CN111494623A - Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1 - Google Patents

Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1 Download PDF

Info

Publication number
CN111494623A
CN111494623A CN202010168531.7A CN202010168531A CN111494623A CN 111494623 A CN111494623 A CN 111494623A CN 202010168531 A CN202010168531 A CN 202010168531A CN 111494623 A CN111494623 A CN 111494623A
Authority
CN
China
Prior art keywords
asn
ile
thr
leu
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010168531.7A
Other languages
Chinese (zh)
Inventor
徐建青
张晓燕
曹康丽
丁相卿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHANGHAI PUBLIC HEALTH CLINICAL CENTER
Original Assignee
SHANGHAI PUBLIC HEALTH CLINICAL CENTER
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI PUBLIC HEALTH CLINICAL CENTER filed Critical SHANGHAI PUBLIC HEALTH CLINICAL CENTER
Priority to CN202010168531.7A priority Critical patent/CN111494623A/en
Priority to PCT/CN2020/081015 priority patent/WO2021179351A1/en
Publication of CN111494623A publication Critical patent/CN111494623A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • AIDS & HIV (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention relates to the field of vaccines, in particular to a vaccine composition for inducing HIV-1 broad-spectrum neutralizing antibodies. The invention adopts a form of combined vaccine, the first needle adopts HIV-1 membrane protein as immunogen, and the vaccine presentation form comprises but is not limited to recombinant plasmid vaccine, recombinant protein subunit vaccine, recombinant virus vector vaccine, virus-like particle vaccine, nanoparticle vaccine, attenuated live vaccine and inactivated virus vaccine; the titer and the broad spectrum of the anti-HIV-1 neutralizing antibody can be remarkably improved by adopting a virus vector vaccine expressing HIV-1 membrane protein in the second needle; such viral vectors include, but are not limited to, poxviruses, adenoviruses, herpes simplex viruses, measles viruses, reoviruses, rhabdoviruses. The third and fourth needles are protein nanoparticle vaccines in combination with viral vector vaccines or vice versa. The vaccination mode of the invention includes but is not limited to intramuscular inoculation, intradermal inoculation, subcutaneous inoculation, nasal drop, aerosol inhalation, genital tract, rectum, oral administration and the like. Animal experiment results prove that the vaccine disclosed by the invention is safe in combination, can continuously generate high-titer broad-spectrum neutralizing antibodies, and can be used for preventing and treating AIDS in the future.

Description

Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1
Technical Field
The invention relates to the field of vaccines, in particular to an immune combination for inducing a broad-spectrum neutralizing antibody against HIV-1.
Background
Human Immunodeficiency Virus Type 1 (HIV-1) has the characteristics of high genome variation, glycosylation protection on the surface, rare membrane protein on the surface of Virus particles and the like, so that a Human body cannot generate an effective immune response reaction aiming at the HIV-1, and the research and development of HIV-1 vaccines are very severely challenged. Among the numerous HIV-1 vaccine clinical trials, the Thailand HIV-1 vaccine (RV-144) phase III clinical trial is the only vaccine that has proven effective at present, however, the effective rate is only 31.2%. Therefore, there is a need to explore the nature of the protective immune response and its mechanism of generation in depth to develop more effective vaccines. The results of the study show that neutralization activity against different viruses, i.e. broad-spectrum neutralizing antibodies (bnAb), can occur in the serum of 10-30% of patients 2 years after infection, wherein about 1% of patients have particularly strong serum-broad-spectrum neutralizing activity, and are called "elite patients", the serum of which can neutralize HIV-1 of various subtypes in vitro, and the serum is delivered to animal models to protect them from HIV-1 infection, thereby generating passive protection. Such broadly neutralizing antibodies are difficult to induce by traditional HIV-1 vaccine strategies.
The emergence of new technologies opens the way to screen cultured memory B cells for virus neutralization and isolation of antigen-specific B cells, and in recent years many highly potent HIV broadly neutralizing antibodies (bnAb) have been isolated, including 3BNC117, VRC01, B12, PGT121, 10E8, and the like. Animal experiments show that the broad-spectrum neutralizing antibodies can inhibit virus infection, reduce the latent of acute-phase virus, delay or block rebound of plasma virus of infected people after stopping taking the medicine, and maintain the inhibiting effect of antiviral medicines. Suggesting that if the body is induced to generate the bnAbs through a vaccine strategy, the immunoprotection effect is expected to be obtained.
The HIV-1 envelope protein is a key site for neutralizing antibody action and is also a core epitope for designing vaccine immunogens to induce neutralizing antibodies. With the analysis of the membrane protein structure and its epitope and broad-spectrum neutralizing monoclonal antibody complex structure, researchers try to maintain the correct folding conformation of the epitope as much as possible by modifying the membrane protein, such as cutting off the variable region, increasing glycosylation, increasing the spatial conformation stability, etc., and avoid the exposure of non-natural epitope and non-neutralizing epitope to obtain better immune effect. For example, after the transmembrane region of gp41 is cut off, gp140 forms a trimer structure and the embedded sequence enhances the formation and stability of the trimer; removing the more immunogenic regions such as V3 to reduce non-broad-spectrum neutralizing antibody production; introducing computer-designed mutations to eliminate the internal regions of the gp120 monomer core region and allow more glycosylation to mask other epitopes; directly truncating the sequence of the inner region; or smaller domains such as membrane-proximal ectodomain (MPER) can be selected for attachment to other proteins as backbone-stabilizing epitopes. Researchers have also designed and engineered HIV-1 membrane proteins from the perspective of the process of generating broadly neutralizing antibodies to achieve the goal of inducing broadly neutralizing antibodies to HIV.
To date, broadly neutralizing antibodies have only been isolated from HIV-1 infected individuals and these broadly neutralizing antibodies often recognize epitopes in spatial conformation, suggesting that the design of immunogens close to the natural structure of the HIV-1 envelope protein make it possible to induce broadly neutralizing antibodies. The design of the natural-like envelope protein SOSIP is carried out at the same time. SOS is a disulfide bond that prevents the separation of gp120 and gp41 ectodomains (gp41ECTO, gp41 ectodomain). SOSIP refers to a mutation that reintroduces uncoiled I559P on the basis of gp140 SOS. To prevent proteolysis of gp140 to gp120 and gp41ECTO, the natural state REKR was replaced with a more potent hexa-arginin (R6) motif. The SOSIP.664 design not only helps to analyze the structure of HIV-1 envelope protein, but also can induce the neutralizing antibody of autologous Tier 2 virus.
To date, three cleavage-independent gp140 trimers have been proposed, namely sc-gp140 from Kwong laboratories (single chain-gp140), NF L from Wyatt et al (native, flexely linked), and UFO from Zhujiang laboratories (Uncleavered instead of optimized), which share the use of a flexible hinge in place of the cleavage site for furin on a trimer-stable mutant gp 140.
The induction of HIV-1 broad-spectrum neutralizing antibody vaccine is still in the initial research stage, and how to design an immunization scheme which has high safety and can continuously generate high-titer broad-spectrum neutralizing antibody is still a problem to be solved urgently.
Multiple studies show that according to the characteristics of HIV-1 Env, reasonable HIV-1 envelope protein immunogens are designed, and anti-HIV-1 broad-spectrum neutralizing antibodies can be induced by utilizing a sequential immunization strategy. Hildegland et al found that priming with adenovirus, adenovirus or protein boosting could significantly enhance Env-specific antibody responses, including the V2 region-specific binding of HIV-1 Env to antibodies. Four additional important tasks further confirm that sequential immunization strategies may induce broadly neutralizing antibodies. A broad-spectrum neutralizing antibody PGT-121 directed against the third loop (V3) of the HIV-1 envelope protein. A PGT-121 antibody knock-in mouse was constructed carrying heavy and light chains of PGT-121 predicted germline genes. Without any immunogen induction, mice do not produce broadly neutralizing antibodies. However, according to the rule that somatic cell mutation occurs frequently, trimeric proteins with different conformations are designed, and the sequential immunization of a mouse with the knock-in of the PGT-121 antibody gene can guide the generation of PGT-121 broad-spectrum neutralizing antibodies. There were two other groups of studies that modeled broadly neutralizing antibodies on the HIV-1 envelope that recognized the CD4 recognition site, VRC 01-like, and similar findings. It has also been shown that eOD-GT 860 mer immunogen can stimulate initial B cell production of VRC01 germline gene heavy chain knock-in mice towards the broad spectrum of VRC01 neutralizing antibodies. Unfortunately, eOD-GT 860 mer alone is not capable of inducing a complete broadly neutralizing antibody response. Rather, much like the PGT-121 antibody, the immune response and somatic hypermutation are directed by a systemic and sequential immunogen toward the broad spectrum neutralizing antibodies characteristic of VRC01 and ultimately induce the production of VRC 01-like broad spectrum neutralizing antibodies. These successful studies suggest that our sequential immunization strategy is highly likely to induce the production of HIV-1 broadly neutralizing antibodies.
Viral vector vaccines are currently in wide use, including adenovirus, poxvirus, newcastle disease virus, and the like. A large body of data indicates that recombinant vaccinia virus is a potent immune vector. The Tiantan strain poxvirus adopted in the experiment has a wide host range, high propagation titer and extremely large exogenous gene capacity which theoretically can reach 25-50kb, can effectively stimulate organisms to generate antibody response and T cell immune response, has proved to have extremely high safety, and can be used by people with immunodeficiency. Vaccinia virus was the earliest as a vaccine vector for rabies virus and can effectively control rabies of wild animals. It is currently used in the development of vaccines for a variety of diseases, such as HIV, influenza, and the like.
Nanoparticle vaccines are currently very widely used vaccines, and studies have been made to couple Hemagglutinin (HA) of H1N1 to ferritin (ferritin) nanoparticles to form a large 24-hedron complex, which greatly improves the ability to induce the production of neutralizing antibodies against H1N1 virus. There is then a further report that coupling of the HIV-1 envelope protein BG505 sosip.664, in a conformation similar to its native conformation, to ferritin nanoparticles may improve their immunogenicity, suggesting that we may improve the immunogenicity of immunogens by ferritin nanoparticles. The SpyTag/SpyCatcher coupling technique is a novel method for combining two independent proteins, and the technique is based on the protein CnaB separated from streptococcus pyogenes2Developed after being modified by genetic engineering. The method mainly comprises two proteins, one is a tag protein (SpyTag) with 13 amino acid residues, and the other is a capture protein (Spycatcher) of the tag protein. The two proteins can be coupled at normal temperature, and a stable covalent bond is formed quickly and efficiently through an isopeptide. On the basis, Spytag tag is added to the C end of the target protein by a molecular cloning method, SpyCatcher is added to the N end of ferritin, and the two molecules can be connected together by a covalent bond. In this study, the SpyTaThe g/spycatccher coupling technique links the SOSIP protein to the ferritin protein, forming 24-hedral nanoparticles.
The invention firstly adopts envelope proteins of a Chinese epidemic strain AE2F strain and a R L42 strain with higher immunogenicity as immunogens, and modifies the immunogens into SOSIP.664 and UFO forms, then adopts HIV-1 membrane proteins of two different genotypes of the Chinese epidemic strain HIV-1R L42 strain and the AE2F strain as immunogens, carries a plurality of vaccine forms such as recombinant plasmid vaccine, recombinant Tiantan pox virus vaccine, membrane protein tripolymer coupled with fertilin nanoparticles and the like, sequentially immunizes Chinese rhesus monkeys, induces a broad spectrum but lower titer HIV-1 neutralizing antibody response, and SHIV-89.6 challenge shows that the induced antibody response reaction has a protective effect indeed, wherein the most main immunization strategy is a first needle DNA-AE2F-gp145, a second needle recombinant Tiantan strain AE2F-gp145, a third needle protein-AE2F-SOSIP 664-ritin + aluminum adjuvant, and a fourth needle recombinant Tiantan strain L42-R145-gp 42.
Disclosure of Invention
The present invention provides an immunological combination for inducing broadly neutralizing antibodies against HIV-1, thereby obtaining broadly neutralizing antibodies for preventing viral entry.
In a particular embodiment of the invention, the combined second needle employs a viral vector vaccine expressing HIV-1 membrane proteins selected from the group consisting of poxviruses, adenoviruses, herpes simplex viruses, measles viruses, reoviruses and rhabdoviruses.
In a specific embodiment of the invention, the poxvirus vector vaccine is selected from the group consisting of the Tiantan strain, the North American vaccine strain, the Whitman derivative strain, the Listeria strain, the Ankara derivative strain, the Copenhagen strain and the New York strain during the combined vaccination described above.
In a specific embodiment of the present invention, in the above-mentioned combined vaccination, the vaccination mode is selected from the group consisting of intramuscular vaccination, intradermal vaccination, subcutaneous vaccination, nasal drip, aerosol inhalation, genital tract, rectal and oral administration.
In a specific embodiment of the present invention, in the combined vaccination process, in addition to the second needle using the recombinant viral vector vaccine, other vaccine forms are selected from the group consisting of recombinant plasmid vaccines, recombinant protein subunit vaccines, recombinant bacterial vector vaccines, recombinant viral vector vaccines, virus-like particle vaccines, nanoparticle vaccines, attenuated live vaccines, inactivated viruses and bacterial vaccines, and combinations of different vaccine forms.
In a specific embodiment of the present invention, in the combined vaccination procedure described above, the adjuvant is selected from the group consisting of aluminium adjuvant, cholera toxin and subunits thereof, oligodeoxynucleotides, manganese ion adjuvant, freund's adjuvant, MF59 adjuvant and QS-21 adjuvant.
In yet another aspect of the present invention, there is provided a combined vaccination method for a vaccine that simultaneously activates B cell response efficiently to generate broadly neutralizing antibodies, the second needle of the combined vaccination method being in the form of a recombinant viral vector vaccine to prevent infectious diseases caused by enveloped viruses.
In a particular embodiment of the invention, the HIV-1 membrane protein subtype used in the vaccine is selected from the group consisting of the HIV-1A, B, C, D, F, G, H, J, K subtype and recombinant forms formed between different types.
In a particular embodiment of the invention, the recombinant form is selected from the group consisting of CRF01-AE, CRF07-BC, CRF08-BC and AG recombinant forms.
In a particular embodiment of the invention, the source of HIV-1 membrane proteins used in the vaccine is selected from the group consisting of AE2F, R L42 and CN 54.
In a particular embodiment of the invention, the form of the HIV-1 membrane protein used in the vaccine is selected from the group consisting of simple membrane proteins (gp145, gp120, gp 140); modified membrane proteins (SOSIP.664, UFO) and fusion proteins (SOSIP.664-fertilitin, UFO-fertilitin, gp120-Fc, gp120-p24-Fc, SOSIP.664-p 24-Fc).
In one embodiment of the invention, simple membrane proteins include, but are not limited to gp145, gp120, gp 140.
Preferably, the simple membrane protein comprises an amino acid sequence selected from the group consisting of:
(i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7;
(ii) and SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 compared to a sequence having one or several amino acid substitutions, deletions or additions (e.g., 1, 2, 3, 4 or 5 amino acid substitutions, deletions or additions); or
(iii) And SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.
Preferably, the coding nucleotide sequence of the simple membrane protein is shown as SEQ ID NO: 2. SEQ ID NO: 4. SEQ ID NO: 6. SEQ ID NO: shown in fig. 8.
In addition, the simple membrane protein may be a protein obtained by converting SEQ ID NO: 1. SEQ ID NO: 3. SEQ ID NO: 5. SEQ ID NO: 7 by substitution, deletion or addition of one or more amino acid residues, does not influence the molecular function.
The coding nucleotide sequence of the simple membrane protein can be the nucleotide sequence shown in SEQ ID NO: 2. SEQ ID NO: 4. SEQ ID NO: 6. SEQ ID NO: 8 by substitution, deletion or addition of one or more nucleotides, does not affect the function of the encoded protein.
In a particular embodiment of the invention, the simple membrane protein is selected from the group consisting of gp145, gp120 and gp 140.
In one embodiment of the invention, the modified membrane protein includes, but is not limited to sosip.664, UFO.
Preferably, the modified membrane protein comprises an amino acid sequence selected from the group consisting of:
(i) SEQ ID NO: 9;
(ii) and SEQ ID NO: 9 (e.g., 1, 2, 3, 4, or 5 amino acid substitutions, deletions, or additions) compared to the amino acid sequence set forth in seq id no; or
(iii) And SEQ ID NO: 9, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.
Preferably, the modified membrane protein has a nucleotide sequence shown in SEQ ID NO: shown at 10.
In addition, the modified membrane protein may be a protein obtained by converting SEQ ID NO: 9 is formed by substitution, deletion or addition of one or more amino acid residues without influencing the molecular function.
The coding nucleotide sequence of the modified membrane protein can be the nucleotide sequence shown in SEQ ID NO: 10 by one or more nucleotide substitutions, deletions or additions, does not affect the function of the encoded protein.
In a particular embodiment of the invention, the modified membrane protein is selected from the group consisting of sosip.664 and UFO.
In a particular embodiment of the invention, fusion proteins include, but are not limited to, SOSIP.664-fertilin, UFO-fertilin, gp120-Fc, gp120-p24-Fc, SOSIP.664-p 24-Fc.
Preferably, the fusion protein comprises an amino acid sequence selected from the group consisting of:
(i) SEQ ID NO: 11, SEQ ID NO: 13;
(ii) and SEQ ID NO: 11, SEQ ID NO: 13 compared to a sequence having one or several amino acid substitutions, deletions or additions (e.g., 1, 2, 3, 4 or 5 amino acid substitutions, deletions or additions); or
(iii) And SEQ ID NO: 11, SEQ ID NO: 13, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.
Preferably, the encoding nucleotide sequence of the fusion protein is as shown in SEQ ID NO: 12. SEQ ID NO: as shown at 14.
In addition, the fusion protein may be a fusion protein of SEQ ID NO: 11. SEQ ID NO: 13 by substitution, deletion or addition of one or more amino acid residues, does not affect the molecular function.
The encoding nucleotide sequence of the fusion protein can be the nucleotide sequence shown in SEQ ID NO: 12. SEQ ID NO: 14 by substitution, deletion or addition of one or more nucleotides, does not affect the function of the encoded protein.
In a particular embodiment of the invention, the fusion protein is selected from the group consisting of SOSIP.664-fertilin, UFO-fertilin, gp120-Fc, gp120-p24-Fc and SOSIP.664-p 24-Fc.
The beneficial effects of the invention are that in the immune combination for inducing the broad-spectrum neutralizing antibody against HIV-1, the second needle adopts a recombinant virus vector vaccine form, selects a replication type virus vector, can prolong the existence time of immunogen in vivo, can better simulate natural infection situation compared with simple recombinant plasmid or protein, and can more effectively stimulate B cells to mature and differentiate so as to generate a more broad-spectrum and effective neutralizing antibody, so that the second needle has application prospect in preventing and reducing virus infection.
Drawings
FIG. 1 shows the effect of different combinations of immunizations in the second needle on the induction of broadly neutralizing antibodies in mice.
The mice used in the experiment are 6-8 weeks old C57/B L6, the immunogen is HIV-1 membrane protein, the first needle and the fourth needle adopted in different immunization combinations are the same, the second needle and the third needle adopt different combinations, the protein is enhanced by aluminum adjuvant, the titer of the neutralizing antibody in the serum of the mice at the 4 th week after immunization is detected by the TZM-B1 method, the abscissa is different immunogen combination modes, and the ordinate is the titer of the neutralizing antibody (ID) in the ordinate50). P < 0.05, p < 0.01, p < 0.001.
Figure 2 shows the effect of a third different combination of immunizations on the induction of broadly neutralizing antibodies in mice.
The mice used in the experiment are 6-8 weeks old C57/B L6, the immunogen is HIV-1 membrane protein, the first needle, the second needle and the fourth needle adopted in different immunization combinations are the same, the third needle adopts different immunogens, the proteins are all enhanced by aluminum adjuvant, the titer of neutralizing antibodies in the serum of the mice at the 4 th week after immunization is detected by the TZM-B1 method, the abscissa is different immunogen combination modes, and the ordinate is the titer of the neutralizing antibodies (ID)50). P < 0.05, p < 0.01, p < 0.001.
Figure 3 shows the effect of different combinations of immunizations with the third and fourth needles on the induction of broadly neutralizing antibodies in mice.
The mice used in the experiment are 6-8 weeks old C57/B L6, the immunogen is HIV-1 membrane protein, the first needle and the second needle used in different immunization combinations are the same immunogen, the third needle and the fourth needle used in different combinations, wherein the protein is enhanced by aluminum adjuvant, the titer of the neutralizing antibody in the serum of the mice at the 4 th week after immunization is detected by the TZM-bl method, the abscissa is different immunogen combination modes, and the ordinate is the titer of the neutralizing antibody (ID)50). P < 0.05, p < 0.01, p < 0.001.
FIG. 4 shows the effect of different combinations of immunizations on the induction of broadly neutralizing antibodies in mice(first needle)。
The mice used in the experiment are 6-8 weeks old C57/B L6, the immunogen is HIV-1 membrane protein, the immunogens of the second needle, the third needle and the fourth needle which are adopted in different immunization combinations are the same, the immunogen of the first needle is different, the protein is strengthened by aluminum adjuvant, the TZM-bl method is used for detecting the titer of the neutralizing antibody in the serum of the mice at the 4 th week after immunization, the abscissa is different immunogen combination modes, and the ordinate is the titer of the neutralizing antibody (ID)50). P < 0.05, p < 0.01, p < 0.001.
Figure 5 shows the induction and challenge protection of the immunization strategy against broadly neutralizing antibodies in rhesus monkeys.
The experimental rhesus macaque is female, the experiment lasts for 3-4 years, the immunogen is HIV-1 membrane protein, the first needle adopts recombinant plasmid vaccine, the second needle adopts recombinant poxvirus vector vaccine, the third needle adopts nanoparticle vaccine, and the protein is strengthened by aluminum adjuvant.
(A) The TZM-b1 method was shown to detect the titer of neutralizing antibodies in plasma 2 weeks after the end of the third immunization. The abscissa is the different pseudoviruses and the ordinate is the titer (ID) of neutralizing antibodies50). (B) Shown is the qPCR detection of viral load in rhesus monkey plasma after SHIV challenge. The abscissa is the number of days after challenge and the ordinate is the viral load (logRNA copies/ml). Denotes p < 0.01.
Figure 6 shows the effect of different combinations of immunizations on the induction of broadly neutralizing antibodies in rhesus monkeys (20).
The experimental rhesus monkey is female, the immunogen is HIV-1 membrane protein, the first needle and the second needle of the two experimental groups are the same, and the two experimental groups are respectively recombinant plasmid vaccine and recombinant poxvirus vector vaccine. Different combinations of the third and fourth needles are used, as follows. Wherein the protein is boosted with an aluminium adjuvant.
The TZM-b1 method is shown to detect the titer of neutralizing antibodies in rhesus monkey plasma 2 weeks after the end of immunization. The abscissa represents the combination of different immunogens and the ordinate represents the titer (ID) of neutralizing antibodies50). Group1 represents DNA + rTV + protein + rTV, and Group2 represents DNA + rTV + rTV + protein. P < 0.05, p < 0.01, p < 0.001.
Detailed description of the preferred embodiments
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. These and other features and advantages of the present invention will become apparent upon reading the following detailed description of the disclosed embodiments and the appended claims.
HIV-1 isolates are generally classified according to the neutralizing "Tier" phenotype, which is important for monitoring and interpreting vaccine-induced neutralizing antibody responses. Four different Tiers can be distinguished based on the neutralization sensitivity exhibited by HIV-1 isolates. Tier 1A is the most sensitive neutralizing phenotype, and accounts for a very small part of circulating strains, and is mostly laboratory strains. Tier 1B is the second most sensitive and represents a larger but still relatively small circulating strain. Most circulating strains exhibit a moderately sensitive Tier 2 phenotype, which is considered to be the most important target for vaccines; this phenotype includes most of the reference strains. Tier 3 is the least sensitive phenotype. Many HIV-1 membrane protein immunogens produce antibodies that neutralize strains of Tier 1A and Tier 1B, but these antibodies do not neutralize most strains of Tier 2 and Tier 3. Therefore, in evaluating the efficacy of an HIV-1 vaccine, the most important reference index is the neutralizing activity against the Tier 2 strain. The pseudovirus strains used in the following experiments were all the Tier 2 strains.
The experimental animals, immunization protocols, immunogens, pseudoviruses and detection methods involved in the following experiments were as follows:
experimental animals including 6-8 week-old female C57/B L6 mouse and 3-4 year-old female Chinese rhesus monkey
The immunization mode comprises the following steps: intramuscular injection of left and right hind limbs, respectively
Immunogens (AE2F strain sequences were all from Genebank AAG38897.1, R L42 strain sequences were all from Genebank AAC05236.1, ferritin sequences were from NCBI Reference Sequence WP _011011871.1)
1. Recombinant plasmid vaccines (DNA) AE2F-gp145(SEQ ID NO: 1/2), AE2F-gp140(SEQ ID NO: 3/4), AE2F-SOSIP.664(SEQ ID NO: 9/10), R L42-gp 140(SEQ ID NO: 7/8), AE2F-gp120-IgG2a (SEQ ID NO: 11/12), pSV1.0 (empty);
2. recombinant poxvirus vector vaccines (rTV) AE2F-gp145(SEQ ID NO: 1/2), R L42-gp 145(SEQ ID NO: 5/6), 752-1 (empty);
3. nanoparticle vaccine (protein): AE2F-SOSIP.664-ferritin (SEQ ID NO: 13/14);
4. recombinant adenovirus vector vaccine (Ad) R L42-gp 145(SEQ ID NO: 5/6).
Immunogen preparation and immunization dose:
the recombinant plasmid vaccine has an immunizing dose of 10-200 mug/mouse and 1-6 mg/rhesus monkey, and the recombinant poxvirus vector vaccine has an immunizing dose of 1 × 106-5×107pfu/mouse, 5 × 10 in rhesus monkey7-1×109pfu/mouse, the immune dose of the nano-particle vaccine is 1-50 mug/mouse, 10-500 mug/mouse in rhesus monkey, and the immune dose of the recombinant adenovirus vector vaccine is 1 × 10 in mouse10-5×1011vps/only.
Preferably, the immunizing doses of the individual immunogens in the combination are as follows:
1. recombinant plasmid vaccine (DNA) 100. mu.g/mouse 100. mu. L, 1 mg/rhesus monkey 1m L;
2. recombinant poxvirus vector vaccine (rTV): 1 × 107pfu/mouse, 100. mu. L, 1 × 108pfu/rhesus monkey, 1m L;
3. nanoparticle vaccine (protein) prepared by mixing protein-AE2F-SOSIP.664-spytag and ferritin-spycacher at a molar ratio of 1: 1 24h before immunization, shaking overnight at 4 deg.C, mixing the protein mixture with aluminum adjuvant at a volume ratio of 1: 1 the next day, and immunizing at 10 μ g/mouse, 100 μ L, 100 μ g/rhesus monkey, 1m L;
4. recombinant adenovirus vector vaccine (Ad): 1 × 1011vps/mouse, 100 μ L;
immunization interval:
mice: 2 weeks
Rhesus monkey: 4 weeks
Packaging of HIV-1 envelope pseudovirus:
1. 293T cells were prepared one day before transfection for transfection and expression of packaging plasmids DMEM complete medium was used to dilute the cells to 5 × 106At a cell density of L m, cells diluted 1m L were plated in 10 cm dishes at 37 ℃ with 5% CO2Culturing overnight;
2. sucking 4 mug HIV-1 membrane protein plasmid and 8 mug pSG3 delta env skeleton plasmid, adding into DMEM with 500 mug L double-free (serum-free, double-free is mixed solution of streptomycin) and incubating for 5min at room temperature;
3. 15 μ L PEIpro was diluted with DMEM-free double, to a final volume of 500 μ L/sample and incubated for 5min at room temperature;
4. mixing the two solutions, incubating at room temperature for 20min at 1000 μ L/final sample volume, adding into 293T cell of 10em, replacing fresh 15m L complete culture medium after 6h, and culturing in cell culture box for 48 h;
5. after the culture is finished, collecting cell culture supernatant of a 10em dish, centrifuging the cell culture supernatant in a 15m L centrifuge tube for 10min at 4000g and 4 ℃, filtering the cell culture supernatant into a new 15m L centrifuge tube by using a 0.45 mu m filter, freezing the cell culture supernatant at the temperature of minus 80 ℃, and titrating the cell culture supernatant for later use.
6. Pseudoviruses used in this experiment included: subtype A/E (SH1.81, GX191.2, AE2F), subtype B (B16), subtype C (C2), Montefiori Global Pane1 (see Table 1)
TABLE 1 Montefiori Global Panel
Figure BDA0002407664600000111
The detection method comprises the following steps:
blood collection:
1. the method comprises the following steps of collecting whole blood at the periphery of a mouse by an eyeball picking method after 4 weeks after the last immunization is finished, collecting the whole blood in a 1.5m L EP tube, standing at room temperature to enable the whole blood to coagulate naturally, placing the coagulated mouse serum at 7000g, centrifuging for 15min, transferring the mouse serum to a new 1.5m L EP tube, inactivating the sample at 56 ℃ for 30min before the experiment to destroy the complement activity in the serum, centrifuging for a short time before the inactivation to avoid the sample on the tube wall and the bottle cap, and enabling the water bath liquid level to be over the sample liquid level but not to exceed the bottle cap.
2. Rhesus monkey: collecting peripheral blood of Chinese rhesus monkey with EDTA-K2 anticoagulant tube at 800g, and centrifuging for 10 min. Sucking the plasma above the separated liquid surface after centrifugation, and subpackaging in a plasma tube for freezing at-80 ℃. Samples were inactivated at 56 ℃ for 60min prior to the experiment to destroy complement activity in serum/plasma. And the tube is centrifuged for a short time before inactivation, so that the residual samples on the tube wall and the bottle cap are avoided. The bath level should be below the sample level but not above the cap.
(II) TZM-bl detection of neutralizing antibodies:
1. a96-well blackboard with a transparent bottom was used for neutralization experiments, the first column was set with a Cell Control (CC) (150. mu. L), the second column was set with a Virus Control (VC) (100. mu. L), and all the other wells were sample wells, and the samples were diluted in duplicate to give a final well volume of 100. mu. L.
2. In addition to the cell control group, 50. mu. L pseudovirus dilution was added to each well to give a final pseudovirus content of 200TCID in each well50。
3. Gently shaking and mixing, placing the blackboard with 96 holes bottom in a cell culture box, keeping the temperature at 37 ℃ and 5% CO2Incubate for 1 h.
4. When the incubation time reached 20min, the preparation of TZM-b1 cells was started and the cells were diluted to 10 with complete medium5Cells/m L, DEAE-dextran was added to promote pseudoviral infection to a concentration of 37.5. mu.g/m L.
5. When the incubation time is up to 1h, 100 mu L TZM-b1 cells are added to each well of a 96-well transparent bottom blackboard, so that the number of cells in each well is 104And a final DEAE-dextran concentration of 15. mu.g/m L.
6. Gently shaking the 96-well transparent bottom blackboard all around to uniformly disperse the cells in the holes, and then placing the blackboard in a cell culture box at 37 ℃ and 5% CO2Culturing for 48 h.
7. After 48h of culture, the 96-well transparent bottom blackboard was taken out of the cell incubator, the supernatant in the wells was aspirated, 100. mu. L PBS was added to each well for washing once, PBS was aspirated, 50. mu. L1 × lysis buffer (from Cat # E153A, Promega) was added to each well, and the cells were fully lysed by incubation on a horizontal shaker at room temperature for 30 min;
8. 30 μ L luciferase substrate (available from Promega, Cat # E1501) was added to a 96-well blackboard and the instrument was used
Figure BDA0002407664600000132
The luciferase activity is detected by a 96-microplate luminescence-detection instrument.
9. Reading value of fluorescein is derived, neutralization inhibition rate is calculated, and ID is calculated by utilizing Graphpad prism5.0 software according to the result of neutralization inhibition rate50。
Figure BDA0002407664600000131
Example 1: evaluation of the Induction Effect of different combinations of immunizations on mouse Broadseptively neutralizing antibodies
Mice were immunized with different combinations of immunizations, which were evaluated to induce titers of neutralizing antibodies against the HIV-1 pseudoviruses GX191.2, B16, and C2 4 weeks after completion of the immunization.
The experimental procedure was as follows: the mice were randomly divided into 7 groups and named DNA + DNA group, rTV + rTV group, rTV + DNA group, DNA + protein group, protein + DNA group, rTV + protein group and protein + rTV group, respectively, according to the following different combinations of immunogens. Specific immunological combinations are shown in table 2.
The titers of neutralizing antibodies generated against HIV-1 pseudoviruses GX191.2, B16 and C2 by the different immunization combinations are shown in FIG. 1: when the combination of the second needle and the third needle is rTV + DNA and rTV + protein, the titer of the antibodies generated against the three pseudoviruses is more than 100, and the titer of the antibodies of other experimental groups is about 10, so that the titer and the broad spectrum of the neutralizing antibodies are well improved by the combination.
The experiment proves that the second vaccine adopting the poxvirus vector can well improve the titer and the broad spectrum of the neutralizing antibody aiming at the HIV-1.
TABLE 2 second experiment for inducing broadly neutralizing antibodies with different combinations of immunizations
Figure BDA0002407664600000141
Example 2: third, evaluation of the Induction Effect of different immunological combinations on mouse broadly neutralizing antibodies
The C57/B L6 mice were immunized with different combinations of immunizations, the immunogen being HIV-1 membrane protein and the adjuvant being aluminum adjuvant, and the different combinations of immunizations were evaluated 4 weeks after completion of the immunization to induce titers of neutralizing antibodies against HIV-1 pseudoviruses GX191.2, B16 and C2.
The experimental procedure is as follows, mice are randomly divided into 7 groups, and the groups are respectively named as a control group, a protein-AE 2F-SOSIP.664-fertilin group, a rTV-AE2F-gp145 group, a rTV-R L42-gp 145 group, an Ad-R L42-gp 145 group and a DNA-AE2F-gp145 group according to the immunogen of a subsequent third needle, the specific immune combination is shown in Table 3, the titer of the neutralizing antibodies generated by different immune combinations against HIV-1 pseudoviruses GX191.2, B16 and C2 is shown in figure 2, when the third needle is protein or poxvirus, the titer of the neutralizing antibodies generated against the three pseudoviruses is about 200, and the titer of the antibodies generated by other experimental groups is about 100, so the titer and broad spectrum of the neutralizing antibodies are well improved by the combination.
The experiment proves that when the second needle is a poxvirus vector vaccine, and the third needle is a recombinant protein vaccine or a poxvirus vector vaccine, the titer and the broad spectrum of a neutralizing antibody aiming at HIV-1 can be well improved.
TABLE 3 third experiment for inducing broadly neutralizing antibodies by different combinations of immunizations
Figure BDA0002407664600000151
Example 3: evaluation of inducing effect of different immunization combinations of the third needle and the fourth needle on mouse broad-spectrum neutralizing antibody
According to the conclusions drawn in examples 1 and 2, the second needle was fixed as a poxvirus vector vaccine and the recombinant protein vaccine and the poxvirus vector vaccine that performed well in the third needle were selected, the combination of three or four needles was used to immunize mice, and after 4 weeks of complete immunization, the different combinations of immunization were evaluated to induce neutralizing antibody titers against HIV-1 pseudoviruses GX191.2, B16 and C2.
The experimental procedure was as follows: the mice were randomly divided into 5 groups and named control group, protein + DNA group, protein + rTV group, rTV + protein group and protein + Ad group, respectively, according to the immunogen combination form of the subsequent third and fourth needles. Specific immunological combinations are shown in table 4.
The titers of neutralizing antibodies generated against HIV-1 pseudoviruses GX191.2, B16 and C2 by the different immunization combinations are shown in FIG. 3: when the third needle is a recombinant protein vaccine and the fourth needle is a poxvirus vector vaccine, the level of neutralizing antibodies aiming at the three pseudoviruses is the highest and can be close to 300; the third needle was a poxvirus vector vaccine and the fourth needle was a recombinant protein vaccine, the level of neutralizing antibodies against the three pseudoviruses was also at a higher level and was not significantly different from the former case.
The experiment proves that when the second needle is a poxvirus vector vaccine, the third needle is a recombinant protein vaccine, the fourth needle is the poxvirus vector vaccine or the third needle is the poxvirus vector vaccine, and when the fourth needle is the recombinant protein vaccine, the titer and the broad spectrum of a neutralizing antibody aiming at HIV-1 can be well improved.
TABLE 4 different combinations of immunization in the third and fourth needles induce broad-spectrum neutralizing antibody experiments
Figure BDA0002407664600000152
Example 4: evaluation of the Induction Effect of the first needle on the broad-spectrum neutralizing antibodies of mice for different immunization combinations
According to the best combination pattern obtained in example 3, the latter three needles were fixed and the first needle was compared. Mice were immunized with different combinations of immunizations, which were evaluated to induce titers of neutralizing antibodies against the HIV-1 pseudoviruses GX191.2, B16, and C2 4 weeks after completion of the immunization.
The experimental procedure was as follows, mice were randomly divided into 5 groups, designated as control group, AE2F-gp145 group, AE2F-gp140 group, AE2F-SOSIP.664 group and R L42-gp 140 group based on the first needle immunogen, specific immunological combinations are shown in Table 5.
The titers of neutralizing antibodies generated against HIV-1 pseudoviruses GX191.2, B16 and C2 by the different immunization combinations are shown in FIG. 4: there were no significant differences between the four experimental groups. This experiment confirmed that when the immunogens of the latter three needles are in a better combination mode, the recombinant plasmid vaccine used in the first needle can induce better neutralizing antibody responses regardless of the membrane protein (gp145, gp140 or sosip.664) or subtype (AE or B) used.
TABLE 5 first-needle different immunization combination induced broad-spectrum neutralizing antibody experiment
Figure BDA0002407664600000161
Example 5: evaluation of Induction Effect of immunization strategy on broad-spectrum neutralizing antibody in rhesus monkey
According to the previous 4 examples, a better combination of DNA-R L42-gp 145+ rTV-AE2F-gp145+ protein-AE2F-SOSIP 664-ferritin was selected to immunize 6 rhesus monkeys after 2 weeks of immunization with the third immunization strategy was evaluated for the neutralizing antibody titers against the HIV-1 pseudovirus SH1.81, GX191.2, AE2F and Montefiori Global Panel, the neutralizing antibody titers generated in rhesus monkeys by the immunization strategy are shown in FIG. 5A, the highest titers against the same subtype of AE2F pseudovirus are around 200, while neutralizing antibodies are present against the majority of the other strains.
This experiment demonstrates that the immunization strategy of DNA-R L42-gpl 45+ rTV-AE2F-gp145+ protein-AE2F-SOSIP.664-ferritin is capable of generating broadly neutralizing antibodies in rhesus monkeys.
Example 6: evaluation of challenge protection effect of immunization strategy on rhesus monkeys
The rhesus monkeys immunized in example 5 were challenged to see the protection of challenge.
The method comprises the following specific steps: two weeks after completion of the third immunization 1000TCID was intravenously administered to each monkey50After the single dose of the SHIV-89.6 virus, peripheral blood was collected on days 3, 7, 10, 14, 28 and 35, respectively, and plasma was separated and then the virus load in the plasma was measured. Extraction of viral RNA from plasma
Figure BDA0002407664600000171
The Viral RNA extracted by 20 mu L is taken and added into a PCR tube, the PCR tube is placed on a PCR instrument and is pre-denatured at 70 ℃ for 10min, and a standard plasmid pSIVmac2 used for quantitative PCR is quantified39-gag was presented to Dr Jeffery L ifson laboratory, then the heat denatured RNA was cooled on ice for 5min, 20 μ L of pre-prepared reverse transcription buffer mixture was added, the system was prepared as shown in Table 6.1. instantaneous centrifugation was performed, the mixture liquid was centrifuged to the bottom of the tube, placed on a PCR instrument and reacted at 25 ℃ for 10min, then at 42 ℃ for 50min, at 95 ℃ for 5min, and finally at 4 ℃ for 5min, after the reverse transcription reaction was completed, the PCR tube was removed to obtain the corresponding cDNA product.
Then real-time fluorescent quantitative PCR (qPCR) was performed, new PCR tubes were prepared, and 20. mu. L PCR buffer mixtures were added to the wells as shown in Table 6.2.
a: gag21 primer sequence: 5'-GTCTGCGTCATCTGGTGCATTC-3'
b: gag22 primer sequence: 5'-CACTAGGTGTCTCTGCACTATCTGTTTTG-3'
c: gag23 primer sequence (probe): 5 '- (FAM) CTTCCTCAGTGTGTTTCACTTTCTCTTCTGCG- (BHQ1) -3'
Adding cDNA products obtained in the step 4 of 20 mu L into the qPCR system, making 2 multiple holes for each sample, instantly separating a PCR tube, placing the PCR tube on a qPCR instrument, carrying out a reaction procedure according to the following steps of 95 ℃ for 2min, 95 ℃ for 15s, 60 ℃ for 1min, 45 cycles, collecting fluorescence of FAM and BHQ, deriving data after the qPCR reaction is finished, calculating the Ct value of a synchronously made standard product, drawing a standard curve, converting the SIV copy number of the sample in each hole according to the standard curve, and finally multiplying the copy number by 10 to obtain the copy number of the SIV in each milliliter of plasma, wherein the sensitivity of the detection method is 100copies RNA/m L.
The virus attacking and protecting effect of the immune strategy on rhesus monkeys is shown in figure 5B, compared with a control group, six rhesus monkeys in an experimental group have good control on virus load, and the experiment proves that the immune strategy of DNA-R L42-gp 145+ rTV-AE2F-gp145+ protein-AE2F-SOSIP.664-ferritin can have good protecting effect on the virus attacking in rhesus monkeys.
TABLE 6.1 reverse transcription reaction System
Figure BDA0002407664600000181
TABLE 6.2 qPCR buffer System Components
Figure BDA0002407664600000182
Example 7: induction of broadly neutralizing antibodies in rhesus monkeys by different immunological combinations
According to the previous examples, two combination patterns were selected for immunization of rhesus monkeys, and the different immunization combinations were evaluated 2 weeks after completion of the immunization to induce titers of neutralizing antibodies against the HIV-1 pseudovirus GX 191.2.
The experimental procedure was as follows: chinese rhesus monkeys were randomly divided into 3 groups, respectively, control group, group1 and group 2. Specific immunological combinations are shown in table 7. The neutralizing antibody titers generated in rhesus monkeys by the different immunization combinations are shown in figure 6: both immunization combinations were able to produce neutralizing antibodies against the GX191.2 strain in rhesus monkeys with no significant difference between the two groups.
The experiment proves that the two immunization combination modes can induce better neutralizing antibody response in rhesus monkeys, and the combination of the second vaccine, the later two recombinant protein vaccines and the vaccinia virus vector vaccine is not only effective in small animals but also effective in non-human primates.
TABLE 7 different immunization combinations induce broad-spectrum neutralizing antibody experiments in rhesus monkeys
Figure BDA0002407664600000191
Sequence listing
<110> Shanghai city public health clinic center
<120> an immunological combination for inducing broadly neutralizing antibodies against HIV-1
<141>2020-03-09
<160>14
<170>SIPOSequenceListing 1.0
<210>1
<211>703
<212>PRT
<213>Human immunodeficiency virus
<400>1
Met Arg Val Lys Glu Thr Gln Met Asn Trp Pro Asn Leu Trp Lys Trp
1 5 10 15
Gly Thr Leu Ile Leu Gly Leu Val Ile Ile Cys Ser Ala Ser Asp Asn
2025 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Asp Ala Asp
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala His Glu Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Ile His Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Arg
85 90 95
Asn Asn Met Val Glu Gln Met Gln Glu Asp Val Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Ala Asn Trp Thr Asn Ser Asn Asn Thr Thr Asn Gly
130 135 140
Pro Asn Lys Ile Gly Asn Ile Thr Asp Glu Val Lys Asn Cys Thr Phe
145 150 155 160
Asn Met Thr Thr Glu Leu Lys Asp Lys Lys Gln Lys Val His Ala Leu
165 170 175
Phe Tyr Lys Leu Asp Ile Val Gln Ile Asn Ser Ser Glu Tyr Arg Leu
180 185190
Ile Asn Cys Asn Thr Ser Val Ile Lys Gln Ala Cys Pro Lys Ile Ser
195 200 205
Phe Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile
210 215 220
Leu Lys Cys Asn Asp Lys Asn Phe Asn Gly Thr Gly Pro Cys Lys Asn
225 230 235 240
Val Ser Ser Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr
245 250 255
Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg
260 265 270
Ser Glu Asn Leu Thr Asn Asn Ala Lys Thr Ile Ile Val His Leu Asn
275 280 285
Lys Ser Val Glu Ile Asn Cys Thr Arg Pro Ser Asn Asn Thr Arg Thr
290 295 300
Ser Ile Thr Met Gly Pro Gly Gln Val Phe Tyr Arg Thr Gly Asp Ile
305 310 315 320
Ile Gly Asp Ile Arg Lys Ala Tyr Cys Glu Ile Asn Gly Ile Lys Trp
325 330 335
Asn Glu Val Leu Val Gln Val Thr Gly Lys Leu Lys Glu His Phe Asn
340 345350
Lys Thr Ile Ile Phe Gln Pro Pro Ser Gly Gly Asp Leu Glu Ile Ile
355 360 365
Thr His His Phe Ser Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Thr
370 375 380
Lys Leu Phe Asn Asn Thr Cys Ile Gly Asn Thr Ser Met Glu Gly Cys
385 390 395 400
Asn Asn Thr Ile Ile Leu Pro Cys Lys Ile Lys Gln Ile Ile Asn Met
405 410 415
Trp Gln Gly Val Gly Gln Ala Met Tyr Ala Pro Pro Ile Ser Gly Arg
420 425 430
Ile Asn Cys Val Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly
435 440 445
Gly Ala Asp Asn Asn Thr Thr Asn Glu Thr Phe Arg Pro Gly Gly Gly
450 455 460
Asn Ile Lys Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val
465 470 475 480
Glu Ile Glu Pro Leu Gly Ile Ala Pro Thr Arg Ala Lys Arg Arg Val
485 490 495
Val Glu Arg Glu Lys Arg Ala Val Gly Ile Gly Ala Met Ile Phe Gly
500 505 510
Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu
515 520 525
Thr Val Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser
530 535 540
Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln Leu Thr
545 550 555 560
Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg
565 570 575
Tyr Leu Lys Asp Gln Lys Phe Leu Gly Leu Trp Gly Cys Ser Gly Lys
580 585 590
Ile Ile Cys Thr Thr Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys
595 600 605
Ser Phe Glu Glu Ile Trp Asp Asn Met Thr Trp Ile Glu Trp Glu Arg
610 615 620
Glu Ile Ser Asn Tyr Thr Ser Gln Ile Tyr Glu Ile Leu Thr Glu Ser
625 630 635 640
Gln Asn Gln Gln Asp Arg Asn Glu Lys Asp Leu Leu Glu Leu Asp Lys
645 650 655
Trp Ala Ser Leu Trp Asn Trp Phe Asp Ile Thr Asn Trp Leu Trp Tyr
660 665 670
Ile Lys Ile Phe Ile Ile Ile Val Gly Ser Leu Ile Gly Leu Arg Ile
675 680 685
Ile Phe Ala Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly Tyr
690 695 700
<210>2
<211>2112
<212>DNA
<213>Human immunodeficiency virus
<400>2
atgcgggtga aggaaacgca gatgaactgg ccaaacctgt ggaaatgggg gaccctgatt 60
ctcggcctgg tcattatatg cagcgcctcc gacaacctgt gggtgaccgt ctactatggc 120
gtgcccgtct ggcgcgacgc ggacaccacg ctgttttgtg ccagcgacgc caaggcccat 180
gagaccgagg tccataacgt gtgggccacc cacgcctgcg tgcccaccga ccctaacccc 240
caggagattc atctcgaaaa cgtgaccgag aacttcaata tgtggcgcaa caatatggtg 300
gagcagatgc aggaggatgt gatcagcctg tgggaccagt ctctgaagcc ctgtgtgaag 360
ctgacccctc tgtgcgtgac gctcaactgc actaacgcca actggacaaa ttccaataac 420
accacgaacg gccccaacaa gattggcaac attacggatg aggtgaagaa ctgtaccttc 480
aacatgacca ctgaactgaa ggacaagaaa cagaaggtcc acgccctgtt ctataagctc 540
gacattgtgc agattaactc tagcgagtat aggctgatta actgcaacac cagcgtgatt 600
aagcaagcct gtcccaagat ttcgttcgat cccatcccga ttcactactg cacccccgcc 660
ggctacgcca ttctcaagtg caacgacaag aatttcaacg gcaccggccc ctgcaagaac 720
gtctctagtg tacaatgcac ccacgggatt aaacccgtgg tcagcacaca actcctgctc 780
aacggcagcc tggcagagga agagattatc attaggagcg agaatctgac caacaatgcg 840
aagacaataa ttgtgcactt aaacaagtcc gtggagatta actgtacccg ccccagcaac 900
aatacacgca cctcgattac catgggaccg ggccaggtgt tctatagaac cggggatatt 960
atcggtgaca tccgcaaagc ctactgcgag attaacggga ttaagtggaa tgaagtgctc 1020
gtccaggtca cagggaaact caaggagcac ttcaataaga ccattatctt tcaaccccca 1080
agcggcggtg acctggagat cataacccac catttcagtt gccggggcga gttcttttac 1140
tgcaacacta ccaagctctt taacaatacc tgtattggca acaccagcat ggagggctgt 1200
aacaatacca ttatcctgcc gtgcaaaatt aagcagatta tcaacatgtg gcagggcgtg 1260
ggccaggcca tgtacgcccc cccgattagc ggccgcatta actgtgttag caatattacc 1320
ggcattctgc tcacacggga tgggggcgcc gacaacaata ccactaacga gaccttccgc 1380
ccagggggcg ggaacattaa ggacaactgg aggagcgagc tgtacaaata caaggtcgtg 1440
gagattgaac cactgggcat tgcccccaca cgggccaagc gccgggtcgt ggagcgcgaa 1500
aagcgcgccg tgggcattgg cgcaatgatt ttcggcttcc tcggcgccgc tggcagtacc 1560
atgggcgccg cttcgattac ccttaccgtg caggctcggc aactgctcag cggcattgtg 1620
cagcaacagt ccaacctgct ccgcgccatt gaggctcagc aacacctgct ccagctgact 1680
gtgtggggca ttaagcagtt acaggccagg gtgctggccg tggagcgcta cctcaaggat 1740
cagaagttcc tgggtctttg gggttgcagc gggaagatta tctgcaccac ggcggtgcct 1800
tggaactcca gctggagcaa caagtccttt gaggaaattt gggacaacat gacctggatt 1860
gagtgggaac gcgaaattag caactacacc agccaaattt acgagattct gaccgaatcc 1920
caaaaccagc aggacaggaa cgagaaggac ctgttggagc tggacaaatg ggcctccctg 1980
tggaactggt ttgacattac caactggctg tggtatatta agattttcat tattattgtg 2040
ggctccctca ttgggctccg cattattttc gccgtgctgt ccattgtcaa ccgggtcagg 2100
cagggctact aa 2112
<210>3
<211>662
<212>PRT
<213>Human immunodeficiency virus
<400>3
Met Arg Val Lys Glu Thr Gln Met Asn Trp Pro Asn Leu Trp Lys Trp
1 5 10 15
Gly Thr Leu Ile Leu Gly Leu Val Ile Ile Cys Ser Ala Ser Asp Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Asp Ala Asp
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala His Glu Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Ile His Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Arg
85 90 95
Asn Asn Met Val Glu Gln Met Gln Glu Asp Val Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Ala Asn Trp Thr Asn Ser Asn Asn Thr Thr Asn Gly
130 135 140
Pro Asn Lys Ile Gly Asn Ile Thr Asp Glu Val Lys Asn Cys Thr Phe
145 150 155 160
Asn Met Thr Thr Glu Leu Lys Asp Lys Lys Gln Lys Val His Ala Leu
165 170 175
Phe Tyr Lys Leu Asp Ile Val Gln Ile Asn Ser Ser Glu Tyr Arg Leu
180 185 190
Ile Asn Cys Asn Thr Ser Val Ile Lys Gln Ala Cys Pro Lys Ile Ser
195 200 205
Phe Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile
210 215 220
Leu Lys Cys Asn Asp Lys Asn Phe Asn Gly Thr Gly Pro Cys Lys Asn
225 230 235 240
Val Ser Ser Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr
245 250 255
Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg
260 265 270
Ser Glu Asn Leu Thr Asn Asn Ala Lys Thr Ile Ile Val His Leu Asn
275 280 285
Lys Ser Val Glu Ile Asn Cys Thr Arg Pro Ser Asn Asn Thr Arg Thr
290 295 300
Ser Ile Thr Met Gly Pro Gly Gln Val Phe Tyr Arg Thr Gly Asp Ile
305 310 315 320
Ile Gly Asp Ile Arg Lys Ala Tyr Cys Glu Ile Asn Gly Ile Lys Trp
325 330 335
Asn Glu Val Leu Val Gln Val Thr Gly Lys Leu Lys Glu His Phe Asn
340 345 350
Lys Thr Ile Ile Phe Gln Pro Pro Ser Gly Gly Asp Leu Glu Ile Ile
355 360 365
Thr His His Phe Ser Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Thr
370 375 380
Lys Leu Phe Asn Asn Thr Cys Ile Gly Asn Thr Ser Met Glu Gly Cys
385 390 395 400
Asn Asn Thr Ile Ile Leu Pro Cys Lys Ile Lys Gln Ile Ile Asn Met
405 410 415
Trp Gln Gly Val Gly Gln Ala Met Tyr Ala Pro Pro Ile Ser Gly Arg
420 425 430
Ile Asn Cys Val Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly
435 440 445
Gly Ala Asp Asn Asn Thr Thr Asn Glu Thr Phe Arg Pro Gly Gly Gly
450 455 460
Asn Ile Lys Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val
465 470 475 480
Glu Ile Glu Pro Leu Gly Ile Ala Pro Thr Arg Ala Lys Arg Arg Val
485 490 495
Val Glu Arg Glu Lys Arg Ala Val Gly Ile Gly Ala Met Ile Phe Gly
500 505 510
Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu
515 520 525
Thr Val Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser
530 535 540
Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln Leu Thr
545 550 555 560
Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg
565 570 575
Tyr Leu Lys Asp Gln Lys Phe Leu Gly Leu Trp Gly Cys Ser Gly Lys
580 585 590
Ile Ile Cys Thr Thr Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys
595 600 605
Ser Phe Glu Glu Ile Trp Asp Asn Met Thr Trp Ile Glu Trp Glu Arg
610 615 620
Glu Ile Ser Asn Tyr Thr Ser Gln Ile Tyr Glu Ile Leu Thr Glu Ser
625 630 635 640
Gln Asn Gln Gln Asp Arg Asn Glu Lys Asp Leu Leu Glu Leu Asp Lys
645 650 655
Trp Ala Ser Leu Trp Asn
660
<210>4
<211>1989
<212>DNA
<213>Human immunodeficiency virus
<400>4
atgcgggtga aggaaacgca gatgaactgg ccaaacctgt ggaaatgggg gaccctgatt 60
ctcggcctgg tcattatatg cagcgcctcc gacaacctgt gggtgaccgt ctactatggc 120
gtgcccgtct ggcgcgacgc ggacaccacg ctgttttgtg ccagcgacgc caaggcccat 180
gagaccgagg tccataacgt gtgggccacc cacgcctgcg tgcccaccga ccctaacccc 240
caggagattc atctcgaaaa cgtgaccgag aacttcaatatgtggcgcaa caatatggtg 300
gagcagatgc aggaggatgt gatcagcctg tgggaccagt ctctgaagcc ctgtgtgaag 360
ctgacccctc tgtgcgtgac gctcaactgc actaacgcca actggacaaa ttccaataac 420
accacgaacg gccccaacaa gattggcaac attacggatg aggtgaagaa ctgtaccttc 480
aacatgacca ctgaactgaa ggacaagaaa cagaaggtcc acgccctgtt ctataagctc 540
gacattgtgc agattaactc tagcgagtat aggctgatta actgcaacac cagcgtgatt 600
aagcaagcct gtcccaagat ttcgttcgat cccatcccga ttcactactg cacccccgcc 660
ggctacgcca ttctcaagtg caacgacaag aatttcaacg gcaccggccc ctgcaagaac 720
gtctctagtg tacaatgcac ccacgggatt aaacccgtgg tcagcacaca actcctgctc 780
aacggcagcc tggcagagga agagattatc attaggagcg agaatctgac caacaatgcg 840
aagacaataa ttgtgcactt aaacaagtcc gtggagatta actgtacccg ccccagcaac 900
aatacacgca cctcgattac catgggaccg ggccaggtgt tctatagaac cggggatatt 960
atcggtgaca tccgcaaagc ctactgcgag attaacggga ttaagtggaa tgaagtgctc 1020
gtccaggtca cagggaaact caaggagcac ttcaataaga ccattatctt tcaaccccca 1080
agcggcggtg acctggagat cataacccac catttcagtt gccggggcga gttcttttac 1140
tgcaacacta ccaagctctt taacaatacc tgtattggca acaccagcat ggagggctgt 1200
aacaatacca ttatcctgcc gtgcaaaatt aagcagatta tcaacatgtg gcagggcgtg 1260
ggccaggcca tgtacgcccc cccgattagc ggccgcatta actgtgttag caatattacc 1320
ggcattctgc tcacacggga tgggggcgcc gacaacaata ccactaacga gaccttccgc 1380
ccagggggcg ggaacattaa ggacaactgg aggagcgagc tgtacaaata caaggtcgtg 1440
gagattgaac cactgggcat tgcccccaca cgggccaagc gccgggtcgt ggagcgcgaa 1500
aagcgcgccg tgggcattgg cgcaatgatt ttcggcttcc tcggcgccgc tggcagtacc 1560
atgggcgccg cttcgattac ccttaccgtg caggctcggc aactgctcag cggcattgtg 1620
cagcaacagt ccaacctgct ccgcgccatt gaggctcagc aacacctgct ccagctgact 1680
gtgtggggca ttaagcagtt acaggccagg gtgctggccg tggagcgcta cctcaaggat 1740
cagaagttcc tgggtctttg gggttgcagc gggaagatta tctgcaccac ggcggtgcct 1800
tggaactcca gctggagcaa caagtccttt gaggaaattt gggacaacat gacctggatt 1860
gagtgggaac gcgaaattag caactacacc agccaaattt acgagattct gaccgaatcc 1920
caaaaccagc aggacaggaa cgagaaggac ctgttggagc tggacaaatg ggcctccctg 1980
tggaactaa 1989
<210>5
<211>701
<212>PRT
<213>Human immunodeficiency virus
<400>5
Met Arg Val Thr Gly Ile Arg Lys Asn Tyr Gln His Leu Trp Arg Trp
1 5 10 15
Gly Thr Met Leu Leu Gly Met Leu Met Ile Cys Asn Ala Ala Glu Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala Thr
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met Trp Lys
85 90 95
Asn Asn Met Val Glu Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Leu Lys Asn Ala Thr Asn Thr Ser Ser Thr Met Glu
130 135 140
Gly Gly Glu Ile Lys Asn Cys Ser Phe Asn Ile Thr Thr Ser Ile Lys
145 150 155 160
Thr Lys Val Lys Asp Tyr Ala Leu Phe Tyr Lys Val Asp Val Val Pro
165 170 175
Ile Gly Asn Asp Ser Thr Ser Tyr Arg Leu Ile Asn Cys Asn Thr Ser
180 185 190
Val Ile Thr Gln Ala Cys Pro Lys Val Ser Phe Glu Pro Ile Pro Ile
195 200 205
His Tyr Cys Thr Pro Ala Gly Phe Ala Ile Ile Lys Cys Asn Asn Lys
210 215 220
Lys Phe Asn Gly Thr Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys
225 230 235 240
Thr His Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly
245 250 255
Ser Leu Ala Glu Glu Glu Val Val Ile Lys Phe Ser Asn Phe Thr Asp
260 265 270
Asn Ala Arg Val Ile Ile Val Gln Leu Asn Glu Ser Val Glu Ile Lys
275 280 285
Cys Ile Arg Pro Asn Asn Asn Thr Arg Lys Ser Ile His Leu Gly Pro
290 295 300
Gly Lys Ala Trp Tyr Thr Thr Gly Gln Ile Ile Gly Asp Ile Arg Gln
305 310 315 320
Ala His Cys Asn Leu Ser Ser Thr Lys Trp Asn Asn Thr Leu Lys Gln
325 330 335
Ile Thr Lys Lys Leu Arg Glu Gln Phe Gly Asn Lys Thr Ile Val Phe
340 345 350
Asn Gln Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn
355 360 365
Cys Gly Gly Glu Phe Phe Tyr Cys Asn Thr Ser Gln Leu Phe Asn Ser
370 375 380
Thr Trp Asn Asp Thr Gly Thr Trp Asn Asp Thr Thr Gly Asn Ser Thr
385 390 395 400
Ile Thr Leu Pro Cys Arg Ile Lys Gln Ile Val Asn Met Trp Gln Glu
405 410 415
Val Gly Lys Ala Met Tyr Ala Pro Pro Ile Glu Gly Gln Ile Arg Cys
420 425 430
Ser Ser Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Asn
435 440 445
Glu Ser Lys Pro Thr Glu Thr Phe Arg Pro Gly Gly Gly Asp Met Arg
450 455 460
Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Lys Ile Glu
465 470 475 480
Pro Leu Gly Val Ala Pro Thr Lys Ala Arg Arg Arg Val Val Gln Arg
485 490 495
Glu Lys Arg Ala Val Gly Thr Ile Gly Ala Met Phe Leu Gly Phe Leu
500 505 510
Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr Val
515520 525
Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Arg Asn Leu
530 535 540
Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp
545 550 555 560
Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg Tyr Leu
565 570 575
Lys Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly Lys Leu Ile
580 585 590
Cys Thr Thr Ala Val Pro Trp Asn Ala Ser Trp Ser Asn Lys Ser Leu
595 600 605
His Glu Ile Trp Asn Asn Met Thr Trp Met Glu Trp Glu Arg Glu Ile
610 615 620
Asp Asn Tyr Thr Arg Glu Ile Tyr Thr Leu Ile Glu Glu Ser Gln Asn
625 630 635 640
Gln Gln Glu Lys Asn Glu Leu Glu Leu Leu Glu Leu Asp Lys Trp Ala
645 650 655
Ser Leu Trp Asn Trp Phe Asp Ile Thr Lys Trp Leu Trp Tyr Ile Lys
660 665 670
Ile Phe Ile Met Ile Val Gly Gly Leu Val Gly Leu Arg Ile Val Phe
675680 685
Ala Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly Tyr
690 695 700
<210>6
<211>2106
<212>DNA
<213>Human immunodeficiency virus
<400>6
atgcgcgtta cgggcattcg gaagaactac cagcacctgt ggcgctgggg caccatgctc 60
ctgggcatgc tgatgatttg caacgccgcg gaaaacctgt gggtgaccgt gtactatggg 120
gtgcccgtct ggaaggaagc caccacaacc ctgttttgcg ccagcgacgc caaagcctac 180
gacaccgaag tgcataatgt ctgggccacc cacgcttgcg tccccaccga ccccaacccc 240
caggaggtgg tcctgggcaa cgtcaccgag aacttcaaca tgtggaagaa caatatggtc 300
gagcagatgc acgaagacat tatctccctg tgggaccaga gcctgaagcc ttgtgtgaag 360
ctgaccccac tgtgcgtcac cctcaactgt actaacctga agaacgccac caacacctcc 420
agcaccatgg agggcggtga gattaagaac tgctccttca atattaccac aagcattaag 480
acgaaagtga aggactacgc cctcttttac aaagtggacg tggtccccat tggcaacgac 540
agcaccagct accgcctgat taactgcaat accagcgtga ttacccaagc ctgccccaag 600
gtgtccttcg agcctattcc catccactac tgcactcctg ccggcttcgc cattatcaag 660
tgcaacaata aaaagttcaa tggaaccggc ccctgtacca acgtctccac cgtgcagtgt 720
acccacggca ttcgccccgt ggtcagcacc cagcttctgc tcaacgggag cctcgccgaa 780
gaggaagtcg tgattaaatt ctccaacttc actgataatg cccgcgtgat tatcgtgcag 840
ctgaacgaga gcgtagagat taagtgcatt cggcccaata acaatacccg caagtctatt 900
cacctcggcc ccggcaaggc ttggtacacc actggccaga ttatcggcga cattcgccag 960
gcgcactgca acctgtccag cactaagtgg aacaatacac tgaagcagat taccaagaaa 1020
ctgcgcgagc agttcggcaa caagaccatt gtgtttaacc agagctccgg aggcgacccg 1080
gagattgtga tgcactcttt caactgcggg ggagagttct tttactgcaa cacctcccag 1140
ctgttcaact ccacctggaa cgacaccggc acctggaacg acaccacagg taattccacg 1200
attaccctcc cctgccgcat taagcagatc gtgaacatgt ggcaggaggt gggcaaggcc 1260
atgtacgccc ccccaattga aggccagatt aggtgcagct ccaatattac cggcctgctc 1320
ctgacccgcg acggtgggaa taacgagagc aagcctaccg agaccttccg ccctggcggt 1380
ggcgacatgc gcgataactg gcgcagcgag ctgtacaagt acaaggtcgt gaagattgag 1440
cccctgggcg tggccccaac caaggcccgc cggcgcgtgg tccagcggga gaaacgcgcc 1500
gtgggcacca tcggggccat gttcctgggc ttcctgggcg ctgccggctc cacgatgggg 1560
gccgctagca ttaccctgac cgtccaggcc cgccagctcc tgtccgggat tgtgcagcaa 1620
cagcgcaacc tcctgcgcgc cattgaggcc cagcaacacc tcttgcagct gaccgtgtgg 1680
gggattaagc agttgcaggc acgggtgctg gccgtggagc gctacctcaa ggatcagcag 1740
ctgctcggga tttggggatg cagcggcaag ctcatttgta ccacagccgt gccctggaac 1800
gcctcctggt ccaacaagag cctccacgaa atttggaata acatgacctg gatggagtgg 1860
gagcgcgaga ttgataacta caccagggag atttacaccctgatcgagga aagccagaac 1920
cagcaggaga agaacgaact ggaactcctg gagctggata agtgggcctc cctgtggaac 1980
tggttcgaca ttaccaaatg gctgtggtac attaagattt tcatcatgat tgtgggcggg 2040
ctggtgggcc tgcggatcgt gttcgcggtg ctctccattg tcaaccgcgt gcgccagggg 2100
tactga 2106
<210>7
<211>660
<212>PRT
<213>Human immunodeficiency virus
<400>7
Met Arg Val Thr Gly Ile Arg Lys Asn Tyr Gln His Leu Trp Arg Trp
1 5 10 15
Gly Thr Met Leu Leu Gly Met Leu Met Ile Cys Asn Ala Ala Glu Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala Thr
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met Trp Lys
85 90 95
Asn Asn Met Val Glu Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Leu Lys Asn Ala Thr Asn Thr Ser Ser Thr Met Glu
130 135 140
Gly Gly Glu Ile Lys Asn Cys Ser Phe Asn Ile Thr Thr Ser Ile Lys
145 150 155 160
Thr Lys Val Lys Asp Tyr Ala Leu Phe Tyr Lys Val Asp Val Val Pro
165 170 175
Ile Gly Asn Asp Ser Thr Ser Tyr Arg Leu Ile Asn Cys Asn Thr Ser
180 185 190
Val Ile Thr Gln Ala Cys Pro Lys Val Ser Phe Glu Pro Ile Pro Ile
195 200 205
His Tyr Cys Thr Pro Ala Gly Phe Ala Ile Ile Lys Cys Asn Asn Lys
210 215 220
Lys Phe Asn Gly Thr Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys
225 230 235 240
Thr His Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly
245 250 255
Ser Leu Ala Glu Glu Glu Val Val Ile Lys Phe Ser Asn Phe Thr Asp
260 265 270
Asn Ala Arg Val Ile Ile Val Gln Leu Asn Glu Ser Val Glu Ile Lys
275 280 285
Cys Ile Arg Pro Asn Asn Asn Thr Arg Lys Ser Ile His Leu Gly Pro
290 295 300
Gly Lys Ala Trp Tyr Thr Thr Gly Gln Ile Ile Gly Asp Ile Arg Gln
305 310 315 320
Ala His Cys Asn Leu Ser Ser Thr Lys Trp Asn Asn Thr Leu Lys Gln
325 330 335
Ile Thr Lys Lys Leu Arg Glu Gln Phe Gly Asn Lys Thr Ile Val Phe
340 345 350
Asn Gln Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn
355 360 365
Cys Gly Gly Glu Phe Phe Tyr Cys Asn Thr Ser Gln Leu Phe Asn Ser
370 375 380
Thr Trp Asn Asp Thr Gly Thr Trp Asn Asp Thr Thr Gly Asn Ser Thr
385 390 395 400
Ile Thr Leu Pro Cys Arg Ile Lys Gln Ile Val Asn Met Trp Gln Glu
405 410 415
Val Gly Lys Ala Met Tyr Ala Pro Pro Ile Glu Gly Gln Ile Arg Cys
420 425 430
Ser Ser Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Asn
435 440 445
Glu Ser Lys Pro Thr Glu Thr Phe Arg Pro Gly Gly Gly Asp Met Arg
450 455 460
Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Lys Ile Glu
465 470 475 480
Pro Leu Gly Val Ala Pro Thr Lys Ala Arg Arg Arg Val Val Gln Arg
485 490 495
Glu Lys Arg Ala Val Gly Thr Ile Gly Ala Met Phe Leu Gly Phe Leu
500 505 510
Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr Val
515 520 525
Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Arg Asn Leu
530 535 540
Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp
545 550 555 560
Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg Tyr Leu
565 570 575
Lys Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly Lys Leu Ile
580 585 590
Cys Thr Thr Ala Val Pro Trp Asn Ala Ser Trp Ser Asn Lys Ser Leu
595 600 605
His Glu Ile Trp Asn Asn Met Thr Trp Met Glu Trp Glu Arg Glu Ile
610 615 620
Asp Asn Tyr Thr Arg Glu Ile Tyr Thr Leu Ile Glu Glu Ser Gln Asn
625 630 635 640
Gln Gln Glu Lys Asn Glu Leu Glu Leu Leu Glu Leu Asp Lys Trp Ala
645 650 655
Ser Leu Trp Asn
660
<210>8
<211>1983
<212>DNA
<213>Human immunodeficiency virus
<400>8
atgcgcgtta cgggcattcg gaagaactac cagcacctgt ggcgctgggg caccatgctc 60
ctgggcatgc tgatgatttg caacgccgcg gaaaacctgt gggtgaccgt gtactatggg 120
gtgcccgtct ggaaggaagc caccacaacc ctgttttgcg ccagcgacgc caaagcctac 180
gacaccgaag tgcataatgt ctgggccacc cacgcttgcg tccccaccga ccccaacccc 240
caggaggtgg tcctgggcaa cgtcaccgag aacttcaaca tgtggaagaa caatatggtc 300
gagcagatgc acgaagacat tatctccctg tgggaccaga gcctgaagcc ttgtgtgaag 360
ctgaccccac tgtgcgtcac cctcaactgt actaacctga agaacgccac caacacctcc 420
agcaccatgg agggcggtga gattaagaac tgctccttca atattaccac aagcattaag 480
acgaaagtga aggactacgc cctcttttac aaagtggacg tggtccccat tggcaacgac 540
agcaccagct accgcctgat taactgcaat accagcgtga ttacccaagc ctgccccaag 600
gtgtccttcg agcctattcc catccactac tgcactcctg ccggcttcgc cattatcaag 660
tgcaacaata aaaagttcaa tggaaccggc ccctgtacca acgtctccac cgtgcagtgt 720
acccacggca ttcgccccgt ggtcagcacc cagcttctgc tcaacgggag cctcgccgaa 780
gaggaagtcg tgattaaatt ctccaacttc actgataatg cccgcgtgat tatcgtgcag 840
ctgaacgaga gcgtagagat taagtgcatt cggcccaata acaatacccg caagtctatt 900
cacctcggcc ccggcaaggc ttggtacacc actggccaga ttatcggcga cattcgccag 960
gcgcactgca acctgtccag cactaagtgg aacaatacac tgaagcagat taccaagaaa 1020
ctgcgcgagc agttcggcaa caagaccatt gtgtttaacc agagctccgg aggcgacccg 1080
gagattgtga tgcactcttt caactgcggg ggagagttct tttactgcaa cacctcccag 1140
ctgttcaact ccacctggaa cgacaccggc acctggaacg acaccacagg taattccacg 1200
attaccctcc cctgccgcat taagcagatc gtgaacatgt ggcaggaggt gggcaaggcc 1260
atgtacgccc ccccaattga aggccagatt aggtgcagct ccaatattac cggcctgctc 1320
ctgacccgcg acggtgggaa taacgagagc aagcctaccg agaccttccg ccctggcggt 1380
ggcgacatgc gcgataactg gcgcagcgag ctgtacaagt acaaggtcgt gaagattgag 1440
cccctgggcg tggccccaac caaggcccgc cggcgcgtgg tccagcggga gaaacgcgcc 1500
gtgggcacca tcggggccat gttcctgggc ttcctgggcg ctgccggctc cacgatgggg 1560
gccgctagca ttaccctgac cgtccaggcc cgccagctcc tgtccgggat tgtgcagcaa 1620
cagcgcaacc tcctgcgcgc cattgaggcc cagcaacacc tcttgcagct gaccgtgtgg 1680
gggattaagc agttgcaggc acgggtgctg gccgtggagc gctacctcaa ggatcagcag 1740
ctgctcggga tttggggatg cagcggcaag ctcatttgta ccacagccgt gccctggaac 1800
gcctcctggt ccaacaagag cctccacgaa atttggaata acatgacctg gatggagtgg 1860
gagcgcgaga ttgataacta caccagggag atttacaccc tgatcgagga aagccagaac 1920
cagcaggaga agaacgaact ggaactcctg gagctggata agtgggcctc cctgtggaac 1980
taa 1983
<210>9
<211>673
<212>PRT
<213>Human immunodeficiency virus
<400>9
Met Arg Val Lys Glu Thr Gln Met Asn Trp Pro Asn Leu Trp Lys Trp
1 5 10 15
Gly Thr Leu Ile Leu Gly Leu Val Ile Ile Cys Ser Ala Ser Asp Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Asp Ala Asp
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala His Glu Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Ile His Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Arg
85 90 95
Asn Asn Met Val Glu Gln Met Gln Glu Asp Val Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Ala Asn Trp Thr Asn Ser Asn Asn Thr Thr Asn Gly
130 135 140
Pro Asn Lys Ile Gly Asn Ile Thr Asp Glu Val Lys Asn Cys Thr Phe
145 150 155 160
Asn Met Thr Thr Glu Leu Lys Asp Lys Lys Gln Lys Val His Ala Leu
165 170 175
Phe Tyr Lys Leu Asp Ile Val Gln Ile Asn Ser Ser Glu Tyr Arg Leu
180 185 190
Ile Asn Cys Asn Thr Ser Val Ile Lys Gln Ala Cys Pro Lys Ile Ser
195 200 205
Phe Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile
210 215 220
Leu Lys Cys Asn Asp Lys Asn Phe Asn Gly Thr Gly Pro Cys Lys Asn
225 230 235 240
Val Ser Ser Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr
245 250 255
Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg
260 265 270
Ser Glu Asn Leu Thr Asn Asn Ala Lys Thr Ile Ile Val His Leu Asn
275 280 285
Lys Ser Val Glu Ile Asn Cys Thr Arg Pro Ser Asn Asn Thr Arg Thr
290 295 300
Ser Ile Thr Met Gly Pro Gly Gln Val Phe Tyr Arg Thr Gly Asp Ile
305 310 315 320
Ile Gly Asp Ile Arg Lys Ala Tyr Cys Glu Ile Asn Gly Ile Lys Trp
325 330 335
Asn Glu Val Leu Val Gln Val Thr Gly Lys Leu Lys Glu His Phe Asn
340 345 350
Lys Thr Ile Ile Phe Gln Pro Pro Ser Gly Gly Asp Leu Glu Ile Ile
355 360 365
Thr His His Phe Ser Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Thr
370 375 380
Lys Leu Phe Asn Asn Thr Cys Ile Gly Asn Thr Ser Met Glu Gly Cys
385 390 395 400
Asn Asn Thr Ile Ile Leu Pro Cys Lys Ile Lys Gln Ile Ile Asn Met
405 410 415
Trp Gln Gly Val Gly Gln Ala Met Tyr Ala Pro Pro Ile Ser Gly Arg
420 425 430
Ile Asn Cys Val Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly
435 440 445
Gly Ala Asp Asn Asn Thr Thr Asn Glu Thr Phe Arg Pro Gly Gly Gly
450 455 460
Asn Ile Lys Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val
465 470 475 480
Glu Ile Glu Pro Leu Gly Ile Ala Pro Thr Arg Cys Lys Arg Arg Val
485 490 495
Val Glu Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
500 505 510
Gly Ala Val Gly Ile Gly Ala Met Ile Phe Gly Phe Leu Gly Ala Ala
515 520 525
Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr Val Gln Ala Arg
530535 540
Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser Asn Leu Leu Arg Ala
545 550 555 560
Pro Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp Gly Ile Lys
565 570 575
Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg Tyr Leu Lys Asp Gln
580 585 590
Lys Phe Leu Gly Leu Trp Gly Cys Ser Gly Lys Ile Ile Cys Cys Thr
595 600 605
Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys Ser Phe Glu Glu Ile
610 615 620
Trp Asp Asn Met Thr Trp Ile Glu Trp Glu Arg Glu Ile Ser Asn Tyr
625 630 635 640
Thr Ser Gln Ile Tyr Glu Ile Leu Thr Glu Ser Gln Asn Gln Gln Asp
645 650 655
Arg Asn Glu Lys Asp Leu Leu Glu Leu Asp Lys Trp Ala Ser Leu Trp
660 665 670
Asn
<210>10
<211>2022
<212>DNA
<213>Human immunodeficiency virus
<400>10
atgcgggtga aggaaacgca gatgaactgg ccaaacctgt ggaaatgggg gaccctgatt 60
ctcggcctgg tcattatatg cagcgcctcc gacaacctgt gggtgaccgt ctactatggc 120
gtgcccgtct ggcgcgacgc ggacaccacg ctgttttgtg ccagcgacgc caaggcccat 180
gagaccgagg tccataacgt gtgggccacc cacgcctgcg tgcccaccga ccctaacccc 240
caggagattc atctcgaaaa cgtgaccgag aacttcaata tgtggcgcaa caatatggtg 300
gagcagatgc aggaggatgt gatcagcctg tgggaccagt ctctgaagcc ctgtgtgaag 360
ctgacccctc tgtgcgtgac gctcaactgc actaacgcca actggacaaa ttccaataac 420
accacgaacg gccccaacaa gattggcaac attacggatg aggtgaagaa ctgtaccttc 480
aacatgacca ctgaactgaa ggacaagaaa cagaaggtcc acgccctgtt ctataagctc 540
gacattgtgc agattaactc tagcgagtat aggctgatta actgcaacac cagcgtgatt 600
aagcaagcct gtcccaagat ttcgttcgat cccatcccga ttcactactg cacccccgcc 660
ggctacgcca ttctcaagtg caacgacaag aatttcaacg gcaccggccc ctgcaagaac 720
gtctctagtg tacaatgcac ccacgggatt aaacccgtgg tcagcacaca actcctgctc 780
aacggcagcc tggcagagga agagattatc attaggagcg agaatctgac caacaatgcg 840
aagacaataa ttgtgcactt aaacaagtcc gtggagatta actgtacccg ccccagcaac 900
aatacacgca cctcgattac catgggaccg ggccaggtgt tctatagaac cggggatatt 960
atcggtgaca tccgcaaagc ctactgcgag attaacggga ttaagtggaa tgaagtgctc 1020
gtccaggtca cagggaaact caaggagcac ttcaataaga ccattatctt tcaaccccca 1080
agcggcggtg acctggagat cataacccac catttcagtt gccggggcga gttcttttac 1140
tgcaacacta ccaagctctt taacaatacc tgtattggca acaccagcat ggagggctgt 1200
aacaatacca ttatcctgcc gtgcaaaatt aagcagatta tcaacatgtg gcagggcgtg 1260
ggccaggcca tgtacgcccc cccgattagc ggccgcatta actgtgttag caatattacc 1320
ggcattctgc tcacacggga tgggggcgcc gacaacaata ccactaacga gaccttccgc 1380
ccagggggcg ggaacattaa ggacaactgg aggagcgagc tgtacaaata caaggtcgtg 1440
gagattgaac cactgggcat tgcccccaca cggtgcaagc gccgggtcgt ggagggcgga 1500
agtggcggcg gcggaagtgg cggcggcgga agtggcggcg ccgtgggcat tggcgcaatg 1560
attttcggct tcctcggcgc cgctggcagt accatgggcg ccgcttcgat tacccttacc 1620
gtgcaggctc ggcaactgct cagcggcatt gtgcagcaac agtccaacct gctccgcgcc 1680
cccgaggctc agcaacacct gctccagctg actgtgtggg gcattaagca gttacaggcc 1740
agggtgctgg ccgtggagcg ctacctcaag gatcagaagt tcctgggtct ttggggttgc 1800
agcgggaaga ttatctgctg cacggcggtg ccttggaact ccagctggag caacaagtcc 1860
tttgaggaaa tttgggacaa catgacctgg attgagtggg aacgcgaaat tagcaactac 1920
accagccaaa tttacgagat tctgaccgaa tcccaaaacc agcaggacag gaacgagaag 1980
gacctgttgg agctggacaa atgggcctcc ctgtggaact aa 2022
<210>11
<211>733
<212>PRT
<213>Human immunodeficiency virus
<400>11
Met Arg Val Lys Glu Thr Gln Met Asn Trp Pro Asn Leu Trp Lys Trp
1 5 10 15
Gly Thr Leu Ile Leu Gly Leu Val Ile Ile Cys Ser Ala Ser Asp Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Asp Ala Asp
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala His Glu Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Ile His Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Arg
85 90 95
Asn Asn Met Val Glu Gln Met Gln Glu Asp Val Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Ala Asn Trp Thr Asn Ser Asn Asn Thr Thr Asn Gly
130 135 140
Pro Asn Lys Ile Gly Asn Ile Thr Asp Glu Val Lys Asn Cys Thr Phe
145 150 155160
Asn Met Thr Thr Glu Leu Lys Asp Lys Lys Gln Lys Val His Ala Leu
165 170 175
Phe Tyr Lys Leu Asp Ile Val Gln Ile Asn Ser Ser Glu Tyr Arg Leu
180 185 190
Ile Asn Cys Asn Thr Ser Val Ile Lys Gln Ala Cys Pro Lys Ile Ser
195 200 205
Phe Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile
210 215 220
Leu Lys Cys Asn Asp Lys Asn Phe Asn Gly Thr Gly Pro Cys Lys Asn
225 230 235 240
Val Ser Ser Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr
245 250 255
Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg
260 265 270
Ser Glu Asn Leu Thr Asn Asn Ala Lys Thr Ile Ile Val His Leu Asn
275 280 285
Lys Ser Val Glu Ile Asn Cys Thr Arg Pro Ser Asn Asn Thr Arg Thr
290 295 300
Ser Ile Thr Met Gly Pro Gly Gln Val Phe Tyr Arg Thr Gly Asp Ile
305 310 315 320
Ile Gly Asp Ile Arg Lys Ala Tyr Cys Glu Ile Asn Gly Ile Lys Trp
325 330 335
Asn Glu Val Leu Val Gln Val Thr Gly Lys Leu Lys Glu His Phe Asn
340 345 350
Lys Thr Ile Ile Phe Gln Pro Pro Ser Gly Gly Asp Leu Glu Ile Ile
355 360 365
Thr His His Phe Ser Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Thr
370 375 380
Lys Leu Phe Asn Asn Thr Cys Ile Gly Asn Thr Ser Met Glu Gly Cys
385 390 395 400
Asn Asn Thr Ile Ile Leu Pro Cys Lys Ile Lys Gln Ile Ile Asn Met
405 410 415
Trp Gln Gly Val Gly Gln Ala Met Tyr Ala Pro Pro Ile Ser Gly Arg
420 425 430
Ile Asn Cys Val Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly
435 440 445
Gly Ala Asp Asn Asn Thr Thr Asn Glu Thr Phe Arg Pro Gly Gly Gly
450 455 460
Asn Ile Lys Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val
465 470 475 480
Glu Ile Glu Pro Leu Gly Ile Ala Pro Thr Arg Ala Lys Arg Arg Val
485 490 495
Val Glu Ser Arg Glu Pro Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro
500 505 510
Cys Lys Cys Pro Ala Pro Asn Leu Leu Gly Gly Pro Ser Val Phe Ile
515 520 525
Phe Pro Pro Lys Ile Lys Asp Val Leu Met Ile Ser Leu Ser Pro Ile
530 535 540
Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro Asp Val Gln
545 550 555 560
Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala Gln Thr Gln
565 570 575
Thr His Arg Glu Asp Tyr Asn Ser Thr Leu Arg Val Val Ser Ala Leu
580 585 590
Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe Lys Cys Lys
595 600 605
Val Asn Asn Lys Asp Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys
610 615 620
Pro Lys Gly Ser Val Arg Ala Pro Gln Val Tyr Val Leu Pro Pro Pro
625 630 635 640
Glu Glu Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cys Met Val Thr
645 650 655
Asp Phe Met Pro Glu Asp Ile Tyr Val Glu Trp Thr Asn Asn Gly Lys
660 665 670
Thr Glu Leu Asn Tyr Lys Asn Thr Glu Pro Val Leu Asp Ser Asp Gly
675 680 685
Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val Glu Lys Lys Asn Trp Val
690 695 700
Glu Arg Asn Ser Tyr Ser Cys Ser Val Val His Glu Gly Leu His Asn
705 710 715 720
His His Thr Thr Lys Ser Phe Ser Arg Thr Pro Gly Lys
725 730
<210>12
<211>2202
<212>DNA
<213>Human immunodeficiency virus
<400>12
atgcgggtga aggaaacgca gatgaactgg ccaaacctgt ggaaatgggg gaccctgatt 60
ctcggcctgg tcattatatg cagcgcctcc gacaacctgt gggtgaccgt ctactatggc 120
gtgcccgtct ggcgcgacgc ggacaccacg ctgttttgtg ccagcgacgc caaggcccat 180
gagaccgagg tccataacgt gtgggccacc cacgcctgcg tgcccaccga ccctaacccc 240
caggagattc atctcgaaaa cgtgaccgag aacttcaata tgtggcgcaa caatatggtg 300
gagcagatgc aggaggatgt gatcagcctg tgggaccagt ctctgaagcc ctgtgtgaag 360
ctgacccctc tgtgcgtgac gctcaactgc actaacgcca actggacaaa ttccaataac 420
accacgaacg gccccaacaa gattggcaac attacggatg aggtgaagaa ctgtaccttc 480
aacatgacca ctgaactgaa ggacaagaaa cagaaggtcc acgccctgtt ctataagctc 540
gacattgtgc agattaactc tagcgagtat aggctgatta actgcaacac cagcgtgatt 600
aagcaagcct gtcccaagat ttcgttcgat cccatcccga ttcactactg cacccccgcc 660
ggctacgcca ttctcaagtg caacgacaag aatttcaacg gcaccggccc ctgcaagaac 720
gtctctagtg tacaatgcac ccacgggatt aaacccgtgg tcagcacaca actcctgctc 780
aacggcagcc tggcagagga agagattatc attaggagcg agaatctgac caacaatgcg 840
aagacaataa ttgtgcactt aaacaagtcc gtggagatta actgtacccg ccccagcaac 900
aatacacgca cctcgattac catgggaccg ggccaggtgt tctatagaac cggggatatt 960
atcggtgaca tccgcaaagc ctactgcgag attaacggga ttaagtggaa tgaagtgctc 1020
gtccaggtca cagggaaact caaggagcac ttcaataaga ccattatctt tcaaccccca 1080
agcggcggtg acctggagat cataacccac catttcagtt gccggggcga gttcttttac 1140
tgcaacacta ccaagctctt taacaatacc tgtattggca acaccagcat ggagggctgt 1200
aacaatacca ttatcctgcc gtgcaaaatt aagcagatta tcaacatgtg gcagggcgtg 1260
ggccaggcca tgtacgcccc cccgattagc ggccgcatta actgtgttag caatattacc 1320
ggcattctgc tcacacggga tgggggcgcc gacaacaata ccactaacga gaccttccgc 1380
ccagggggcg ggaacattaa ggacaactgg aggagcgagc tgtacaaata caaggtcgtg 1440
gagattgaac cactgggcat tgcccccaca cgggccaagc gccgggtcgt ggagtctaga 1500
gagcccagag ggcccacaat caagccctgt cctccatgca aatgcccagc acctaacctc 1560
ttgggtggac catccgtctt catcttccct ccaaagatca aggatgtact catgatctcc 1620
ctgagcccca tagtcacatg tgtggtggtg gatgtgagcg aggatgaccc agatgtccag 1680
atcagctggt ttgtgaacaa cgtggaagta cacacagctc agacacaaac ccatagagag 1740
gattacaaca gtactctccg ggtggtcagt gccctcccca tccagcacca ggactggatg 1800
agtggcaagg agttcaaatg caaggtcaac aacaaagacc tcccagcgcc catcgagaga 1860
accatctcaa aacccaaagg gtcagtaaga gctccacagg tatatgtctt gcctccacca 1920
gaagaagaga tgactaagaa acaggtcact ctgacctgca tggtcacaga cttcatgcct 1980
gaagacattt acgtggagtg gaccaacaac gggaaaacag agctaaacta caagaacact 2040
gaaccagtcc tggactctga tggttcttac ttcatgtaca gcaagctgag agtggaaaag 2100
aagaactggg tggaaagaaa tagctactcc tgttcagtgg tccacgaggg tctgcacaat 2160
caccacacga ctaagagctt ctcccggact ccgggtaaat ga 2202
<210>13
<211>863
<212>PRT
<213>Human immunodeficiency virus
<400>13
Met Arg Val Lys Glu Thr Gln Met Asn Trp Pro Asn Leu Trp Lys Trp
1 5 1015
Gly Thr Leu Ile Leu Gly Leu Val Ile Ile Cys Ser Ala Ser Asp Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Asp Ala Asp
35 40 45
Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala His Glu Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Ile His Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Arg
85 90 95
Asn Asn Met Val Glu Gln Met Gln Glu Asp Val Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Asn Cys Thr Asn Ala Asn Trp Thr Asn Ser Asn Asn Thr Thr Asn Gly
130 135 140
Pro Asn Lys Ile Gly Asn Ile Thr Asp Glu Val Lys Asn Cys Thr Phe
145 150 155 160
Asn Met Thr Thr Glu Leu Lys Asp Lys Lys Gln Lys Val His Ala Leu
165 170 175
Phe Tyr Lys Leu Asp Ile Val Gln Ile Asn Ser Ser Glu Tyr Arg Leu
180 185 190
Ile Asn Cys Asn Thr Ser Val Ile Lys Gln Ala Cys Pro Lys Ile Ser
195 200 205
Phe Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile
210 215 220
Leu Lys Cys Asn Asp Lys Asn Phe Asn Gly Thr Gly Pro Cys Lys Asn
225 230 235 240
Val Ser Ser Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr
245 250 255
Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg
260 265 270
Ser Glu Asn Leu Thr Asn Asn Ala Lys Thr Ile Ile Val His Leu Asn
275 280 285
Lys Ser Val Glu Ile Asn Cys Thr Arg Pro Ser Asn Asn Thr Arg Thr
290 295 300
Ser Ile Thr Met Gly Pro Gly Gln Val Phe Tyr Arg Thr Gly Asp Ile
305 310 315 320
Ile Gly Asp Ile Arg Lys Ala Tyr Cys Glu Ile Asn Gly Ile Lys Trp
325 330 335
Asn Glu Val Leu Val Gln Val Thr Gly Lys Leu Lys Glu His Phe Asn
340 345 350
Lys Thr Ile Ile Phe Gln Pro Pro Ser Gly Gly Asp Leu Glu Ile Ile
355 360 365
Thr His His Phe Ser Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Thr
370 375 380
Lys Leu Phe Asn Asn Thr Cys Ile Gly Asn Thr Ser Met Glu Gly Cys
385 390 395 400
Asn Asn Thr Ile Ile Leu Pro Cys Lys Ile Lys Gln Ile Ile Asn Met
405 410 415
Trp Gln Gly Val Gly Gln Ala Met Tyr Ala Pro Pro Ile Ser Gly Arg
420 425 430
Ile Asn Cys Val Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly
435 440 445
Gly Ala Asp Asn Asn Thr Thr Asn Glu Thr Phe Arg Pro Gly Gly Gly
450 455 460
Asn Ile Lys Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val
465 470 475 480
Glu Ile Glu Pro Leu Gly Ile Ala Pro Thr Arg Cys Lys Arg Arg Val
485 490 495
Val Glu Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
500 505 510
Gly Ala Val Gly Ile Gly Ala Met Ile Phe Gly Phe Leu Gly Ala Ala
515 520 525
Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr Val Gln Ala Arg
530 535 540
Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser Asn Leu Leu Arg Ala
545 550 555 560
Pro Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp Gly Ile Lys
565 570 575
Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg Tyr Leu Lys Asp Gln
580 585 590
Lys Phe Leu Gly Leu Trp Gly Cys Ser Gly Lys Ile Ile Cys Cys Thr
595 600 605
Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys Ser Phe Glu Glu Ile
610 615 620
Trp Asp Asn Met Thr Trp Ile Glu Trp Glu Arg Glu Ile Ser Asn Tyr
625 630 635 640
Thr Ser Gln Ile Tyr Glu Ile Leu Thr Glu Ser Gln Asn Gln Gln Asp
645 650 655
Arg Asn Glu Lys Asp Leu Leu Glu Leu Asp Lys Trp Ala Ser Leu Trp
660 665 670
Asn Ala Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
675 680 685
Gly Ser Leu Ser Glu Arg Met Leu Lys Ala Leu Asn Asp Gln Leu Asn
690 695 700
Arg Glu Leu Tyr Ser Ala Tyr Leu Tyr Phe Ala Met Ala Ala Tyr Phe
705 710 715 720
Glu Asp Leu Gly Leu Glu Gly Phe Ala Asn Trp Met Lys Ala Gln Ala
725 730 735
Glu Glu Glu Ile Gly His Ala Leu Arg Phe Tyr Asn Tyr Ile Tyr Asp
740 745 750
Arg Asn Gly Arg Val Glu Leu Asp Glu Ile Pro Lys Pro Pro Lys Glu
755 760 765
Trp Glu Ser Pro Leu Lys Ala Phe Glu Ala Ala Tyr Glu His Glu Lys
770 775 780
Phe Ile Ser Lys Ser Ile Tyr Glu Leu Ala Ala Leu Ala Glu Glu Glu
785 790 795 800
Lys Asp Tyr Ser Thr Arg Ala Phe Leu Glu Trp Phe Ile Asn Glu Gln
805 810 815
Val Glu Glu Glu Ala Ser Val Lys Lys Ile Leu Asp Lys Leu Lys Phe
820 825 830
Ala Lys Asp Ser Pro Gln Ile Leu Phe Met Leu Asp Lys Glu Leu Ser
835 840 845
Ala Arg Ala Pro Lys Leu Pro Gly Leu Leu Met Gln Gly Gly Glu
850 855 860
<210>14
<211>2592
<212>DNA
<213>Human immunodeficiency virus
<400>14
atgcgcgtga aggagaccca gatgaactgg ccaaacctct ggaagtgggg cacactgatc 60
ctcggactgg tgatcatttg ctccgcatcc gacaacctct gggtgaccgt gtactacggg 120
gtgccagtgt ggagggacgc cgacaccaca ctcttctgcg cgtctgacgc taaggctcac 180
gagacagagg tgcacaacgt gtgggctacc cacgcttgcg tgcctaccga cccaaaccct 240
caggagattc acctggagaa cgtgacagag aacttcaaca tgtggcgcaa caacatggtg 300
gagcagatgc aggaggacgt gatctccctg tgggaccagt ctctcaagcc ttgcgtgaag 360
ctgaccccac tgtgcgtgac actgaactgc acaaacgcta actggaccaa ctctaacaac 420
accacaaacg ggcctaacaa gatcggaaac attaccgacg aggtgaagaa ctgcaccttc 480
aacatgacca cagagctgaa ggacaagaag cagaaggtgc acgccctgtt ctacaagctc 540
gacattgtgc agattaactc ttccgagtac agactcatta actgcaacac ctctgtgatc 600
aagcaggctt gcccaaagat ttctttcgac cctatcccaa ttcactactg cacccccgcc 660
ggatacgcta ttctcaagtg caacgacaag aacttcaacg gaaccgggcc ttgcaagaac 720
gtgtctagcg tgcagtgcac ccacggcatt aagcccgtgg tgtctaccca gctgctcctg 780
aacggcagcc tcgctgagga ggagatcatt attcggtccg agaacctcac aaacaacgct 840
aagacaatta ttgtgcacct gaacaagtcc gtggagatta actgcacccg cccatctaac 900
aacacacgca catctattac catgggcccc gggcaggtgt tctaccgcac aggggacatc 960
atcggcgaca ttagaaaggc ttactgcgag attaacggaa ttaagtggaa cgaggtgctg 1020
gtgcaggtga ccggaaagct caaggagcac ttcaacaaga ccatcatttt ccagcctcca 1080
tccggcggcg acttggaaat catcacccac cacttctctt gccgcggaga gttcttctac 1140
tgcaacacca caaagctgtt caacaacaca tgcatcggaa acacatctat ggagggatgc 1200
aacaacacca ttatcctgcc ttgcaagatc aagcagatta tcaacatgtg gcagggagtg 1260
ggccaggcta tgtacgcccc tccaatttcc ggacgcatta actgcgtgtc caacatcacc 1320
ggaatcctgc tgacccgcga cggcggcgcc gacaacaaca ccacaaacga gaccttcaga 1380
cccggcgggg gaaacattaa ggacaactgg cggtctgagc tgtacaagta caaggtggtg 1440
gagattgagc cactcggaat cgcccctacc cggtgcaagc gcagagtggt ggagggaggg 1500
tctggcgggg gcgggtccgg cggcggcgga tctggcgggg ccgtgggaat cggcgctatg 1560
attttcgggt tcctcggggc tgccgggtcc accatgggcg ccgcttccat cacactcaca 1620
gtgcaggccc gccagctcct gtctggcatt gtgcagcagc agtctaacct gctgcgcgcc 1680
cctgaggctc agcagcacct gctccagctc acagtgtggg gaattaagca gctccaggct 1740
agagtgctcg ccgtggagcg gtacctgaag gaccagaagt tcctgggact ctggggatgc 1800
tccggaaaga ttatttgctg cacagccgtg ccttggaact cttcttggtc caacaagtct 1860
ttcgaggaga tttgggacaa catgacatgg attgagtggg agcgcgagat ctctaactac 1920
accagccaga tttacgagat tctcacagag tctcagaacc agcaggacag aaacgagaag 1980
gacctccttg aactcgacaa gtgggcctct ctgtggaacg ctagcggcgg cgggggttcc 2040
gggggcggcg ggtccggggg cggcggatct ctgtctgagc gcatgctgaa ggccctgaac 2100
gaccagctga accgcgagct gtacagcgct tacctgtact tcgccatggc cgcttacttc 2160
gaggacctcg gactcgaagg gttcgctaac tggatgaagg ctcaggctga ggaggagatt 2220
ggccacgccc tcaggttcta caactacatt tacgaccgca acggacgcgt ggagctggac 2280
gagatcccaa agcctccaaa ggagtgggag tctcccctga aggctttcga ggccgcttac 2340
gagcacgaga agttcatctc taagtctatt tacgagctgg ccgccctcgc cgaggaggag 2400
aaggactact ctacacgcgc tttcctggag tggttcatta acgagcaggt ggaggaggag 2460
gcctccgtga agaagattct cgacaagctc aagttcgcta aggactcccc tcagattctg 2520
ttcatgctcg acaaggagct gtccgctaga gcccctaagc tccccggact cctgatgcag 2580
ggcggcgagt ga 2592

Claims (16)

1. An immunological combination for inducing broadly neutralizing antibodies against HIV-1, wherein the second needle of said immunological combination employs a viral vector vaccine expressing HIV-1 membrane proteins, said viral vector vaccine being selected from the group consisting of poxvirus, adenovirus, herpes simplex virus, measles virus, reovirus and rhabdovirus, thereby significantly increasing the titer and broad spectrum of antibodies for inducing broadly neutralizing antibodies against HIV-1.
2. The immunological combination for inducing broad-spectrum neutralizing antibodies against HIV-1 according to claim 1, wherein said poxvirus vector is selected from the group consisting of a Techthy strain, a North American vaccine strain, a Whitman derived strain, a Listeria strain, an Ankara derived strain, a Copenhagen strain and a New York strain.
3. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to claim 1 wherein the third needle is an HIV-1 membrane protein vaccine in a form selected from the group consisting of recombinant protein subunit vaccine, virus-like particle vaccine, nanoparticle vaccine.
4. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to claim 1 wherein the third needle is an HIV-1 membrane protein viral vector vaccine selected from the group consisting of poxvirus, adenovirus, herpes simplex virus, measles virus, reovirus and rhabdovirus.
5. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to claim 1 or 3 wherein the fourth needle is an HIV-1 membrane protein viral vector vaccine selected from the group consisting of poxvirus, adenovirus, herpes simplex virus, measles virus, reovirus and rhabdovirus.
6. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to claim 1 or 4 wherein the fourth needle is an HIV-1 membrane protein vaccine in a form selected from the group consisting of recombinant protein subunit vaccine, virus-like particle vaccine, nanoparticle vaccine.
7. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any of claims 1, 3-6 wherein the first needle immunization is in a form of a vaccine selected from the group consisting of recombinant plasmid vaccine, recombinant protein subunit vaccine, recombinant viral vector vaccine, virus-like particle vaccine, nanoparticle vaccine, live attenuated vaccine and inactivated virus vaccine.
8. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any of claims 1 and 3 to 7 wherein the source of HIV-1 membrane protein immunogen expressed by the vaccination comprises a member selected from the group consisting of HIV-1A, B, C, D, F, G, H, J, K subtype and recombinant forms formed between different types selected from the group consisting of CRF01-AE, CRF07-BC, CRF08-BC, AG recombinant forms.
9. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any of claims 1, 3-8 wherein the source of HIV-1 membrane protein is selected from the group consisting of AE2F, R L42, CN54 strain.
10. The immune combination for inducing broadly neutralizing antibodies against HIV-1 according to any one of claims 1, 3-9, wherein the immunogenic form of HIV-1 membrane protein is selected from the group consisting of gp120, gp140, gp145, sosip.664, UFO, gp120-Fc, sosip.664-ferritin, UFO-ferritin, gp120-p24-Fc, sosip.664-p 24-Fc.
11. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any one of claims 1 to 10 wherein the vaccination modality is selected from the group consisting of intramuscular vaccination, intradermal vaccination, subcutaneous vaccination, nasal drops, aerosol inhalation, genital tract, rectal and oral administration.
12. An immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any of claims 1-10 wherein an adjuvant is used during immunization, said adjuvant being selected from the group consisting of aluminum adjuvant, cholera toxin and its subunits, oligodeoxynucleotides, manganese ion adjuvant, freund's adjuvant, MF59 adjuvant and QS-21 adjuvant.
13. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to claim 1 wherein said vaccination is intramuscular with a first needle of DNA-AE2F-gp145, a second needle of recombinant Tetris poxvirus-AE 2F-gp145, a third needle of protein-AE 2F-SOSIP.664-fertilin + aluminum adjuvant, and a fourth needle of recombinant Tetris poxvirus-R L42-gp 145.
14. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to claim 1 wherein said vaccination is intramuscular, a first needle of DNA-AE2F-gp145, a second needle of recombinant Tiantan strain poxvirus-AE 2F-gp145, a third needle of recombinant Tiantan strain poxvirus-R L42-gp 145, a fourth needle of protein-AE2F-SOSIP 664-ferritin + aluminum adjuvant, and said immunization interval is 2 weeks and more.
15. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any one of claims 1 to 14 wherein the immunization interval is selected from the group consisting of 2 weeks, 4 weeks and 6 weeks.
16. The immunological combination for inducing broadly neutralizing antibodies against HIV-1 according to any one of claims 1 to 15 wherein the recombinant plasmid vaccine is administered at an immunizing dose of 10 to 200 μ g/mouse and 1 to 6 mg/mouse in rhesus monkey and the recombinant poxvirus vector vaccine is administered at an immunizing dose of 1 × 10 mouse6-5×107pfu/mouse, 5 × 10 in rhesus monkey7-1×109pfu/mouse, the immune dose of the nano-particle vaccine is 1-50 mug/mouse, 10-500 mug/mouse in rhesus monkey, and the immune dose of the recombinant adenovirus vector vaccine is 1 × 10 in mouse10-5×1011vps/only.
CN202010168531.7A 2020-03-11 2020-03-11 Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1 Pending CN111494623A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202010168531.7A CN111494623A (en) 2020-03-11 2020-03-11 Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1
PCT/CN2020/081015 WO2021179351A1 (en) 2020-03-11 2020-03-25 Immune combination for inducing broad-spectrum neutralizing antibody against hiv-1

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010168531.7A CN111494623A (en) 2020-03-11 2020-03-11 Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1

Publications (1)

Publication Number Publication Date
CN111494623A true CN111494623A (en) 2020-08-07

Family

ID=71865774

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010168531.7A Pending CN111494623A (en) 2020-03-11 2020-03-11 Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1

Country Status (2)

Country Link
CN (1) CN111494623A (en)
WO (1) WO2021179351A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021179351A1 (en) * 2020-03-11 2021-09-16 上海市公共卫生临床中心 Immune combination for inducing broad-spectrum neutralizing antibody against hiv-1

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101569745A (en) * 2009-05-25 2009-11-04 苏州工业园区唯可达生物科技有限公司 Combination vaccine against various HIVs and combination method thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102258779B (en) * 2011-07-18 2013-07-24 曾毅 Sequential and repeated application of four or more HIV (human immunodeficiency virus) vector gene vaccines
US11883485B2 (en) * 2018-08-29 2024-01-30 Fred Hutchinson Cancer Center Methods of eliciting antibodies that bind to full-length glycosylated HIV-1 Env using multimerized Env cores
CN111494623A (en) * 2020-03-11 2020-08-07 上海市公共卫生临床中心 Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101569745A (en) * 2009-05-25 2009-11-04 苏州工业园区唯可达生物科技有限公司 Combination vaccine against various HIVs and combination method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DING.X等: "Sequential vaccination with heterologous HIV env immunogens in different vaccine forms elicits broad cross-reactive neutralization antibody responses", vol. 49, no. 3, pages 1683 *
李哲等: "<HIV 广谱中和抗体研究进展>", 《中国比较医学杂志》, vol. 31, no. 10, 28 September 2021 (2021-09-28), pages 107 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021179351A1 (en) * 2020-03-11 2021-09-16 上海市公共卫生临床中心 Immune combination for inducing broad-spectrum neutralizing antibody against hiv-1

Also Published As

Publication number Publication date
WO2021179351A1 (en) 2021-09-16

Similar Documents

Publication Publication Date Title
Hanke et al. Enhancement of MHC class I-restricted peptide-specific T cell induction by a DNA prime/MVA boost vaccination regime
Doria-Rose et al. Human immunodeficiency virus type 1 subtype B ancestral envelope protein is functional and elicits neutralizing antibodies in rabbits similar to those elicited by a circulating subtype B envelope
Hammond et al. Comparative clonal analysis of human immunodeficiency virus type 1 (HIV-1)-specific CD4+ and CD8+ cytolytic T lymphocytes isolated from seronegative humans immunized with candidate HIV-1 vaccines.
US7993651B2 (en) Chimeric human immunodeficiency virus (HIV) immunogens comprising GAG P24-P17 fused to multiple cytotoxic T lymphocyte (CTL) epitopes
US7323557B2 (en) Genome of the HIV-1 inter-subtype (C/B&#39;) and use thereof
Pastori et al. Virus like particle based strategy to elicit HIV-protective antibodies to the alpha-helic regions of gp41
JP2001512308A (en) Synthetic HIV GAG gene
del Moral-Sánchez et al. Strategies for inducing effective neutralizing antibody responses against HIV-1
Heilman et al. HIV vaccines—where are we going?
JP2000517290A (en) Methods and compositions for protective and therapeutic gene immunization
CN113151184A (en) Method for cell membrane-based display of coronavirus immunogens to induce neutralizing antibodies
Chhatbar et al. HIV vaccine: hopes and hurdles
Chen Monkey models and HIV vaccine research
JP2004518443A (en) Recombinant poxvirus for chimeric proteins of human immunodeficiency virus
Stratov et al. Vaccines and vaccine strategies against HIV
CN111494623A (en) Immune combination for inducing broad-spectrum neutralizing antibody aiming at HIV-1
Radaelli et al. Prime-boost immunization with DNA, recombinant fowlpox virus and VLPSHIV elicit both neutralizing antibodies and IFNγ-producing T cells against the HIV-envelope protein in mice that control env-bearing tumour cells
Gao et al. Centralized HIV-1 envelope immunogens and neutralizing antibodies
CA2538840C (en) Dna vaccine compositions and methods of use
WO2013026452A1 (en) Method for removing immunosuppresive properties of hiv envelope glycoproteins
WO2008118470A2 (en) Acute transmitted hiv envelope signatures
WO2013040766A1 (en) Method and vaccine capable of inducing broad spectrum immune response against hiv
Mayr et al. Antibodies targeting the envelope of HIV‐1
US20100034851A1 (en) AIDS Vaccine Based on Replicative Vaccinia Virus Vector
EP2740488A1 (en) Sequential and repeated application of four or more hiv vector gene vaccines

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination