crystalline retinal degeneration (BCD) is a rare disease of retinal degeneration whose symptoms mainly include crystals in the cornea (clear cover), fine, yellow or white crystalline deposits deposited in the light-sensitive tissues of the retina, and progressive atrophy of the retina, choroidal capillaries and choroid. The deposits can damage the retina, resulting in a gradual loss of vision.

The study shows that BCD is a genetic disease caused by CYP4V2 gene mutation, and the CYP4V2 gene mutation is generally considered to destroy the functions of enzymes participating in fatty acid metabolism, thereby influencing lipolysis. Although the study of mutations in the CYP4V2 gene has provided the possibility for future gene therapy, no effective treatment is currently available.

Disclosure of Invention

The present application provides a vector carrying a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 11. The vector has good expression effect, high expression speed and more stable expression intensity, can be expressed in RPE cells of retina, can also be effectively expressed in a photoreceptor cell layer, has wide expression range and can play better treatment effect. The vector and/or the nucleic acid molecule can effectively reduce the lipid deposition condition of the RPE cell mutated by the CYP4V2 gene, recover the normal functions of damaged fatty acid metabolism and lipid decomposition of a BCD patient, recover the phagocytic capacity of the RPE cell of the BCD patient, enhance the phagocytic capacity of the RPE cell of a normal person, obviously improve the amplitude of a retina electrogram of a BCD mouse, improve the retina function of the BCD mouse, improve the RPE cell morphology of the BCD mouse and maintain the number of the RPE cells. In summary, the present application provides a vector and a kit comprising a specific CYP4V2 gene sequence and promoter sequence, and can significantly improve the expression effect of the CYP4V2 protein, effectively improve retinal function, and prevent or treat BCD. The carrier has effectiveness and practicability in different levels such as cell, organoid and animal level, and the like, and has very high guiding significance for application in human bodies in the future.

The application provides a kit comprising a) a vector carrying a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO. 11 and b) a pharmaceutically acceptable excipient.

In certain embodiments, the vector in the kit comprises a viral vector.

In certain embodiments, the vector in the kit comprises an AAV viral vector.

In certain embodiments, the vector in the kit comprises an AAV capsid.

In certain embodiments, the vector in the kit comprises an AAV8 serotype capsid.

In certain embodiments, the pharmaceutically acceptable excipient in the kit is suitable for subretinal administration.

In certain embodiments, the kit further comprises instructions for use, a dosing regimen, one or more fine needles, one or more syringes, and/or a solvent.

In another aspect, the present application provides a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO. 11.

In certain embodiments, the nucleic acid molecule comprises a viral packaging signal.

In certain embodiments, the viral packaging signal in the nucleic acid molecule comprises a recombinant AAV2/8 viral packaging signal.

In another aspect, the present application provides a cell comprising a nucleic acid molecule as described herein.

In another aspect, the present application provides a pharmaceutical composition comprising said nucleic acid molecule and/or said cell.

In another aspect, the application provides the use of the nucleic acid molecule, or the cell, in the manufacture of a medicament for treating, ameliorating and/or preventing a disease or disorder associated with atrophy of the Retinal Pigment Epithelium (RPE).

In certain embodiments, the disease or disorder comprises crystalline retinal degeneration.

Other aspects and advantages of the present application will be readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present application have been shown and described in the following detailed description. As those skilled in the art will recognize, the disclosure of the present application enables those skilled in the art to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention as it is directed to the present application. Accordingly, the descriptions in the drawings and the specification of the present application are illustrative only and not limiting.

Drawings

The specific features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates will be better understood by reference to the exemplary embodiments described in detail below and the accompanying drawings. The brief description of the drawings is as follows:

FIG. 1 shows a schematic representation of the structure of a nucleic acid molecule as described herein.

FIG. 2 shows the GFP fluorescence intensity of the vectors of different promoters.

FIG. 3 shows CYP4V2 protein expression from vectors with different promoters.

FIG. 4 shows the GFP fluorescence intensity of the vectors at different polyadenylation signal sites.

FIG. 5 shows CYP4V2 protein expression from vectors with different polyadenylation signal sites.

Fig. 6 shows AAV of different serotypes expressed on mouse retinas 1 week after injection, where a: AAV2, B: AAV5, C and D: AAV8, E: AAV9, F: local detection of 4 AAV serotypes.

FIG. 7 shows the effect of AAV8 virus with different promoters on iPSC-induced differentiation of RPE cells.

FIG. 8 shows the effect of AAV8 virus with different promoters on iPSC-induced differentiation of 3D-retinal organoids.

Fig. 9 shows protein expression of AAV8 virus from different promoters injected into mouse subretinal space, a: after 2 weeks, B: after 6 weeks.

FIG. 10A shows lipid deposition in a blank set of CYP4V2 KO-ARPE19 cell line, FIG. 10B shows lipid deposition in AAV8-CAG-CYP4V2 virus-infected CYP4V2 KO-ARPE19 cell line, and FIG. 10C shows CYP4V2 expression in AAV8-CAG-CYP4V2 virus-infected CYP4V2 KO-ARPE19 cell line versus wild-type ARPE 19.

FIG. 11A shows lipid deposition following infection of iPSC-induced RPE cells in normal and BCD patients with AAV8-CAG-CYP4V 2.

FIG. 11B shows the expression of CYP4V2 after infection of RPE cells induced by iPSC in normal and BCD patients with AAV8-CAG-CYP4V 2.

FIG. 12 shows the phagocytic capacity of cells after infection of iPSC-induced RPE cells by AAV8-CAG-CYP4V2 in normal and BCD patients.

FIG. 13A is a schematic view showing the subretinal injection of a mouse under a microscope.

FIG. 13B shows the fundus photographic deposits of crystals 3 or 6 months after BCD mice were injected with AAV8-CAG-CYP4V 2.

FIG. 14 shows CYP4V2 expression in BCD mice injected with AAV8-CAG-CYP4V 2.

FIG. 15 shows ERG levels 3 months after BCD mice injection of AAV8-CAG-CYP4V 2.

FIG. 16 shows ERG levels 6 months after BCD mice injection of AAV8-CAG-CYP4V 2.

FIG. 17 shows ERG dark response b-wave 6 months after BCD mice injected with AAV8-CAG-CYP4V 2.

FIG. 18 shows ERG levels 3 and 6 months after BCD mice were injected with AAV8-CAG-CYP4V 2.

Figure 19 shows RPE cell morphology improvement and number maintenance 6 months after BCD mouse treatment.

FIG. 20 shows a schematic diagram of the pAAV-CAG-CYP4V2 vector.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification.

Definition of terms

The present application is further described below: in the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms, and laboratory procedures used herein are all terms and conventional procedures used extensively in the relevant art. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

In the present application, the term "CYP 4V 2" generally refers to a protein that is member 2 of the cytochrome P450 family 4 subfamily V. The term "cytochrome P450," also known as cytochromeP450 or CYP450, generally refers to a family of heme proteins, belonging to the class of monooxygenases, that are involved in the metabolism of endogenous substances or exogenous substances including drugs, environmental compounds. According to the degree of homology of amino acid sequences, the members thereof are sequentially divided into three classes, namely families, subfamilies and enzyme individuals. The cytochrome P450 enzyme system may be abbreviated CYP, wherein families are indicated by arabic numerals, subfamilies are indicated by capital english letters, and enzyme individuals are indicated by arabic numerals, such as CYP4V2 in this application. The human CYP4V2 gene (HGNC: 23198) is 19.28kb in length, is located at 4q35, has 11 exons, and plays an important role in fatty acid metabolism (Kumar S., Bioinformation, 2011,7: 360-. CYP4V2 is expressed in almost all tissues, but at high levels in the retina and retinal pigment epithelium, and at slightly lower levels in the cornea, tissues. Mutations in the CYP4V2 gene may be associated with crystalloid retinal degeneration and/or posterior retinal pigment degeneration.

In the present application, the term "polyadenylation sequence", also known as polyadenylation tail, PolyA tail, generally refers to a single strand of several tens to several hundreds of adenylic acid added to the 3' end of the transcribed mRNA. Polyadenylation generally occurs during and after the transcription of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) within the nucleus of the cell, and is usually accomplished by polyadenylic acid polymerase. In eukaryotes, polyadenylation is a mechanism by which the mRNA molecule is interrupted at its 3' end, and the polyadenylation sequence protects the mRNA from exonuclease attack and is important for nuclear export, translation, and stability of the mRNA.

In the present application, the term "polyadenylation signal site" generally refers to a sequence of bases located 3' to messenger RNA (mRNA) that is recognized by polyadenylation-associated cleavage factors. And is also typically a cis-regulatory signal on the mRNA. In general, the process of tailing (i.e., polyadenylation) begins after transcription has terminated, with polyadenylation-associated cleavage factors followed by several tens to hundreds of single adenylates in the 3' UTR of the mRNA under the control of polyadenylation signal sites. Common tailed signals include SV40, BGH, HSV, TK signals, and the like. The polyadenylation-associated lytic factor may include lytic/polyadenylation specific factor (CPSF), lytic stimulatory factor (CstF), lytic factor i (cfi), lytic factor ii (cfii). The polyadenylation signal site may typically comprise an AAUAAA sequence, but differs between eukaryotic groups. For example, most human polyadenylation signal sites contain an AAUAAA sequence, but this sequence is less common in plants and fungi.

In the present application, the term "operably linked" generally refers to the placement of the regulatory sequences necessary for the expression of a coding sequence in an appropriate position relative to the coding sequence in order to achieve expression of the coding sequence. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. In certain embodiments, the arrangement of coding sequences and transcriptional control elements in an expression vector may be expressed. The control elements may include promoters, enhancers and termination elements. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. In certain embodiments, "operably linked" may also refer to the linkage of a gene of interest into a vector such that transcriptional and translational control sequences within the vector perform their intended functions of regulating the transcription and translation of the gene of interest.

In the present application, the term "promoter" generally refers to a sequence of deoxyribonucleic acid (DNA) that enables transcription of a particular gene. The promoter is recognized by RNA polymerase and transcription to synthesize RNA begins. In ribonucleic acid (RNA) synthesis, promoters may interact with transcription factors that regulate gene transcription, controlling the timing of initiation and the extent of expression of a gene (transcription). The promoter comprises a core promoter region and a regulatory region, is located upstream (5' direction of DNA antisense strand) of the transcription initiation site of a gene in a regulatory sequence controlling the expression of the gene, and has no coding function per se. The method is divided into three categories according to the action mode and the function: constitutive promoters (which maintain sustained activity in most or all tissues), specific promoters (tissue-specific or developmental stage-specific), and inducible promoters (which are regulated by external chemical or physical signals).

In this application, the term "Retinal Pigment Epithelium (RPE)" generally refers to a layer of pigmented cells that lie next to the outside of the sensory nerve of the retina. The retinal pigment epithelium consists of a monolayer of hexagonal cells containing a dense population of pigment particles. The Retinal Pigment Epithelium (RPE), which is tightly associated with underlying choroid and overlying retinal nerve cells, may have major functions including: control the fluid and nutrients in the subretinal space, functioning as a blood-retinal barrier; synthesizing growth factors to adjust local structure; absorbing light, and adjusting electric balance; regeneration and synthesis of visual pigment; phagocytosis and digestion of photoreceptor outer segments; maintaining the attachment of the retina; regeneration and repair after injury. RPE is generally considered to be an important tissue for maintaining photoreceptor function, and is also affected by many pathologies of the choroid and retina.

In this application, the term "Retinal Pigment Epithelium (RPE) atrophy" generally refers to the degenerative changes in the Retinal Pigment Epithelium (RPE) manifested as cell death or dysfunction.age-related macular degeneration or retinal pigment degeneration (RP) is usually accompanied by retinal pigment epithelium atrophy.Retention pigment degeneration (Retention Pigmentosa, abbreviated as RP) is also known as retinochrome, which generally refers to a class of inherited ophthalmic diseases that inherit in three forms, autosomal recessive, dominant and X-linked recessive, as well as bi-genetic and mitochondrial inheritance.

In the present application, the term "crystalline retinal degeneration" generally refers to a class of autosomal recessive inherited eye diseases first described by the italian ophthalmologist GBBietti, doctor in 1937. The main symptoms include crystals in the cornea (clear cover), fine, yellow or white crystalline deposits deposited in the light-sensitive tissues of the retina, and progressive atrophy of the retina, choroidal capillaries and choroid. Crystalline retinal degeneration may include diseases caused by mutations in the CYP4V2 gene.

In the present application, the term "vector" generally refers to a nucleic acid vehicle into which a polynucleotide encoding a protein can be inserted and the protein expressed. The vector may be transformed, transduced or transfected into a host cell so that the genetic material elements it carries are expressed in the host cell. By way of example, the carrier includes: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or artificial chromosomes (PACs) derived from P1; bacteriophage such as lambda phage or M13 phage and viral vector. A vector may contain a variety of elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may contain a replication initiation site. The vector may also include components which assist its entry into the cell, such as viral particles, liposomes or protein coats, but not exclusively.

In the present application, the term "viral vector" is generally intended to refer to a non-wild-type recombinant viral particle that serves as a gene delivery vector and comprises a recombinant viral genome packaged within a viral capsid. Animal virus species used as vectors may include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses (AAV), herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papilloma polyomavirus vacuolium (e.g., SV 40).

In this application, the term "AAV" is a standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells, some of which are provided by co-infection helper viruses. There are currently thirteen AAV serotypes that have been characterized, as shown in table 1 below. General information and reviews on AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses (Handbook of Parvoviruses), Vol.1, pp.169-228 and Berns, 1990, Virology (Virology), pp.1743-1764, Raven Press, (New York). However, it is fully expected that these same principles will apply to additional AAV serotypes, since it is known that the various serotypes are very closely related, both structurally and functionally, even at the genetic level. For example, all AAV serotypes apparently exhibit very similar replication characteristics mediated by homologous rep genes; and all carry three related capsid proteins, such as those expressed in AAV 6. Relatedness is further demonstrated by heteroduplex analysis, which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of similar self-annealing segments at the end corresponding to the "Inverted Terminal Repeat (ITR)". Similar infection patterns also indicate that replication functions in each serotype are under similar regulatory control.

TABLE 1 AAV capsid protein serotypes

In the present application, the term "AAV vector" generally refers to a vector comprising one or more polynucleotides of interest (or transgenes) flanked by AAV terminal repeats (ITRs). Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been transfected with a vector encoding and expressing rep and cap gene products. The term "AAV virion" or "AAV viral particle" or "AAV vector particle" refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered into a mammalian cell), it is often referred to as an "AAV vector particle" or simply an "AAV vector". Thus, production of AAV vector particles necessarily includes production of AAV vectors such that the vectors are contained within the AAV vector particles.

The AAV "rep" gene and "cap" gene refer to genes encoding replication protein and capsid protein, respectively. AAV rep and cap genes have been found in all AAV serotypes studied to date and are described herein and in the references cited. In wild-type AAV, the rep and cap genes are typically adjacent to each other in the viral genome (i.e., they are "coupled" together into contiguous or overlapping transcription units), and they are typically conserved among AAV serotypes. The AAV rep and cap genes may also be referred to individually or collectively as "AAV packaging genes". The AAV Cap gene encodes a Cap protein that is capable of packaging an AAV vector in the presence of rep and adenoviral helper functions and that is capable of binding to a target cell receptor. In certain instances, the AAV cap gene encodes a capsid protein having a sequence derived from a particular AAV serotype, such as the serotypes set forth in table 1.

The different serotypes of AAV have genomic sequences that are significantly homologous at the amino acid and nucleic acid levels, provide a set of similar genetic functions, produce virions that are essentially physically and functionally equivalent, and replicate and assemble by nearly identical mechanisms.

The terms "polynucleotide", "nucleic acid molecule", "nucleotide sequence", "nucleic acid", and "oligonucleotide" are used interchangeably and generally refer to a polymeric form of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. The polynucleotide may have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of nucleic acid molecules: coding or non-coding regions of a gene or gene fragment, multiple loci (one locus) defined according to ligation analysis, exons, introns, messenger RNA (mrna), transfer RNA, ribosomal RNA, short interfering RNA (sirna), short hairpin RNA (shrna), micro-RNA (mirna), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Nucleic acid molecules may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modification of the nucleotide structure, if present, may be performed before or after assembly of the polymer. The sequence of the nucleic acid molecule may be interrupted by non-nucleotide components. The nucleic acid molecule may be further modified after polymerization, such as by conjugation with a labeled component.

In the present application, the terms "polypeptide," "peptide," "protein," and "protein" are used interchangeably and generally refer to a polymer of amino acids of any length.

In addition to the specific proteins and nucleic acid molecules mentioned herein, the present application may also include functional variants, derivatives, analogs, homologs, and fragments thereof.

The term "functional variant" refers to a polypeptide that has substantially the same amino acid sequence as a naturally occurring sequence or is encoded by substantially the same nucleotide sequence and is capable of one or more of the activities of a naturally occurring sequence. In the context of this application, a variant of any given sequence refers to a sequence in which the particular sequence of residues (whether amino acid or nucleotide residues) has been modified such that the polypeptide or polynucleotide substantially retains at least one endogenous function. Variant sequences may be obtained by addition, deletion, substitution, modification, substitution and/or variation of at least one amino acid residue and/or nucleotide residue present in the naturally occurring protein and/or polynucleotide, so long as the original functional activity is retained.

In the present application, the term "derivative" generally refers to a polypeptide or polynucleotide of the present application including any substitution, variation, modification, substitution, deletion and/or addition from/to one (or more) amino acid residues of the sequence, so long as the resulting polypeptide or polynucleotide substantially retains at least one of its endogenous functions.

In the present application, the term "analog" generally with respect to a polypeptide or polynucleotide includes any mimetic of a polypeptide or polynucleotide, i.e., a chemical compound that possesses at least one endogenous function of the polypeptide or polynucleotide that the mimetic mimics.

Typically, amino acid substitutions, such as at least 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 20) amino acid substitutions can be made so long as the modified sequence substantially retains the desired activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogs.

The proteins or polypeptides used in the present application may also have deletions, insertions or substitutions of amino acid residues which produce silent changes and result in a functionally equivalent protein. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues, as long as endogenous function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with similar hydrophilicity values without an electrically polar head group include asparagine, glutamine, serine, threonine, and tyrosine.

In the present application, the term "homologue" generally refers to an amino acid sequence or a nucleotide sequence having a certain homology with the wild-type amino acid sequence and the wild-type nucleotide sequence. The term "homology" may be equivalent to sequence "identity". A homologous sequence can include an amino acid sequence that is at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence. Typically, homologues will comprise the same active site etc. as the subject amino acid sequence. Homology may be considered in terms of similarity (i.e., amino acid residues with similar chemical properties/functions), or may be expressed in terms of sequence identity. In the present application, a sequence having a percent identity to any one of SEQ ID NOs of the referenced amino acid sequence or nucleotide sequence refers to a sequence having said percent identity over the entire length of the referenced SEQ ID NO.

To determine sequence identity, sequence alignments can be performed, which can be performed in a variety of ways as understood by those skilled in the art, e.g., using B L AST, B L AST-2, A L IGN, NEED L E, or Megalign (DNASTAR) software, etc.

In the present application, the term "prevention" generally refers to prophylactic administration of a combination to a healthy subject to prevent the occurrence of a certain disease or disorder. It may also comprise prophylactic administration of the combination to a patient at a pre-stage of the allergic disease to be treated. "preventing" does not require 100% elimination of the likelihood of the occurrence of a disease or condition, in other words "preventing" generally means that the likelihood of the occurrence of a disease or condition is reduced in the presence of the administered combination.

In this application, the term "alleviating" refers to reducing, diminishing or delaying a condition, disease, disorder or phenotype. The condition, disease, disorder or phenotype may include subjective perception by the subject, such as pain, dizziness or other physiological disorder, or medically detectable indication, such as a disease condition detected by medical testing means.

In the present application, the term "treatment" generally refers to clinical intervention to alter the natural course of the treated individual or cell in the course of clinical pathology. May include improving the disease state, eliminating the lesion, or improving prognosis.

In the present application, the term "cell" may generally be, or have been, a single cell, cell line, or cell culture that is the recipient of a nucleic acid molecule or vector.

In the present application, the term "pharmaceutical composition" generally refers to compositions that are suitable for administration to a patient, a human patient. For example, a pharmaceutical composition described herein, which may comprise a nucleic acid molecule described herein, a vector described herein, and/or a cell described herein, and optionally a pharmaceutically acceptable adjuvant. In addition, the pharmaceutical composition may further comprise suitable formulations of one or more (pharmaceutically effective) carriers, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and/or preservatives. The acceptable ingredients of the composition may be non-toxic to the recipient at the dosages and concentrations employed. The pharmaceutical compositions of the present application include, but are not limited to, liquid, frozen and lyophilized compositions.

In this application, the term "and/or" should be understood to mean either one of the options or both of the options.

In the present application, the term "comprising" or "comprises" is generally intended to include the explicitly specified features, but not to exclude other elements.

In the present application, the term "about" generally means varying from 0.5% to 10% above or below the stated value, for example, varying from 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the stated value.

Detailed Description

CYP4V2

In one aspect, the present application provides a nucleic acid molecule comprising a polynucleotide encoding CYP4V 2. In the present application, CYP4V2 may comprise a class of proteins, the dysfunction of which or mutations in genes encoding them, which may lead to crystal-like retinal degeneration, including but not limited to CYP4V2 or functional variants thereof from humans, chimpanzees, gorillas, rhesus monkeys, dogs, cows, mice, rats, chickens, drosophila, nematodes or frogs. For example, the CYP4V2 may comprise human CYP4V 2. In the present application, the polynucleotide encoding CYP4V2 may encode the amino acid sequence shown in SEQ ID NO. 5. For example, the polynucleotide encoding CYP4V2 may encode an amino acid sequence which is at least 90% homologous, e.g. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homologous, to the amino acid sequence depicted in SEQ ID NO. 5.

In certain instances, a polynucleotide encoding CYP4V2 described herein can comprise the sequence of the naturally occurring CTP4V2 polynucleotide following a synonymous mutation. In some cases, a polynucleotide encoding CYP4V2 described herein can comprise the nucleotide sequence set forth in SEQ ID NO. 4. For example, the polynucleotide encoding CYP4V2 can comprise a nucleotide sequence that is at least 90% homologous to the nucleotide sequence set forth in SEQ id No. 4, e.g., any one of the polynucleotide sequences that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homologous.

The 5' end of the polynucleotide encoding CYP4V2 of the present application may comprise a kozak sequence, for example, the kozak sequence may comprise the nucleotide sequence shown in SEQ ID NO. 10.

Promoters

The promoter may also comprise a CAG promoter (hybrid CMV early enhancer/chicken β actin promoter, also known as CAGGS promoter, CB promoter or CBA promoter), human β actin promoter, small CBA (smcba) promoter, CBs promoter or CBh promoter, elongation factor 1 α short (EFS) promoter, elongation factor 1 α (EF-1 α) promoter, CMV promoter, PGK promoter, UBC promoter, GUSB promoter, UCOE promoter, VMD 5632 (also known as BEST 1) promoter, ophybrid EFS promoter, CYP4V2 self promoter, RPE65 promoter or a variant or derivative thereof.

For example, the promoter may comprise the nucleotide sequence shown in SEQ ID NO. 2. For example, the promoter may comprise a nucleotide sequence that is at least 90% homologous to the nucleotide sequence set forth in SEQ ID NO. 2, e.g., any one of the polynucleotide sequences that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

In the present application, the promoter may be operably linked to the polynucleotide encoding CYP4V 2. In some cases, the promoter may be located 5' to the polynucleotide encoding CYP4V 2.

The promoter described herein enables efficient expression of a gene encoding a protein.

Polyadenylation signal site

In the present application, the vector may further comprise a polyadenylation signal site. The polyadenylation signal site may comprise an SV40 signal site, a BGH signal site, a WPRE-SV40 signal site, a WPRE-BGH signal site or derivatives thereof.

In certain instances, the polyadenylation signal site is recognized by polyadenylation-associated cleavage factors to generate the SV40 polyadenylation sequence, the BGH signal polyadenylation sequence, the HSV signal polyadenylation sequence, the TK signal polyadenylation sequence, the WPRE signal polyadenylation sequence, and the like. For example, the polyadenylation signal site may be a BGH signal site and may comprise the nucleotide sequence shown in SEQ ID NO. 3. For example, the polyadenylation signal site may comprise a nucleotide sequence which is at least 90% homologous to the nucleotide sequence set forth in SEQ ID NO. 3, e.g., any polynucleotide sequence which is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

In some cases, the polyadenylation signal site may be located 3' to the polynucleotide encoding CYP4V 2.

Nucleic acid molecules

In one aspect, the present application provides a nucleic acid molecule which may comprise, from 5 'to 3', the promoter, the polynucleotide encoding CYP4V2, and the polyadenylation signal site in that order. For example, the promoter may comprise the nucleotide sequence shown in SEQ ID NO. 2, the polynucleotide encoding CYP4V2 may comprise the nucleotide sequence shown in SEQ ID NO. 4, and the polyadenylation signal site comprises the nucleotide sequence shown in SEQ ID NO. 3. Wherein the polynucleotide encoding CYP4V2 may comprise a kozak sequence (SEQ ID NO: 10) at its 5' end.

The nucleic acid molecules described herein can be linear nucleic acid molecules.

In the present application, the nucleic acid molecule may comprise the nucleotide sequence shown in SEQ ID NO. 11. For example, the nucleic acid molecule can comprise a nucleotide sequence having at least 80% (e.g., at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%) sequence homology to the nucleotide sequence set forth in SEQ ID NO: 11.

Carrier

The present application provides a vector comprising a nucleic acid molecule as described herein. The vector may comprise a linear vector or a non-linear vector.

In the present application, the vector may include a plasmid, a phagemid, a cosmid, an artificial chromosome such as a Yeast Artificial Chromosome (YAC), a Bacterial Artificial Chromosome (BAC), or an artificial chromosome (PAC) of P1 origin, a bacteriophage such as a lambda phage or M13 phage, and a viral vector.

The vectors described herein may include viral vectors. In some cases, the viral vector may include a retrovirus (including lentivirus), an adenovirus, an adeno-associated virus (AAV vector), a herpes virus (e.g., herpes simplex virus), a poxvirus, a baculovirus, a papilloma virus, a papovavirus (e.g., SV 40). The nucleic acid molecule may be comprised in a viral vector.

For example, the vector may comprise an AAV vector. The AAV vector genes may comprise Inverted Terminal Repeats (ITRs), an Open Reading Frame (ORF), which may include polynucleotides encoding Rep proteins, and may also include polynucleotides encoding capsids. The AAV vector may also include a recombinant adeno-associated viral vector (rAAV vector).

In some cases, the vector may further comprise a restriction enzyme site downstream of the promoter to allow insertion of the polynucleotide encoding the CYP4V2, wherein the promoter and restriction enzyme site may be located downstream of the 5 'AAV ITR and upstream of the 3' AAV ITR. In some cases, the vector may further comprise a post-transcriptional regulatory element downstream of the restriction enzyme site and upstream of the 3' AAV ITRs. In some cases, the vector may further comprise a polynucleotide inserted at the restriction site and operably linked to a promoter, wherein the polynucleotide may comprise the coding region of CYP4V 2. As will be appreciated by those skilled in the art, any of the AAV vectors disclosed in the present application may be used in the methods as viral constructs to produce recombinant AAV.

In some cases, one or more helper plasmids or helper viruses comprising adenoviral or baculovirus helper genes may provide helper functions. Non-limiting examples of adenoviral or baculovirus helper genes include, but are not limited to, E1A, E1B, E2A, E4, and VA, which can provide helper functions for AAV packaging.

Helper viruses for AAV are known in the art and may include, for example, viruses from the Adenoviridae (adenviridae) and Herpesviridae (Herpesviridae). One skilled in the art will appreciate that any helper virus or helper plasmid of AAV that can provide sufficient helper functions for AAV may be used herein.

In some cases, the AAV cap gene may be present in a plasmid. The plasmid may also comprise an AAV rep gene. Rep genes and/or cap genes from any AAV serotype (including but not limited to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and any variants thereof) may be used herein to produce recombinant AAV. In some cases, the AAV cap gene may encode a capsid from serotype 1, serotype 2, serotype 3B, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype 13, or variants thereof.

For example, the capsid, ITRs and other selected AAV components in the recombinant adeno-associated viral vector can be independently selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, DJ/8, Rh10 any known or mentioned variant of an AAV or a yet to be discovered AAV or variant or mixture thereof.

In some cases, the capsid sequence of the vector may be provided by another plasmid. For example, it can be provided by AAV-RC8, and its vector sequence can be shown in SEQ ID NO. 9. For example, the capsid sequence can comprise a nucleotide sequence having at least 80% (e.g., at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%) sequence homology to the nucleotide sequence set forth in SEQ id No. 9. In some cases, the capsid sequence may further comprise amino acid mutations.

In certain instances, the AAV vector may be any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, AAVAnc80, DJ/8, Rh 10. For example, the AAV vector is an ocular tissue affinity AAV vector, e.g., AAV2, AAV3, AAV4, AAV5, AAV8, DJ/8, or any rAAV vector.

In some cases, insect or mammalian cells can be transfected with helper plasmids or helper viruses, viral constructs and plasmids encoding the AAVcap gene; and recombinant AAV viruses can be collected at various time points after co-transfection. For example, the recombinant AAV virus can be collected at about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, or at a time between any two of these time points after co-transfection.

In certain instances, the AAV vector can be AAV2/2, AAV2/5, AAV2/8, or AAV 2/9.

For example, the viral vector may comprise AAV 2/8.

For example, the viral vector may comprise a vector backbone from AAV. The vector backbone may comprise the nucleotide sequence shown in SEQ ID NO. 8. For example, the vector backbone can comprise a nucleotide sequence having at least 80% (e.g., at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%) sequence homology to the nucleotide sequence set forth in SEQ ID NO. 8.

Recombinant AAV may also be produced using any conventional method known in the art suitable for producing infectious recombinant AAV. In some cases, recombinant AAV can be produced by using insect cells or mammalian cells that stably express components necessary for AAV particle production. For example, a plasmid (or plasmids) comprising the AAV rep and cap genes and a selectable marker, such as a kanamycin resistance gene, can be integrated into the genome of the cell. The insect or mammalian cells can then be co-infected with a helper virus (e.g., an adenovirus or baculovirus that provides helper function) and a viral vector comprising 5 'AAV ITRs and 3' AAV ITRs (and, if desired, a nucleotide sequence encoding a heterologous protein). The advantage of this approach is that the cells are selectable and suitable for large-scale production of recombinant AAV. As another non-limiting example, adenovirus or baculovirus, rather than plasmid, can be used to introduce the rep and cap genes into the packaging cell. As yet another non-limiting example, both a viral vector containing 5 'AAV ITRs and 3' AAV ITRs and a viral vector containing a rep-cap gene can be stably integrated into the DNA of a producer cell, and helper functions can be provided by a wild-type adenovirus to produce a recombinant AAV.

In certain instances, the vectors described herein may comprise a5 'non-coding region and/or a 3' non-coding region. The 5 'non-coding region and/or the 3' non-coding region may have a variety of sequences, with an exemplary 5 'non-coding region nucleotide sequence being shown in SEQ ID NO. 6 and an exemplary 3' non-coding region nucleotide sequence being shown in SEQ ID NO. 7. In other cases, the vectors described herein may not contain a5 'non-coding region and/or a 3' non-coding region.

The vectors described herein may be provided with a selection marker, which may include an antibiotic selection marker. For example, the antibiotic selection marker may comprise a kanamycin selection marker.

For example, the vector described herein can comprise a map as shown in fig. 20. For example, the vector described herein may comprise the nucleotide sequence set forth in SEQ ID NO. 1. For example, the vector may comprise a nucleotide sequence which is at least 90% homologous to the nucleotide sequence shown in SEQ ID No. 1, such as any one of the polynucleotide sequences which is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homologous.

The vectors described herein can be administered to the eye by retinal or vitreous administration. In a possible mode of administration, the carrier may be administered as an injectable liquid. For example, the carrier may be administered as an injectable liquid, by capsule or syringe.

Reagent kit

The present application provides a kit that can include a nucleic acid molecule, vector, as described herein. The kits described herein may further comprise a buffer and/or a pharmaceutically acceptable excipient. As is well known in the art, a pharmaceutically acceptable excipient is a relatively inert substance that facilitates administration of a pharmaceutically effective substance and may be provided as a liquid solution or suspension, as an emulsion, or as a solid form suitable for dissolution or suspension in a liquid prior to use. For example, the excipient may impart a form or consistency or act as a diluent. Suitable excipients may include, but are not limited to, stabilizers, lubricants or emulsifiers, salts for varying osmotic pressure, encapsulating agents, pH buffering substances and buffers. For example, the excipient may comprise an agent suitable for direct delivery to the eye, which may be administered without undue toxicity. Pharmaceutically acceptable excipients may include, but are not limited to, liquids, for example, water, saline, glycerol, and ethanol. Pharmaceutically acceptable salts may also be included therein, including, but not limited to, inorganic salts such as hydroxides, mild bromides, phosphates, sulfates, and the like; and organic salts such as acetates, propionates, benzoates, and the like.

In protocols involving subretinal injection, the pharmaceutically acceptable excipient may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can be a sterile liquid such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil and the like. Saline solutions and aqueous dextrose, polyethylene glycol, and glycerol solutions may also be employed as liquid carriers, particularly injectable solutions. Additional ingredients such as preservatives, buffers, isotonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, solubilizing agents and the like may also be used. The kits described herein may be packaged in single unit dose or multi-dose form. The contents of the kit are typically configured as sterile and substantially isotonic solutions.

In the present application, the vector comprising the nucleic acid molecule may be present in the same or different excipient as the other components (e.g., capsid encoding sequences).

The kits described herein can further include other materials required from the commercial and user standpoint, including other buffers, diluents, filters, pillows, syringes, and inserts with instructions for performing any of the methods described herein. Suitable packaging materials may also be included and may be any packaging material consistent with the art, such as vials, ampoules, canisters, flexible packaging, and the like. These articles of manufacture may be further sterilized and/or sealed. The kits of the present application may further comprise instructions for use, a dosing regimen, one or more fine needles, one or more syringes, and a solvent.

Cells

In some cases, the cells may comprise bacterial cells (e.g., E.coli), yeast cells, or other eukaryotic cells, such as COS cells, Chinese Hamster Ovary (CHO) cells, He L a cells, HEK293 cells, COS-1 cells, NS0 cells, or myeloma cells, 293T cells.

The cells described herein may comprise retinal cells, corneal cells, choroidal cells, lens cells, neural cells, RPE cells, stem cells, which may comprise induced pluripotent stem cells (ipscs), Embryonic Stem Cells (ESCs), Mesenchymal Stem Cells (MSCs), adult stem cells, or any cell derived from stem cells. For example, the retinal cells, corneal cells, choroidal cells, lens cells, neural cells, RPE cells may be induced to differentiate by the stem cells. For another example, the cells can comprise ARPE-19 cells, human iPSC-induced RPE cells.

Pharmaceutical composition

In another aspect, the present application provides a pharmaceutical composition comprising said vector and/or said cell. The pharmaceutical composition may further comprise an optional pharmaceutically acceptable adjuvant. In certain instances, the pharmaceutical compositions described herein may also include suitable formulations of one or more (pharmaceutically effective) carriers, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and/or preservatives.

In certain instances, the acceptable ingredients of the compositions are not toxic to the recipient at the dosages and concentrations employed. In certain instances, the pharmaceutical compositions include, but are not limited to, liquid, frozen, and lyophilized compositions. In certain instances, the pharmaceutically acceptable adjuvants may include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents that are compatible with pharmaceutical administration, are generally safe, non-toxic, and are neither biologically nor otherwise undesirable.

For example, the pharmaceutical composition may comprise parenteral, transdermal, intracavity, intraarterial, intrathecal and/or intraocular administration or direct injection into tissue.

For example, the pharmaceutical composition may be administered to a patient or subject by instillation, infusion or injection. For example, the pharmaceutical composition may be administered without interruption (or continuously). For example, the uninterrupted (or continuous) administration may be achieved by a small pump system worn by the patient to measure the therapeutic agent flow into the patient, as described in WO 2015/036583.

In the present application, the subject may include humans and non-human animals. For example, the subject may include, but is not limited to, a cat, dog, horse, pig, cow, sheep, rabbit, mouse, rat, or monkey.

Use of

In another aspect, the application provides the use of said vector, or said cell, in the manufacture of a medicament for the treatment, alleviation and/or prevention of a disease or condition associated with atrophy of the Retinal Pigment Epithelium (RPE). In some cases, the disease or disorder includes retinal degeneration.

In some cases, the retinitis pigmentosa may include monocular primary retinitis pigmentosa, quadrant primary retinitis pigmentosa, central or paracentric primary retinitis pigmentosa, achromotensic retinitis pigmentosa, punctate retinitis pigmentosa, crystalloid retinitis, venous retinitis pigmentosa, arteriolar parachromic retinitis pigmentosa, L eber congenital amaurosis, and retinitis pigmentosa in other syndromes.

For example, the crystalline retinal degeneration may include a disease caused by a mutation in the CYP4V2 gene.

In certain instances, the CYP4V2 gene mutations can include, but are not limited to, missense mutations, replication errors, splice site errors, frameshifts, base deletions or insertions, nonsense mutations, polymorphisms (e.g., single nucleotide polymorphisms), premature termination, partial or complete CYP4V2 gene deletions, and unidentified CYP4V2 gene variations associated with crystalline retinal degeneration.

For example, the CYP4V2 gene mutations may include the mutations shown in table 2:

TABLE 2 mutant part types of CYP4V2 Gene

The mutants of CYP4V2 gene shown in Table 2 can be self-organized in databases

And (4) obtaining.

Without intending to be bound by any theory, the following examples are intended merely to illustrate the fusion proteins, methods of preparation, uses, etc., of the present application, and are not intended to limit the scope of the invention of the present application.

Examples

Example 1 construction of vectors

Construction of nucleic acid molecules: including the promoter, CYP4V2 coding region and terminator signals, and a kozak sequence is added to the 5' end of the coding region to promote translation. Wherein, the carrier promoter is CAG, and the nucleotide sequence is shown as SEQ ID NO. 2; the sequence of kozak is shown as SEQ ID NO. 10; the human CYP4V2CDS nucleotide sequence is shown in SEQ ID NO: 4; the terminator is BGH, and the nucleotide sequence is shown in SEQ ID NO. 3. The nucleotide sequence of the framework vector is shown as SEQ ID NO. 8. The sequence of the nucleic acid molecule is shown as SEQ ID NO. 11.

Construction of the vector pAAV-CAG-CYP4V 2: the vector backbone is pAAV plasmid, the ITR sequences are from AAV2, and the nucleic acid molecule is inserted between two ITRs to obtain vector pAAV-CAG-CYP4V2, which is shown in FIG. 1.

Construction of AAV vectors for different promoters: AAV vectors comprising a promoter, CYP4V2CDS sequence and terminator were constructed using different promoters CMV (SEQ ID NO: 18), EFS (SEQ ID NO: 16) and EF1a (SEQ ID NO: 17) to express CYP4V 2.

Additionally, reporter vectors for different promoters were constructed: GFP CDS is connected to the 3' end of the CYP4V2CDS sequence of the AAV vector with different promoters to serve as a reporter gene, and reporter vectors containing different promoters are constructed.

Cloning each fragment and synthesizing a vector, transforming the obtained viral vector into an escherichia coli competent cell, shaking bacteria for sequencing, and extracting a plasmid by using an extraction kit (Omega, D6915-04).

Example 2 packaging and purification

(1) Virus package

Day 0: cell seeding (inoculum size 1X 10)⁷) 293T cells were seeded in 15 cm dishes. Day 1: 293T cells were transfected with 20ml of complete medium (Gibco, C11965500 BT) containing 10% serum (FSP 500, Gittiferaceae, Shanghai) at 80% -90%. Day 2: after 12-18 hours of transfection, 30ml of fresh complete medium is replaced. Day 3: 30ml of complete medium is replaced by fresh medium after 48 hours of transfection. Day 4: after 72h of transfection, 293T cells were trypsinized according to the conventional method and collected to 50 mlThe tubes were washed twice with PBS, centrifuged at 1200 rpm for 5min, blotted to dryness, and frozen in a-80 ℃ freezer.

(2) Virus purification

Packaging the obtained AAV293T cells and thawing. The cells were resuspended in cell lysate (150 mM NaCl, 50mM Tris, pH 8.5). Chloroform in a half volume (3 ml) of the cell lysate was added to the tube, the tube was tightened, and the tube was horizontally placed on a 37 ℃ shaker at 250rpm for 30 min. 5M sodium chloride was added and mixed well. Transferring to a high-speed centrifuge tube, and centrifuging for 25min at 11000 rpm. Taking the upper water phase, transferring the part which is not easy to be absorbed at the interface to a 1.5ml centrifuge tube, centrifuging at 12000rpm for 30s, combining the supernatants, adding nuclease (Benzonase) into the upper water phase to a final concentration of 50U/ml, adding sodium deoxycholate to a final concentration of 0.4%, and adding MgCl to a final concentration of 10mM₂0.5mM CaCl ₂5 IU/ml Turbo DNase I, 25 ug/ml RNaseA (stock concentration 10 mg/ml). Water bath at 37 ℃ for 30 min. Adding 50% PEG8000, shaking, mixing, standing on ice for 1hr, and centrifuging at 11000rpm for 25 min. The supernatant was aspirated and discarded, and centrifuged again for 1min to remove the residual supernatant. PBS was added according to the final dissolution volume requirement, blown into suspension, and transferred to a 1.5ml centrifuge tube. Add 500. mu.l chloroform, shake, centrifuge at 12000rpm for 20 min. Sucking supernatant under aseptic condition, and packaging at-80 deg.C.

Example 3 validation of promoter Strength Using EGFP as reporter Gene

Respectively transfecting 293T cells (ATCC, CR L-3216) with reporter vector plasmids of different promoters, which comprises the steps of firstly separating the 293T cells (ATCC, CR L-3216) to a 35mm cell culture dish on the first day, preparing a transfection system by adding 2 mu g of the plasmid obtained in example 2 into 100 mu l of serum-free DMEM, adding 3 mu l of PEI, uniformly mixing, standing for 20min, adding the transfection system into a cell culture medium, uniformly shaking, placing in CO₂In the incubator, the solution was changed after 6 hours or overnight, and the fluorescence signal was observed by a fluorescence microscope (L ife AMF 4305) after 24 hours.

As shown in FIG. 2, the vectors with different promoters can express GFP, the expression effect of the CAG and EF1a promoters is good, the CMV promoter is second, and the EFS promoter is weak.

Example 4 verification of promoter Strength by CYP4V2 expression

293T cells (ATCC, CR L-3216) were transfected with reporter plasmids of different promoters respectively, after 48 hours, the cells were lysed with RIPA lysate (Beijing prilley C1053-100), and protein gel was run, Western blot was used to detect the expression of CYP4V2, and the antibodies used were anti-CYP4V2 (Atlas, HPA 029122), anti-actin (Abclonal, AC 026), and coat-anti-rat (Abclonal, AS 014), and after 24 hours, fluorescence signals were observed with a fluorescence microscope (L ife AMF 4305).

As shown in FIG. 3, the vectors with different promoters can express CYP4V2, the expression effect of the CAG and EF1a promoters is good, the CMV promoter is second, and the EFS promoter is weak.

Example 5 verification of terminator Strength Using EGFP as reporter Gene

AAV vectors for different terminators were constructed as in example 1: different terminators SV40 (nucleotide sequence shown in SEQ ID NO: 12), BGH (nucleotide sequence shown in SEQ ID NO: 3), WPRE (nucleotide sequence shown in SEQ ID NO: 13), WPRE-SV40 (nucleotide sequence shown in SEQ ID NO: 14) and WPRE-BGH (nucleotide sequence shown in SEQ ID NO: 15) were used to construct viral vectors comprising the CAG promoter, the CYP4V2CDS sequence and the terminator. GFP CDS as a reporter gene was ligated to the 3' end of the CYP4V2CDS sequence to construct reporter vectors containing different promoters. The part is responsible for gene synthesis and subcloning by organisms in Beijing Okame.

293T cells (ATCC, CR L-3216) were transfected with each of the above vectors, and the fluorescence signal was observed 24 hours later with a fluorescence microscope (L ifeAMF 4305).

The results are shown in FIG. 4, where the BGH terminator and SV40 terminator were expressed well, WPRE was the weakest, and WPRE-BGH and WPRE-SV40 were centered.

Example 6 verification of terminator intensity by CYP4V2 expression

293T cells (ATCC) were transfected with the reporter vectors of the different terminators constructed in example 5, respectively^TMCR L-3216), after 48 hours, the cells were lysed with RIPA lysate (Beijing prilley C1053-100), running protein gel, Western blot to detect CYP4V2 expression, and the antibody usedThe following were used: anti-CYP4V2 (Atlas)^TM，HPA029122），anti- actin（Abclonal^TM，AC026），goat-anti-rabbit（Abclonal^TM，AS014）。

The results are shown in FIG. 5, where the BGH terminator, SV40 terminator, expressed well, while WPRE was the weakest, with WPRE-BGH and WPRE-SV40 centered.

Example 7 selection of AAV capsid serotypes

Wild type mice were injected subretinally with AAV2/2, AAV2/5, AAV2/8 and AAV2/9 serotypes of viruses (purchased from Shandong Veitl Biotech, Inc.) packaging GFP reporter genes, the promoters all being CMV. Mice were sacrificed 1 week or one month after injection and the embedded sections were subjected to retinal histomorphometric observation. GFP fluorescence indicates the expression site of the vector, and DAPI marks the nucleus.

As can be seen in fig. 6, the capsid protein serotype AAV8 was most strongly expressed at 1 week post-injection, and expression was also detectable for AAV2, AAV5 and AAV 9. At one month after injection, the fluorescence intensity of AAV2 and AAV5 is medium, mainly RPE cells and photoreceptor cells; AAV8 and AAV9 have high effect, and can infect photoreceptor inner segment and RPE cell specifically and express outer nuclear layer and bipolar cell. The GFP fluorescence expression intensity is AAV8> AAV9> AAV5> AAV 2.

Therefore, AAV8 has the highest expression speed and more stable expression strength.

EXAMPLE 8 construction and packaging of AAV8 viral vectors with different promoters

8.1 construction of AAV2/8 vector

pAAV-RC8-Kana (namely AAV 2/8) is obtained by modifying pAAV-RC5-Amp (purchased from Beijing Meijie science and technology Co., Ltd.), and the vector sequence is shown as SEQ ID NO. 9.

8.2 packaging and purification

(1) Virus package

Packaging and purification were carried out according to the method of example 2, and the specific transfection system is shown in Table 3.

TABLE 3 transfection System

AAV8 viral vectors with different promoters were obtained.

Example 9 Effect of AAV8 viruses of different promoters on iPSC-induced differentiation of RPE cells

Human Induced Pluripotent Stem Cells (iPSCs) were purchased from Beijing Saibei according to the methods described in the documents da Cruz, L, et al (2018), Phase 1 clinical study of an infectious stem cell-derived therapeutic associated with the μ lar differentiation, Nat Biotechnol 36(4): 328) 337, 3X10⁴/cm²Human iPSCs were cultured in 4ml of TESR-E8 medium (STEMCE LL #05990, # 05991) in a T25 flask, and after 5 days, they were replaced with 6 ml of a medium (Gibco, CAT # A3181502) containing 20% serum replacement (Gibco, CAT # 10829018), and after 2 days, they were cultured in 6 ml of a serum-free medium (Gibco, CAT # 10829018) for about 20 weeks to obtain oval, dark-colored splittable cells, that is, RPE cells.

With MOI =1x10⁶The AAV2/8 serotype virus packaging different promoters of GFP reporter gene of example 6 was infected with an equal amount of RPE cells, and 10 days after infection, fluorescence signals were observed using a fluorescence microscope (L if AMF 4305). As shown in FIG. 7, the viral vector using CAG promoter showed good fluorescent protein expression, the second CMV promoter, the second EF1a promoter, and the weakest EFS promoter.

EXAMPLE 10 Effect of infection of iPSC with AAV8 viruses from different promoters on induced differentiation of 3D-retinal organoids

For methods for inducing 3D-retinal organoids from human Induced Pluripotent Stem Cells (iPSCs), see Zhong, X., Gutierrez, C., Xue, T. et al.Nat Commun5, 4047 (2014)。

The virus titer of 5x10 is adopted¹⁰AAV2/8 serotype virus packaging different promoters of GFP reporter gene of example 6 of cup infected 3D-retinal organoids in 96-well plates 14 days later, fluorescence signals were observed using fluorescence microscope (L ife AMF 4305). The results are shown in FIG. 8The fluorescent protein expression effect of the viral vector using the CAG promoter is good.

EXAMPLE 11 expression of AAV8 Virus from different promoters in subretinal space of mice injected with viruses

Wild type mice were injected subretinally using AAV2/8 serotype viruses packaging different promoters of the GFP reporter gene of example 6. Mice were sacrificed 2 or 6 weeks after injection and embedded sections were subjected to retinal histomorphological observation. GFP fluorescence indicates the expression site of the vector, DAPI marks the nucleus. The results of the staining pattern are shown in FIG. 9.

As can be seen from fig. 9A, 2 weeks after injection, the CMV promoter, CAG promoter, and EF1a promoters were strongly expressed, and the EFs promoter expressed EGFP was weakly expressed; wherein the expression parts of the CMV promoter and the CAG promoter are mainly expressed in an RPE layer, an inner segment and an outer segment, and the expression parts of the EF1a promoter and the EFS promoter are expressed in the RPE layer, the inner segment, the outer segment and an outer nuclear layer.

As shown in fig. 9B, the CAG promoter and EF1a promoter were strongly expressed and the CMV promoter and EFs promoter were weakly expressed in EGFP 6 weeks after injection. Each promoter is expressed in RPE layer, inner segment, outer segment and outer nuclear layer.

Therefore, the AAV8-CAG promoter has more stable expression strength in mouse retina and wide expression range.

Example 12 lipid deposition following infection of cells with vectors comprising nucleic acid molecules described herein

The pAAV-CAG-CYP4V2 plasmid of example 1 was packaged according to the method of example 8 to obtain AAV8-CAG-CYP4V2 viral vector.

The CYP4V2 gene of ARPE19 cell line (CR L-2302) is knocked out, a CYP4V2 KO-ARPE19 cell line is constructed, AAV8-CAG-CYP4V2 is used for infection, and lipid deposition is observed under a microscope.As seen in the following figures 10A-10C, AAV8-CAG-CYP4V2 virus infects the CYP4V2 KO-ARPE19 cell line, protein expression of CYP4V2 can be detected, lipid deposition of the cell line can be reduced, and the lipid deposition has a negative correlation with the protein expression of CYP4V 2.

Example 13 lipid deposition following infection of BCD patients with iPSC-induced RPE cells with vectors comprising the nucleic acid molecules described herein

BCD patients (genotype CYP4V 2: c.802-8_810del17bpinsGC homozygous mutation) were patients admitted to the eye at Beijing university third Hospital from 11 months to 12 months in 2018. All aspects of the study were approved by the ethical committee of the third hospital, Beijing university, and informed consent for sample collection was obtained from the subjects (or their legal guardians).

Preparation of human induced pluripotent stem cells (ipscs). Extracting renal epithelial cells from urine by using a Urineasy urine cell separation kit (Beijing sabia, CA 3102500), culturing and amplifying by using a Urineasy urine cell amplification kit (Beijing sabia, CA 3103200), and selecting cells with the 3-4 generation confluence reaching 70-80% for reprogramming experiments. Reprogramming experiments used the hiPSC reprogramming kit (beijing seebeck, CA 5002002) according to the operating method in the kit instructions to obtain human ipscs for cell differentiation experiments.

RPE preparation reference example 9.

With MOI =1x10⁶The virus AAV8-CAG-CYP4V2 infected an equal amount of normal human or patient RPE cells, 10 days after infection, BODIPY (D3922, Thermo Fisher) was used to stain neutral lipids, and fluorescence signals were observed using a fluorescence microscope (L ifeAMF 4305). The results are shown in FIG. 11A. the normal human and patient RPE cells in the infected and non-infected groups were lysed using RIPA lysate, and the expression of CYP4V2 was detected by western (FIG. 11B).

Example 14 vectors containing nucleic acid molecules described herein infect BCD patient iPSC-induced RPE cells and test for phagocytic potential of the cells

Preparation and infection of RPE cells and western test As in example 13. Latex beads (L4655, Sigma) were added to the cell culture medium and the fluorescent signal was observed 24 hours later using a fluorescence microscope (L if AMF 4305).

As can be seen from FIG. 12, a small number of fluorescent spots in the RPE-BCD group (left three upper and lower panels) were free latex beads, not latex beads that entered the cells, and all of the fluorescent spots in the other panels were latex beads that were phagocytosed by the RPE and entered the cells. Compared with the normal RPE, the RPE cells of the BCD patients have greatly weakened capability of phagocytizing latex pellets, and the AAV8-CAG-CYP4V2 virus infection can restore the phagocytosis capability of the RPE cells of the BCD patients to a certain degree and enhance the phagocytosis capability of the normal RPE cells.

Example 15 vector treatment of BCD model mice comprising nucleic acid molecules described herein

15.1 preparation and detection of BCD model mice

BCD mice meet certain characteristics of BCD disease and are a good animal model for studying BCD disease. BCD mice (purchased from Beijing Baioeioscope Gene biotechnology, Inc., Cyp4V 3-/-) were injected into the subretinal space at 1 month of age, and AAV8-CAG-CYP4V2 was injected into the eyeball and observed 3 to 6 months after injection.

The subretinal space injection method comprises the following steps: experimental items were prepared by subjecting mice to mydriasis with 1% atropine followed by intraperitoneal injection of 80 mg/kg ketamine + 8 mg/kg xylazine for anesthesia. After anesthesia, the mice were again mydriatically dilated with 1% atropine, and then placed in front of the animal experiment platform of the ophthalmic surgical microscope (Topcon, OMS 800) with 0.5% proparacaine local anesthetic dropped onto the mouse eyeballs. With sodium fluorescein: virus = 100: 1 to the virus, stock solution of sodium fluorescein was added and mixed by pipetting. Pre-pricking a small hole at the pars plana of mouse eyeball with insulin needle, penetrating the small hole with the needle of micro-injector, allowing the needle to enter the vitreous cavity of mouse eyeball, dripping appropriate amount of 2% hydroxymethyl cellulose on mouse eyeball to make the mouse eyeground visible under the lens, inserting the needle into the retina of opposite side periphery while avoiding the lens, slowly pushing virus with fluorescein sodium, wherein the injection amount of each eye is 1 μ l, and the virus concentration is 1x10⁹And the presence or absence of injection into the subretinal space is judged by using sodium fluorescein as an indicator, as shown in fig. 13. After operation, the surface of the eyeball is cleaned by normal saline, and the eyeball is placed in a cage and other mice to revive. FIG. 13A is a schematic view showing the subretinal injection of a mouse under a microscope.

15.2 Observation of crystalline sample deposition in fundus oculi

3 or 6 months after AAV8-CAG-CYP4V2 injection, the eyeballs of mice are scattered by 1% atropine, then 80 mg/kg ketamine + 8 mg/kg xylazine is injected and anesthetized in an abdominal cavity, the anesthetized mice are horizontally laid on a laboratory table of a Micro III animal retina imaging system (Phoenix Research L laboratory, Micro III), a proper amount of 2% hydroxymethyl cellulose is dripped on the eyeballs of the mice to improve the contact effect of a lens and a cornea), the laboratory table is rotated to adjust the positions of the eyes of the mice, the focal length and the light intensity are adjusted to obtain the eyeground images of the mice, the images are shot by Micro III software, and after the shooting is finished, the GraphPadPrism software is used for quantitative analysis of crystal deposition.

The results are shown in FIG. 13B, which shows that the fundus crystal deposition is improved after AAV8-CAG-CYP4V2 injection.

15.3 retinal tissue morphology Observation

Fixing and dehydrating: mice injected with AAV8-CAG-CYP4V2 are killed by dislocation of cervical vertebrae, the eyeballs are picked up, the eyeballs of the mice are placed in a 1.5ml EP tube, and 1ml of 4% paraformaldehyde is added for overnight at 4 ℃. Then transferring the eyeball into 1.5ml of EP tube containing 1ml of 30% sucrose solution for dehydration, and settling the eyeball. Placing mouse eyeball into 1.5ml EP tube filled with frozen embedding agent (OCT), placing mouse eye into direct-view front direction with forceps, covering EP tube, placing into liquid nitrogen, freezing and slicing until completely frozen, wherein the slice thickness is 7 μm. Fixing with acetone at 4 deg.C for 10 min, and storing at-80 deg.C. ) The sections were removed and allowed to return to room temperature, and then washed 3 times with PBS for 5min each time. The non-tissue part of the slide was wiped dry, 40. mu.l of blocking solution (5% donkey serum) was added dropwise to each section, and the section was blocked at room temperature for 1 hour. The primary antibody was diluted with 5% donkey serum and approximately 40. mu.l of antibody working solution was added dropwise to completely cover the mouse eyeball tissue overnight at 4 ℃. The primary antibody used in this experiment was: CYP4V2 (1: 50, from Sigma), slides were removed and washed 3 times with PBS for 5min each. The secondary antibody (purchased from Thermo Fisher Scientific) was diluted 1:800 with PBS and approximately 40. mu.l of secondary antibody working solution was added dropwise to completely cover the mouse eye tissue and incubated at room temperature for 1 h. After washing with PBS for 3 times, DAPI diluent (1: 5000) was added dropwise and incubated at room temperature for 15 min. Dropping the fluorescence quenching tablet in the glass slide, covering with a cover glass, and storing at-20 deg.C in dark. Images were taken by observation with a Nikon A1 laser confocal microscope equipped with NIS-Elements C software.

The results are shown in FIG. 14, which shows the expression of hYP 4V2 (range indicated by double arrow in the way) after AAV8-CAG-CYP4V2 was injected into mouse subretinal space.

15.4 improvement in mouse ERG levels

Mice dark adaptation following unilateral eyeball injection of AAV8-CAG-CYP4V 2: mice were dark adapted for at least 16 hours, after which all manipulations were performed under dark red light. Mouse anesthesia: 80 mg/kg ketamine + 8 mg/kg xylazine were used for intraperitoneal injection for anesthesia. After anesthesia was complete, the mouse eyes were mydriatically mydriatic with 1% atropine under dark red light illumination, and the mouse was placed fixedly with adhesive tape in front of the animal experimental platform of the optoelectrophysiology instrument Espion E2, consistent with both eyes, and fully exposed. The ground electrode needle is inserted into the root of the tail of the mouse, the reference electrode needle is inserted into the lower jaw of the mouse, the two gold ring recording electrodes are clamped on an electrode bracket of an animal experiment platform, the angles of the two gold ring recording electrodes are adjusted to enable the two gold ring recording electrodes to slightly contact the central top ends of the left eye cornea and the right eye cornea respectively, and a proper amount of 2 percent hydroxymethyl cellulose is dripped to improve the contact effect of the gold ring electrodes and the cornea. The program was run after entering the mouse number and age of month information in the computer Espion E2 system. The line-dark adaptive flash intensity is 0.003, 0.01, 0.1, 1, 3, 10, 100cd · s/m²(background light intensity of 0cd · s/m)²Stimulation interval 15s, average of 3 ERG signals recorded); the photopic flash intensity is 3, 10, 30, 100 cd-s/m²(adaptation time 5min, background light intensity 30 cd s/m²Stimulation interval was 15s, and the average of 5 ERG signals was recorded). And automatically storing the running result after the program runs, and counting the result by using GraphPad Prism. The virus-injected side was the virus group, and the virus-non-injected side was the control group. The statistical analysis method comprises the following steps: and (4) performing double-tail pairing t test. P<0.05，**P<0.01，***P<0.005. Error line: standard error.

The results are shown in FIGS. 15-18. Cyp4v3 KO mice were injected unilaterally with virus and ERG (n = 8) treated eyes 3 months after treatment (virus group) had no significant change in amplitude of each wave compared to control eyes (control group) (fig. 15). ERG (n = 8) treated eyes (virus group) had higher overall wave amplitude than control eyes (control group) 6 months after treatment, and the difference in wave amplitude variation under individual light intensity stimulation was statistically significant (fig. 15). The treated eye (virogroup, fig. 16) had a significantly higher amplitude than the control eye (control group, fig. 17) for 6 months of ERG dark response b-wave treatment. Comparing ERG profiles at 3 and 6 months post-treatment, the treated eye amplitude was significantly higher in mice at 6 months post-treatment than at 3 months post-treatment (fig. 18).

15.5 mouse eyeball RPE plating staining examination of cell number and morphology

Precooled PBS was added to a 1.5ml EP tube, and after sacrifice, the eyes were removed and immersed in PBS for 15 min. The mouse eyeballs were transferred to 1ml of 4% paraformaldehyde in 1.5ml EP tubes and fixed for 1 h. The mouse anterior bulbar segment was removed under a stereomicroscope (Olympus, SZ 61-SET), the neuroretinal layer was separated from the RPE layer, and the RPE layer was cut into 4 lobes. RPE patches were washed 3 times for 5min in pre-cooled PBS. RPE sections were permeabilized in 0.1% Triton for 20min and then washed 3 times with PBS for 5min each. RPE slides were placed into one well of a 96-well plate and added as 1: phalloidin working solution diluted with 200 parts PBS was incubated at room temperature for 1 h. PBS was washed 3 times for 5min each, RPE was spread on a glass slide and flattened, a small amount of the blocking agent was added dropwise and then mounted on a cover glass, and observed under a Nikon fluorescence microscope.

As a result, as shown in fig. 19, the hexagonal morphology of RPE cells was more complete and tightly packed in BCD mice injected with virus (right side) compared to BCD mice of the control group not injected with virus (left side). And the number of RPE cells in the virus group is more than that in the control group in the same area.

Sequence listing

<110> third Hospital of Beijing university (third clinical medical college of Beijing university); beijing Zhongyin science and technology Co., Ltd

<120> a kit comprising a vector carrying a nucleic acid molecule

<130>0138-PA-008

<160>18

<170>PatentIn version 3.5

<210>1

<211>6202

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> complete sequence of vector

<400>1

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccggtc gcgtctagta ctagtctagt cgcgtaccat tgacgtcaat 180

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 240

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 300

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 360

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtcga 420

ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac ccccaatttt 480

gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg ggggggggcg 540

cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga gaggtgcggc 600

ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc ggcggcggcg 660

gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgacgc tgccttcgcc 720

ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg accgcgttac 780

tcccacaggt gagcgggcgg gacggccctt ctcctccggg ctgtaattag cgcttggttt 840

aatgacggct tgtttctttt ctgtggctgc gtgaaagcct tgaggggctc cgggagggcc 900

ctttgtgcgg ggggagcggc tcggggctgt ccgcgggggg acggctgcct tcggggggga 960

cggggcaggg cggggttcgg cttctggcgt gtgaccggcg gctctagagc ctctgctaac 1020

catgttcatg ccttcttctt tttcctacag ctcctgggca acgtgctggt tattgtgctg 1080

tctcatcatt ttggcaaaga attggatcgg taccgaggag atctgccacc atggcggggc 1140

tctggctggg gctcgtgtgg cagaagctgc tgctgtgggg cgcggcgagt gccctttccc 1200

tggccggcgc cagtctggtc ctgagtctgc tgcagagggt ggcgagctac gcgcggaaat 1260

ggcagcagat gcggcccatc cccacggtgg cccgcgccta cccactggtg ggccacgcgc 1320

tgctgatgaa gccggacggg cgagaatttt ttcagcagat cattgagtac acagaggaat 1380

accgccacat gccgctgctg aagctctggg tcgggccagt gcccatggtg gccctttata 1440

atgcagaaaa tgtggaggta attttaacta gttcaaagca aattgacaaa tcctctatgt 1500

acaagttttt agaaccatgg cttggcctag gacttcttac aagtactgga aacaaatggc 1560

gctccaggag aaagatgtta acacccactt tccattttac cattctggaa gatttcttag 1620

atatcatgaa tgaacaagca aatatattgg ttaagaaact tgaaaaacac attaaccaag 1680

aagcatttaa ctgctttttt tacatcactc tttgtgcctt agatatcatc tgtgaaacag 1740

ctatggggaa gaatattggt gctcaaagta atgatgattc cgagtatgtc cgtgcagttt 1800

atagaatgag tgagatgata tttcgaagaa taaagatgcc ctggctttgg cttgatctct 1860

ggtaccttat gtttaaagaa ggatgggaac acaaaaagag ccttcagatc ctacatactt 1920

ttaccaacag tgtcatcgcg gaacgggcca atgaaatgaa cgccaatgaa gactgtagag 1980

gtgatggcag gggctctgcc ccctccaaaa ataaacgcag ggcctttctt gacttgcttt 2040

taagtgtgac tgatgacgaa gggaacaggc taagtcatga agatattcga gaagaagttg 2100

acaccttcat gtttgagggg cacgatacaa ctgcagctgc aataaactgg tccttatacc 2160

tgttgggttc taacccagaa gtccagaaaa aagtggatca tgaattggat gacgtgtttg 2220

ggaagtctga ccgtcccgct acagtagaag acctgaagaa acttcggtat ctggaatgtg 2280

ttattaagga gacccttcgc ctttttcctt ctgttccttt atttgcccgt agtgttagtg 2340

aagattgtga agtggcaggt tacagagttc taaaaggcac tgaagccgtc atcattccct 2400

atgcattgca cagagatccg agatacttcc ccaaccccga ggagttccag cctgagcggt 2460

tcttccccga gaatgcacaa gggcgccatc catatgccta cgtgcccttc tctgctggcc 2520

ccaggaactg tataggtcaa aagtttgctg tgatggaaga aaagaccatt ctttcgtgca 2580

tcctgaggca cttttggata gaatccaacc agaaaagaga agagcttggt ctagaaggac 2640

agttgattct tcgtccaagt aatggcatct ggatcaagtt gaagaggaga aatgcagatg 2700

aacgctaaac gcgtggttta tccgatccac cggatctaga taagatatcc gatccaccgg 2760

atctagataa ctgatcataa tcagccatac cacatttgta gaggttttac ttgctttaaa 2820

aaacctccca cacctccccc tgaacctgaa acataaaatg aatgcaattg gcggccgcct 2880

cgagctgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg 2940

accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat 3000

tgtctgagta ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag 3060

gattgggaag acaatagcag gcatgctggg gatgcggtgg gctctatggg gtaaccacgt 3120

gcggacccaa cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc 3180

tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc 3240

ggcctcagtg agcgagcgag cgcgcagctg cctgcagggg cgcctgatgc ggtattttct 3300

ccttacgcat ctgtgcggta tttcacaccg catacgtcaa agcaaccata gtacgcgccc 3360

tgtagcggca cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt 3420

gccagcgcct tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc 3480

ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta 3540

cggcacctcg accccaaaaa acttgatttg ggtgatggtt cacgtagtgg gccatcgccc 3600

tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg 3660

ttccaaactg gaacaacact caactctatc tcgggctatt cttttgattt ataagggatt 3720

ttgccgattt cggtctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat 3780

tttaacaaaa tattaacgtt tacaatttta tggtgcactc tcagtacaat ctgctctgat 3840

gccgcatagt taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct 3900

tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt 3960

cagaggtttt caccgtcatc accgaaacgc gcgagacgaa agggcctcgt gatacgccta 4020

tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg 4080

ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg 4140

ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtcctgag 4200

gcggaaagaa ccagctgtgg aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc 4260

cagcaggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccagg tgtggaaagt 4320

ccccaggctc cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca 4380

tagtcccgcc cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc 4440

cgccccatgg ctgactaatt ttttttattt atgcagaggc cgaggccgcc tcggcctctg 4500

agctattcca gaagtagtga ggaggctttt ttggaggcct aggcttttgc aaagatcgat 4560

caagagacag gatgaggatc gtttcgcatg attgaacaag atggattgca cgcaggttct 4620

ccggccgctt gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc 4680

tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc 4740

gacctgtccg gtgccctgaa tgaactgcaa gacgaggcag cgcggctatc gtggctggcc 4800

acgacgggcg ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg 4860

ctgctattgg gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag 4920

aaagtatcca tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc 4980

ccattcgacc accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt 5040

cttgtcgatc aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc 5100

gccaggctca aggcgagcat gcccgacggc gaggatctcg tcgtgaccca tggcgatgcc 5160

tgcttgccga atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg 5220

ctgggtgtgg cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag 5280

cttggcggcg aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg 5340

cagcgcatcg ccttctatcg ccttcttgac gagttcttct gactgtcaga ccaagtttac 5400

tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag 5460

atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg 5520

tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc 5580

tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag 5640

ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtt 5700

cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac 5760

ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc 5820

gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt 5880

tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt 5940

gagctatgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc 6000

ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt 6060

tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca 6120

ggggggcgga gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt 6180

tgctggcctt ttgctcacat gt 6202

<210>2

<211>937

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> promoter CAG

<400>2

ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac tttccattga 60

cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca agtgtatcat 120

atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg gcattatgcc 180

cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt agtcatcgct 240

attaccatgg tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc 300

ccacccccaa ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg 360

gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg 420

cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc ttttatggcg 480

aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg agtcgctgcg 540

acgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc cccggctctg 600

actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa 660

ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa gccttgaggg 720

gctccgggag ggccctttgt gcggggggag cggctcgggg ctgtccgcgg ggggacggct 780

gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta 840

gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc 900

tggttattgt gctgtctcat cattttggca aagaatt 937

<210>3

<211>225

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>polyA BGH

<400>3

ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60

tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120

tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180

gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

<210>4

<211>1578

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> coding region CYP4V2CDS

<400>4

atggcggggc tctggctggg gctcgtgtgg cagaagctgc tgctgtgggg cgcggcgagt 60

gccctttccc tggccggcgc cagtctggtc ctgagtctgc tgcagagggt ggcgagctac 120

gcgcggaaat ggcagcagat gcggcccatc cccacggtgg cccgcgccta cccactggtg 180

ggccacgcgc tgctgatgaa gccggacggg cgagaatttt ttcagcagat cattgagtac 240

acagaggaat accgccacat gccgctgctg aagctctggg tcgggccagt gcccatggtg 300

gccctttata atgcagaaaa tgtggaggta attttaacta gttcaaagca aattgacaaa 360

tcctctatgt acaagttttt agaaccatgg cttggcctag gacttcttac aagtactgga 420

aacaaatggc gctccaggag aaagatgtta acacccactt tccattttac cattctggaa 480

gatttcttag atatcatgaa tgaacaagca aatatattgg ttaagaaact tgaaaaacac 540

attaaccaag aagcatttaa ctgctttttt tacatcactc tttgtgcctt agatatcatc 600

tgtgaaacag ctatggggaa gaatattggt gctcaaagta atgatgattc cgagtatgtc 660

cgtgcagttt atagaatgag tgagatgata tttcgaagaa taaagatgcc ctggctttgg 720

cttgatctct ggtaccttat gtttaaagaa ggatgggaac acaaaaagag ccttcagatc 780

ctacatactt ttaccaacag tgtcatcgcg gaacgggcca atgaaatgaa cgccaatgaa 840

gactgtagag gtgatggcag gggctctgcc ccctccaaaa ataaacgcag ggcctttctt 900

gacttgcttt taagtgtgac tgatgacgaa gggaacaggc taagtcatga agatattcga 960

gaagaagttg acaccttcat gtttgagggg cacgatacaa ctgcagctgc aataaactgg 1020

tccttatacc tgttgggttc taacccagaa gtccagaaaa aagtggatca tgaattggat 1080

gacgtgtttg ggaagtctga ccgtcccgct acagtagaag acctgaagaa acttcggtat 1140

ctggaatgtg ttattaagga gacccttcgc ctttttcctt ctgttccttt atttgcccgt 1200

agtgttagtg aagattgtga agtggcaggt tacagagttc taaaaggcac tgaagccgtc 1260

atcattccct atgcattgca cagagatccg agatacttcc ccaaccccga ggagttccag 1320

cctgagcggt tcttccccga gaatgcacaa gggcgccatc catatgccta cgtgcccttc 1380

tctgctggcc ccaggaactg tataggtcaa aagtttgctg tgatggaaga aaagaccatt 1440

ctttcgtgca tcctgaggca cttttggata gaatccaacc agaaaagaga agagcttggt 1500

ctagaaggac agttgattct tcgtccaagt aatggcatct ggatcaagtt gaagaggaga 1560

aatgcagatg aacgctaa 1578

<210>5

<211>525

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> CYP4V2 amino acid sequence

<400>5

Met Ala Gly Leu Trp Leu Gly Leu Val Trp Gln Lys Leu Leu Leu Trp

1 5 10 15

Gly Ala Ala Ser Ala Leu Ser Leu Ala Gly Ala Ser Leu Val Leu Ser

20 25 30

Leu Leu Gln Arg Val Ala Ser Tyr Ala Arg Lys Trp Gln Gln Met Arg

35 40 45

Pro Ile Pro Thr Val Ala Arg Ala Tyr Pro Leu Val Gly His Ala Leu

50 55 60

Leu Met Lys Pro Asp Gly Arg Glu Phe Phe Gln Gln Ile Ile Glu Tyr

65 70 75 80

Thr Glu Glu Tyr Arg His Met Pro Leu Leu Lys Leu Trp Val Gly Pro

85 90 95

Val Pro Met Val Ala Leu Tyr Asn Ala Glu Asn Val Glu Val Ile Leu

100 105 110

Thr Ser Ser Lys Gln Ile Asp Lys Ser Ser Met Tyr Lys Phe Leu Glu

115 120 125

Pro Trp Leu Gly Leu Gly Leu Leu Thr Ser Thr Gly Asn Lys Trp Arg

130 135 140

Ser Arg Arg Lys Met Leu Thr Pro Thr Phe His Phe Thr Ile Leu Glu

145 150 155 160

Asp Phe Leu Asp Ile Met Asn Glu Gln Ala Asn Ile Leu Val Lys Lys

165 170 175

Leu Glu Lys His Ile Asn Gln Glu Ala Phe Asn Cys Phe Phe Tyr Ile

180 185 190

Thr Leu Cys Ala Leu Asp Ile Ile Cys Glu Thr Ala Met Gly Lys Asn

195 200 205

Ile Gly Ala Gln Ser Asn Asp Asp Ser Glu Tyr Val Arg Ala Val Tyr

210 215 220

Arg Met Ser Glu Met Ile Phe Arg Arg Ile Lys Met Pro Trp Leu Trp

225 230 235 240

Leu Asp Leu Trp Tyr Leu Met Phe Lys Glu Gly Trp Glu His Lys Lys

245 250 255

Ser Leu Gln Ile Leu His Thr Phe Thr Asn Ser Val Ile Ala Glu Arg

260 265 270

Ala Asn Glu Met Asn Ala Asn Glu Asp Cys Arg Gly Asp Gly Arg Gly

275 280 285

Ser Ala Pro Ser Lys Asn Lys Arg Arg Ala Phe Leu Asp Leu Leu Leu

290 295 300

Ser Val Thr Asp Asp Glu Gly Asn Arg Leu Ser His Glu Asp Ile Arg

305 310 315 320

Glu Glu Val Asp Thr Phe Met Phe Glu Gly His Asp Thr Thr Ala Ala

325 330 335

Ala Ile Asn Trp Ser Leu Tyr Leu Leu Gly Ser Asn Pro Glu Val Gln

340 345 350

Lys Lys Val Asp His Glu Leu Asp Asp Val Phe Gly Lys Ser Asp Arg

355 360 365

Pro Ala Thr Val Glu Asp Leu Lys Lys Leu Arg Tyr Leu Glu Cys Val

370 375 380

Ile Lys Glu Thr Leu Arg Leu Phe Pro Ser Val Pro Leu Phe Ala Arg

385 390 395 400

Ser Val Ser Glu Asp Cys Glu Val Ala Gly Tyr Arg Val Leu Lys Gly

405 410 415

Thr Glu Ala Val Ile Ile Pro Tyr Ala Leu His Arg Asp Pro Arg Tyr

420 425 430

Phe Pro Asn Pro Glu Glu Phe Gln Pro Glu Arg Phe Phe Pro Glu Asn

435 440 445

Ala Gln Gly Arg His Pro Tyr Ala Tyr Val Pro Phe Ser Ala Gly Pro

450 455 460

Arg Asn Cys Ile Gly Gln Lys Phe Ala Val Met Glu Glu Lys Thr Ile

465 470 475 480

Leu Ser Cys Ile Leu Arg His Phe Trp Ile Glu Ser Asn Gln Lys Arg

485 490 495

Glu Glu Leu Gly Leu Glu Gly Gln Leu Ile Leu Arg Pro Ser Asn Gly

500 505 510

Ile Trp Ile Lys Leu Lys Arg Arg Asn Ala Asp Glu Arg

515 520 525

<210>6

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 5' non-coding region

<400>6

ggatcggtac cgaggagatc tgccacc 27

<210>7

<211>176

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 3' non-coding region

<400>7

acgcgtggtt tatccgatcc accggatcta gataagatat ccgatccacc ggatctagat 60

aactgatcat aatcagccat accacatttg tagaggtttt acttgcttta aaaaacctcc 120

cacacctccc cctgaacctg aaacataaaa tgaatgcaat tggcggccgc ctcgag 176

<210>8

<211>3259

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> vector backbone

<400>8

ggtaaccacg tgcggaccca acggccgcag gaacccctag tgatggagtt ggccactccc 60

tctctgcgcg ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc 120

tttgcccggg cggcctcagt gagcgagcga gcgcgcagct gcctgcaggg gcgcctgatg 180

cggtattttc tccttacgca tctgtgcggt atttcacacc gcatacgtca aagcaaccat 240

agtacgcgcc ctgtagcggc acattaagcg cggcgggtgt ggtggttacg cgcagcgtga 300

ccgctacact tgccagcgcc ttagcgcccg ctcctttcgc tttcttccct tcctttctcg 360

ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat 420

ttagtgcttt acggcacctc gaccccaaaa aacttgattt gggtgatggt tcacgtagtg 480

ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata 540

gtggactctt gttccaaact ggaacaacac tcaactctat ctcgggctat tcttttgatt 600

tataagggat tttgccgatt tcggtctatt ggttaaaaaa tgagctgatt taacaaaaat 660

ttaacgcgaa ttttaacaaa atattaacgt ttacaatttt atggtgcact ctcagtacaa 720

tctgctctga tgccgcatag ttaagccagccccgacaccc gccaacaccc gctgacgcgc 780

cctgacgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga 840

gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg 900

tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg 960

gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 1020

atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 1080

agagtcctga ggcggaaaga accagctgtg gaatgtgtgt cagttagggt gtggaaagtc 1140

cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag 1200

gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta 1260

gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc 1320

cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg ccgaggccgc 1380

ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg 1440

caaagatcga tcaagagaca ggatgaggat cgtttcgcat gattgaacaa gatggattgc 1500

acgcaggttc tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga 1560

caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt 1620

ttgtcaagac cgacctgtcc ggtgccctga atgaactgca agacgaggca gcgcggctat 1680

cgtggctggc cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg 1740

gaagggactg gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg 1800

ctcctgccga gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc 1860

cggctacctg cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga 1920

tggaagccgg tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag 1980

ccgaactgtt cgccaggctc aaggcgagca tgcccgacgg cgaggatctc gtcgtgaccc 2040

atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg 2100

actgtggccg gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata 2160

ttgctgaaga gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg 2220

ctcccgattc gcagcgcatc gccttctatc gccttcttga cgagttcttc tgactgtcag 2280

accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 2340

tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt 2400

tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc 2460

tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 2520

cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac 2580

caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac 2640

cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt 2700

cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct 2760

gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat 2820

acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt 2880

atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg 2940

cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt 3000

gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt 3060

tcctggcctt ttgctggcct tttgctcaca tgtcctgcag gcagctgcgc gctcgctcgc 3120

tcactgaggc cgcccgggcg tcgggcgacc tttggtcgcc cggcctcagt gagcgagcga 3180

gcgcgcagag agggagtggc caactccatc actaggggtt cctgcggccg gtcgcgtcta 3240

gtactagtct agtcgcgta 3259

<210>9

<211>7663

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>AAV2/8

<400>9

atcgttaacg ccccgcgccg gccgctctag aactagtgga tcccccggaa gatcagaagt 60

tcctattccg aagttcctat tctctagaaa gtataggaac ttctgatctg cgcagccgcc 120

atgccggggt tttacgagat tgtgattaag gtccccagcg accttgacga gcatctgccc 180

ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt gccgccagat 240

tctgacatgg atctgaatct gattgagcag gcacccctga ccgtggccga gaagctgcag 300

cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc cggaggccct tttctttgtg 360

caatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac caccggggtg 420

aaatccatgg ttttgggacg tttcctgagt cagattcgcg aaaaactgat tcagagaatt 480

taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac cagaaatggc 540

gccggaggcg ggaacaaggt ggtggatgag tgctacatcc ccaattactt gctccccaaa 600

acccagcctg agctccagtg ggcgtggact aatatggaac agtatttaag cgcctgtttg 660

aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc gcagacgcag 720

gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag atcaaaaact 780

tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac ctcggagaag 840

cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc caactcgcgg 900

tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac taaaaccgcc 960

cccgactacc tggtgggcca gcagcccgtg gaggacattt ccagcaatcg gatttataaa 1020

attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct gggatgggcc 1080

acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac taccgggaag 1140

accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt aaactggacc 1200

aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg ggaggagggg 1260

aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag caaggtgcgc 1320

gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat cgtcacctcc 1380

aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca ccagcagccg 1440

ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga ctttgggaag 1500

gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt ggttgaggtg 1560

gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc cagtgacgca 1620

gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac gtcagacgcg 1680

gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca cgtgggcatg 1740

aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc aaatatctgc 1800

ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc tcaacccgtt 1860

tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat gggaaaggtg 1920

ccagacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg catctttgaa 1980

caataaatga tttaaatcag gtatggctgc cgatggttat cttccagatt ggctcgagga 2040

caacctctct gagggcattc gcgagtggtg ggcgctgaaa cctggagccc cgaagcccaa 2100

agccaaccag caaaagcagg acgacggccg gggtctggtg cttcctggct acaagtacct 2160

cggacccttc aacggactcg acaaggggga gcccgtcaac gcggcggacg cagcggccct 2220

cgagcacgac aaggcctacg accagcagct gcaggcgggt gacaatccgt acctgcggta 2280

taaccacgcc gacgccgagt ttcaggagcg tctgcaagaa gatacgtctt ttgggggcaa 2340

cctcgggcga gcagtcttcc aggccaagaa gcgggttctc gaacctctcg gtctggttga 2400

ggaaggcgct aagacggctc ctggaaagaa gagaccggta gagccatcac cccagcgttc 2460

tccagactcc tctacgggca tcggcaagaa aggccaacag cccgccagaa aaagactcaa 2520

ttttggtcag actggcgact cagagtcagt tccagaccct caacctctcg gagaacctcc 2580

agcagcgccc tctggtgtgg gacctaatac aatggctgca ggcggtggcg caccaatggc 2640

agacaataac gaaggcgccg acggagtggg tagttcctcg ggaaattggc attgcgattc 2700

cacatggctg ggcgacagag tcatcaccac cagcacccga acctgggccc tgcccaccta 2760

caacaaccac ctctacaagc aaatctccaa cgggacatcg ggaggagcca ccaacgacaa 2820

cacctacttc ggctacagca ccccctgggg gtattttgac tttaacagat tccactgcca 2880

cttttcacca cgtgactggc agcgactcat caacaacaac tggggattcc ggcccaagag 2940

actcagcttc aagctcttca acatccaggt caaggaggtc acgcagaatg aaggcaccaa 3000

gaccatcgcc aataacctca ccagcaccat ccaggtgttt acggactcgg agtaccagct 3060

gccgtacgtt ctcggctctg cccaccaggg ctgcctgcct ccgttcccgg cggacgtgtt 3120

catgattccc cagtacggct acctaacact caacaacggt agtcaggccg tgggacgctc 3180

ctccttctac tgcctggaat actttccttc gcagatgctg agaaccggca acaacttcca 3240

gtttacttac accttcgagg acgtgccttt ccacagcagc tacgcccaca gccagagctt 3300

ggaccggctg atgaatcctc tgattgacca gtacctgtac tacttgtctc ggactcaaac 3360

aacaggaggc acggcaaata cgcagactct gggcttcagc caaggtgggc ctaatacaat 3420

ggccaatcag gcaaagaact ggctgccagg accctgttac cgccaacaac gcgtctcaac 3480

gacaaccggg caaaacaaca atagcaactt tgcctggact gctgggacca aataccatct 3540

gaatggaaga aattcattgg ctaatcctgg catcgctatg gcaacacaca aagacgacga 3600

ggagcgtttt tttcccagta acgggatcct gatttttggc aaacaaaatg ctgccagaga 3660

caatgcggat tacagcgatg tcatgctcac cagcgaggaa gaaatcaaaa ccactaaccc 3720

tgtggctaca gaggaatacg gtatcgtggc agataacttg cagcagcaaa acacggctcc 3780

tcaaattgga actgtcaaca gccagggggc cttacccggt atggtctggc agaaccggga 3840

cgtgtacctg cagggtccca tctgggccaa gattcctcac acggacggca acttccaccc 3900

gtctccgctg atgggcggct ttggcctgaa acatcctccg cctcagatcc tgatcaagaa 3960

cacgcctgta cctgcggatc ctccgaccac cttcaaccag tcaaagctga actctttcat 4020

cacgcaatac agcaccggac aggtcagcgt ggaaattgaa tgggagctgc agaaggaaaa 4080

cagcaagcgc tggaaccccg agatccagta cacctccaac tactacaaat ctacaagtgt 4140

ggactttgct gttaatacag aaggcgtgta ctctgaaccc cgccccattg gcacccgtta 4200

cctcacccgt aatctgtaat tgcttgttaa tcaataaacc gtttaattcg tttcagttga 4260

actttggtct ctgcgtattt ctttcttatc tagtttccat ggctacgtag ataagtagca 4320

tggcgggtta atcattaact acagcccggg cgtttaaaca gcgggcggag gggtggagtc 4380

gtgacgtgaa ttacgtcata gggttaggga ggtcctgtat tagaggtcac gtgagtgttt 4440

tgcgacattt tgcgacacca tgtggtctcg ctgggggggg gggcccgagt gagcacgcag 4500

ggtctccatt ttgaagcggg aggtttgaac gagcgctggc gcgctcactg gccgtcgttt 4560

tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc 4620

cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt 4680

tgcgcagcct gaatggcgaa tggaaattgt aagcgttaat attttgttaa aattcgcgtt 4740

aaatttttgt taaatcagct cattttttta accaataggc cgaaatcggc aaaatccctt 4800

ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc 4860

cactattaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg 4920

cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact 4980

aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt 5040

ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc 5100

ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc 5160

aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 5220

ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 5280

aaggaagagt cctgaggcgg aaagaaccag ctgtggaatg tgtgtcagtt agggtgtgga 5340

aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca 5400

accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc 5460

aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc 5520

agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag 5580

gccgcctcgg cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc 5640

ttttgcaaag atcgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg 5700

attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca 5760

acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt 5820

tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg 5880

gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga 5940

agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca 6000

ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct 6060

tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac 6120

tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc 6180

gccagccgaa ctgttcgcca ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt 6240

gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt 6300

catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg 6360

tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat 6420

cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgact 6480

gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 6540

aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 6600

ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 6660

ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 6720

tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 6780

gataccaaat actgttcttc tagtgtagcc gtagttaggc caccacttca agaactctgt 6840

agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 6900

taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 6960

gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact 7020

gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga 7080

caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg 7140

aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 7200

tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 7260

acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga 7320

ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac 7380

gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcccaatac gcaaaccgcc 7440

tctccccgcg cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa 7500

agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc 7560

tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca 7620

cacaggaaac agctatgacc atgattacgc caagcgcgcc gat 7663

<210>10

<211>6

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>kozak

<400>10

gccacc 6

<210>11

<211>2943

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> promoter-CYP 4V 2-terminator

<400>11

ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac tttccattga 60

cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca agtgtatcat 120

atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg gcattatgcc 180

cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt agtcatcgct 240

attaccatgg tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc 300

ccacccccaa ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg 360

gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg 420

cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc ttttatggcg 480

aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg agtcgctgcg 540

acgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc cccggctctg 600

actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa 660

ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa gccttgaggg 720

gctccgggag ggccctttgt gcggggggag cggctcgggg ctgtccgcgg ggggacggct 780

gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta 840

gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc 900

tggttattgt gctgtctcat cattttggca aagaattgga tcggtaccga ggagatctgc 960

caccatggcg gggctctggc tggggctcgt gtggcagaag ctgctgctgt ggggcgcggc 1020

gagtgccctt tccctggccg gcgccagtct ggtcctgagt ctgctgcaga gggtggcgag 1080

ctacgcgcgg aaatggcagc agatgcggcc catccccacg gtggcccgcg cctacccact 1140

ggtgggccac gcgctgctga tgaagccgga cgggcgagaa ttttttcagc agatcattga 1200

gtacacagag gaataccgcc acatgccgct gctgaagctc tgggtcgggc cagtgcccat 1260

ggtggccctt tataatgcag aaaatgtgga ggtaatttta actagttcaa agcaaattga 1320

caaatcctct atgtacaagt ttttagaacc atggcttggc ctaggacttc ttacaagtac 1380

tggaaacaaa tggcgctcca ggagaaagat gttaacaccc actttccatt ttaccattct 1440

ggaagatttc ttagatatca tgaatgaaca agcaaatata ttggttaaga aacttgaaaa 1500

acacattaac caagaagcat ttaactgctt tttttacatc actctttgtg ccttagatat 1560

catctgtgaa acagctatgg ggaagaatat tggtgctcaa agtaatgatg attccgagta 1620

tgtccgtgca gtttatagaa tgagtgagat gatatttcga agaataaaga tgccctggct 1680

ttggcttgat ctctggtacc ttatgtttaa agaaggatgg gaacacaaaa agagccttca 1740

gatcctacat acttttacca acagtgtcat cgcggaacgg gccaatgaaa tgaacgccaa 1800

tgaagactgt agaggtgatg gcaggggctc tgccccctcc aaaaataaac gcagggcctt 1860

tcttgacttg cttttaagtg tgactgatga cgaagggaac aggctaagtc atgaagatat 1920

tcgagaagaa gttgacacct tcatgtttga ggggcacgat acaactgcag ctgcaataaa 1980

ctggtcctta tacctgttgg gttctaaccc agaagtccag aaaaaagtgg atcatgaatt 2040

ggatgacgtg tttgggaagt ctgaccgtcc cgctacagta gaagacctga agaaacttcg 2100

gtatctggaa tgtgttatta aggagaccct tcgccttttt ccttctgttc ctttatttgc 2160

ccgtagtgtt agtgaagatt gtgaagtggc aggttacaga gttctaaaag gcactgaagc 2220

cgtcatcatt ccctatgcat tgcacagaga tccgagatac ttccccaacc ccgaggagtt 2280

ccagcctgag cggttcttcc ccgagaatgc acaagggcgc catccatatg cctacgtgcc 2340

cttctctgct ggccccagga actgtatagg tcaaaagttt gctgtgatgg aagaaaagac 2400

cattctttcg tgcatcctga ggcacttttg gatagaatcc aaccagaaaa gagaagagct 2460

tggtctagaa ggacagttga ttcttcgtcc aagtaatggc atctggatca agttgaagag 2520

gagaaatgca gatgaacgct aaacgcgtgg tttatccgat ccaccggatc tagataagat 2580

atccgatcca ccggatctag ataactgatc ataatcagcc ataccacatt tgtagaggtt 2640

ttacttgctt taaaaaacct cccacacctc cccctgaacc tgaaacataa aatgaatgca 2700

attggcggcc gcctcgagct gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2760

ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2820

aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2880

acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2940

tgg 2943

<210>12

<211>122

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> SV40 Signal site

<400>12

aacttgttta ttgcagcttataatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

ta 122

<210>13

<211>589

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> WPRE signaling site

<400>13

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589

<210>14

<211>717

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> WPRE-SV40 Signal site

<400>14

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcg gtaacaactt 600

gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa 660

agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatctta 717

<210>15

<211>820

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> WPRE-BGH signal site

<400>15

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tcgagctgtg 600

ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 660

ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 720

aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 780

gacaatagca ggcatgctgg ggatgcggtg ggctctatgg 820

<210>16

<211>212

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> EFS promoter

<400>16

gggcagagcg cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgaa 60

ccggtgccta gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc 120

gcctttttcc cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc 180

tttttcgcaa cgggtttgcc gccagaacac ag 212

<210>17

<211>1162

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> EF1a promoter

<400>17

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300

cttccacctg gctccagtac gtgattcttg atcccgagct ggagccaggg gcgggccttg 360

cgctttagga gccccttcgc ctcgtgcttg agttgaggcc tggcctgggc gctggggccg 420

ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct gctttcgata agtctctagc 480

catttaaaat ttttgatgac ctgctgcgac gctttttttc tggcaagata gtcttgtaaa 540

tgcgggccag gatctgcaca ctggtatttc ggtttttggg gccgcgggcg gcgacggggc 600

ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg cgagcgcggc caccgagaat 660

cggacggggg tagtctcaag ctggccggcc tgctctggtg cctggcctcg cgccgccgtg720

tatcgccccg ccctgggcgg caaggctggc ccggtcggca ccagttgcgt gagcggaaag 780

atggccgctt cccggccctg ctccaggggg ctcaaaatgg aggacgcggc gctcgggaga 840

gcgggcgggt gagtcaccca cacaaaggaa aggggccttt ccgtcctcag ccgtcgcttc 900

atgtgactcc acggagtacc gggcgccgtc caggcacctc gattagttct ggagcttttg 960

gagtacgtcg tctttaggtt ggggggaggg gttttatgcg atggagtttc cccacactga 1020

gtgggtggag actgaagtta ggccagcttg gcacttgatg taattctcct tggaatttgc 1080

cctttttgag tttggatctt ggttcattct caagcctcag acagtggttc aaagtttttt 1140

tcttccattt caggtgtcgt ga 1162

<210>18

<211>508

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> CMV promoter

<400>18

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 300

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 360

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 420

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 480

acggtgggag gtctatataa gcagagct 508

Claims (14)

1. A kit comprising a) a vector carrying a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID No. 11 and b) a pharmaceutically acceptable excipient.

2. The kit of claim 1, wherein the vector comprises a viral vector.

3. The kit of claim 1, wherein the vector comprises an AAV viral vector.

4. The kit of claim 1, wherein the vector comprises an AAV capsid.

5. The kit of claim 1, wherein the vector comprises an AAV8 serotype capsid.

6. The kit of claim 1, wherein the pharmaceutically acceptable excipient is suitable for subretinal administration.

7. The kit of claim 1, further comprising instructions for use, a dosing regimen, one or more fine needles, one or more syringes, and/or a solvent.

8. A nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO. 11.

9. The nucleic acid molecule of claim 8, comprising a viral packaging signal.

10. The nucleic acid molecule of claim 9, wherein the viral packaging signal comprises a recombinant AAV2/8 viral packaging signal.

11. A cell comprising the nucleic acid molecule of any one of claims 8-10.

12. A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 8-10 and/or the cell of claim 11.

13. Use of the nucleic acid molecule of any one of claims 8-10, or the cell of claim 11, in the manufacture of a medicament for treating, ameliorating, and/or preventing a disease or disorder associated with atrophy of the Retinal Pigment Epithelium (RPE).

14. The use of claim 13, wherein the disease or disorder comprises crystalline retinal degeneration.

Images