CN111494608A - Medicine for preventing or treating preeclampsia and related diseases and application thereof - Google Patents

Abstract

The invention relates to a medicine for preventing or treating preeclampsia and related diseases and application thereof, and creatively proves that Diannexin can prevent or treat preeclampsia and related diseases. The medicine of the invention can inhibit the whole body inflammatory reaction of the mother body, reduce the blood pressure, and can not cause the potential bleeding risk of the mother body and the fetus; has important value and application prospect for improving the capability and safety of clinically preventing or treating preeclampsia.

Description

Medicine for preventing or treating preeclampsia and related diseases and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a medicine for preventing or treating preeclampsia and related diseases and application thereof, in particular to application of a recombinant protein Diannexin in preparation of a medicine for preventing or treating preeclampsia and related diseases.

Background

Preeclampsia (PE) is characterized by new onset hypertension (greater than or equal to 140/90mmHg) and proteinuria (urinary protein greater than or equal to 0.3g/24h) after 20 weeks of gestation, with an incidence of 2% -8% in pregnancy. PE can rapidly progress to multiple organ failure of eclampsia, to which about 12% of maternal and 15% of neonatal deaths are associated; however, once PE progresses, no other effective treatment measures are available except for termination of pregnancy, so that the prevention of PE occurrence in clinic has more important value.

The pathogenesis of PE involves placental ischemia-reperfusion injury caused by failure of uterine spiral artery recasting, and the resulting state of maternal systemic thrombo-inflammatory response (thrombobiform response); therefore, drugs having inflammation-inhibiting and antithrombotic effects have been attempted for the prevention and treatment of PE.

Although the etiology and pathogenesis of PE is not well understood at present, its pathophysiological processes are generally considered to be divided into two phases. The first stage is as follows: under the action of various factors, the invasion of trophoblasts is insufficient, the recasting of uterine spiral artery is obstructed, and the placenta is oxidized and the endoplasmic reticulum is stressed due to insufficient blood supply and oxygen deficiency and irregular reperfusion events; in the second stage, oxidative stress and other injuries cause apoptosis and necrosis of syncytium structures, inflammatory factors, anti-angiogenic factors, procoagulant microparticles and the like are released from villus gaps to enter maternal blood circulation, and the inflammatory response of maternal thrombus (including leukocyte activation, endothelial cell dysfunction, platelet activation, excessive thrombin generation and the like) is induced. Compared with normal pregnancy, excessive inflammatory reaction and hemostasis system disorder further affect multiple organs, and clinical manifestations of multiple organ dysfunction such as hypertension, heart failure, renal insufficiency, acute liver injury and the like and fetal intrauterine growth limitation occur.

Annexin A5 is an Annexin that binds to Phosphatidylserine (PS) exposed on the surface of endothelial cells, trophoblasts and platelet membranes to form a two-dimensional lattice barrier structure that prevents prothrombin complexes from forming on the cell surface, exerts barrier anticoagulant protection, and also exerts inflammation inhibitory effects, whereas Annexin A5 homodimer, synthesized by recombinant DNA techniques, has a higher affinity to PS (about 10 times that of Annexin A5) and a longer half-life (de L a B, Wu XX, van L ummel M, Derksen RHON, de Groot PG, Rand JH. Correa antibiotic nanoparticles that protect against pathological diffusion of a 2-glucoprotein I, which is used for the control of inflammation after transplantation of organ 1499. A151. Biodiffusion, Biodiffusion kinase I, and reperfusion injury, Biodiffusion of tissue I, tissue graft II K-graft II, IgG, tissue K-IV, IgG.

At present, drugs (such as hormones, aspirin and the like) for inhibiting the inflammatory reaction of thrombus mostly have the risks of teratogenesis, increase of bleeding of puerperae and fetus and the like, and are limited in the application process. Thus, there is still a pressing need for more effective preventive or intervention measures for PE at present.

Disclosure of Invention

Therefore, the present invention aims to provide a drug capable of preventing or treating preeclampsia and related conditions thereof. In order to realize the purpose of the invention, the following technical scheme is adopted:

the invention relates to a medicament for preventing or treating preeclampsia and related diseases thereof, which is characterized in that the active ingredient of the medicament comprises Diannexin, wherein the Diannexin refers to Annexin A5 homodimer.

In a preferred embodiment of the present invention, the Diannexin has an amino acid sequence as shown in SEQ ID No.1 or an amino acid sequence encoded by a nucleotide sequence as shown in SEQ ID No. 2.

In a preferred embodiment of the present invention, the drug is an injectable formulation or an oral formulation; preferably an injectable formulation.

The invention also relates to application of Diannexin in preparing a medicament for preventing or treating preeclampsia.

In another aspect, the invention also relates to the use of Diannexin in the preparation of a medicament for improving placental development and/or fetal development in a pre-eclamptic pregnant woman or a pre-eclamptic-like phenotypic pregnant mouse.

In another aspect, the invention also relates to the use of Diannexin in the preparation of a medicament for reducing blood pressure in a pregnant woman with preeclampsia or a pregnant mouse with a preeclampsia-like phenotype.

In another aspect, the invention also relates to the use of Diannexin in the preparation of a medicament for reducing soluble fms-like tyrosine kinase 1 in a pregnant woman with preeclampsia or a pregnant mouse with a preeclampsia-like phenotype.

In another aspect, the invention relates to the use of Diannexin in the preparation of a medicament for reducing the release of Microparticles (MPs) from a pregnant woman with pre-eclampsia or a pregnant mouse with a pre-eclampsia-like phenotype.

In another aspect, the invention also relates to the use of Diannexin in the preparation of a medicament for reducing the level of inflammation in a pre-eclamptic pregnant woman or a pre-eclamptic-like phenotypic pregnant mouse.

Advantageous effects

The invention creatively proves that Diannexin can prevent or treat preeclampsia and related diseases thereof, the medicine of the invention can inhibit the whole body inflammatory reaction of the mother and reduce the blood pressure, and can not cause the potential bleeding risk of the mother and the fetus; has important value and application prospect for improving the capability and safety of clinically preventing or treating preeclampsia.

Drawings

FIG. 1 is a flow diagram of microparticle extraction;

FIG. 2 animal model and treatment;

FIG. 3 blood pressure, urinary protein/creatinine and sFlt-1 levels differences in three groups of pregnant mice: (a) the blood pressure of pregnant mice in the PE model group is obviously increased, and the blood pressure of pregnant mice is obviously reduced after Diannexin is dried; (b) the ratio of the urine protein to the creatinine of the pregnant mouse in the PE model group is obviously increased, and after Diannexin dry prediction, the ratio of the urine protein to the creatinine is reduced, but the difference has no statistical significance; (c) the level of sFlt-1 in pregnant mice in the PE model group was significantly increased, and the level of sFlt-1 was significantly decreased after Diannexin intervention. SBP: systolic arterial pressure, MBP: mean arterial pressure, DBP: diastolic arterial pressure, P/C: urinary protein/creatinine, sFlt-1: soluble fms-like tyrosine kinase 1. P <0.05, P <0.01 for the PE model group compared to the control group; # is Diannexin intervention group, # P <0.05 compared to PE model group.

Figure 4 anatomical diagrams of placenta and fetal mice: the loss of fetal mice in the PE model group is increased (black arrows), the survival rate of the fetal mice is reduced, developmental disorder appears in part of the fetal mice (white arrows), and after Diannexin intervention treatment, the fetal mice are lost, and the placenta development does not appear obvious abnormal.

FIG. 5 three groups of fetal mouse survival, fetal mouse and placental development differences: (a) the survival rate of the fetal rat of the PE model group is obviously reduced, after Diannexin intervention treatment, the survival rate of the fetal rat is increased, but the difference has no statistical significance; (b) the long diameter of the fetal rat in the PE model group is obviously reduced, and after Diannexin intervention treatment, the long diameter of the fetal rat is obviously increased; (c) the diameter of the placenta of the PE model group is obviously reduced, and the diameter of the placenta is obviously increased after Diannexin intervention treatment. P <0.05, P <0.01 for the PE model group compared to the control group; # is Diannexin intervention group, # P <0.05 compared to PE model group.

FIG. 6 anatomical map of fetal mouse development: the growth of the fetal rat in the PE model group is hindered, the outline of the anterior foot plate is smooth, and the retinal pigment is light (indicated by black solid triangles), while after the Diannexin stem group, the growth condition of the fetal rat is the same as that of the control group, the outline of the anterior foot plate has fluctuation corresponding to the fingers, and the retinal pigment is more (indicated by white solid triangles).

Figure 7 flow cytometry detects microparticle levels in three groups of pregnant mice: compared with a control group, the number of the particles in the PE model group is obviously increased, and the number of the particles is obviously reduced after the Diannexin is dried. P <0.01 for the PE model group compared to the control group; # Diannexin group vs. PE model group, # P < 0.01.

Figure 8RT-PCR detects mRNA levels of N L RP3, Caspase1 and I L-1 β in the placentas of three groups of pregnant mice-mRNA levels of N L RP3, Caspase1 and I L-1 β were significantly increased compared to the control group, and mRNA levels of N L RP3, Caspase1 and I L-1 β were significantly decreased for the Diannexin dry prognosis, the results were the mean of three replicates, and Ct values were the number of cycles for the amount of amplification product reaching a critical threshold, Δ Ct (target protein) -Ct (β -actin), Δ Δ Ct (PE model group/Diannexin) - Δ Ct (control group), P <0.05, # P <0.01, P < 0.05.

FIG. 9Western blot analysis of protein levels of N L RP3, Caspase1 and I L-1L in three groups of pregnant mouse placentas (a) Western blot analysis of protein levels of N L RP3, Caspase1 and I L1-1L in three groups of pregnant mouse placentas (L-actin as an internal reference protein), N L RP L, cleared-Caspase 1 and cleared-I L4-1L in the PE model group were significantly higher than those in the control group, N L RP L, cleared-Caspase 1 and cleared-I L-1L in the Diannexin pretreatment group were significantly lower than those in the PE model group (N L1 RP L, PAS 1 and I L-1L) than those in the PE model group (the quantified protein ratio of Caspase 1: PAS to the PE 72 of the PE 72, the PAS 1: PAS 72, the activity of the DIannexin precursor of the DIPAS L: DA 1-L (no cleavage of the P L: the P L) in the DIannexin pretreatment group, the activity of the DIPAS 0: PAS 1-L in the PE model group (no cleavage of the P L: the P0: L) and no cleavage of the precursor of the P72 of the PE 1-L (no cleavage of the P72) in the PE model group).

FIG. 10 expression levels and locations of N L RP3 and total Caspase1 in three placental tissues (a) immunohistochemistry for N L RP3 levels in placenta, N L RP3 mainly located in feeder cells of giant cell trophoblasts, sponge trophoblasts and labyrinthine trophoblasts, with the feeder cells of giant cell and sponge trophoblasts being more positive than those of labyrinthine, with the PE model group being significantly more positive than the control group, and with the Diannexin stem pre-group being significantly less positive than the PE model group (b) immunohistochemistry for total Caspase1 levels in placenta, 200 × amplification, (c-d) quantitative analysis of J, with P <0.05 in the PE model group compared to the control group, and # Diannexin stem pre-group compared to the PE model group, # P <0.05 in DA: Diannexin, TGC: TC: L feeder cells of giant cell, Spongytubm 35ab in placenta.

Figure 11E L ISA tested the expression levels of I L-1 β in three placental tissues, I L-1 β levels were significantly increased in placental tissues from the PE model group compared to the control group, I L-1 β levels were significantly decreased in placental tissues from the Diannexin intervention group compared to the PE model group, # P <0.05 in the PE model group compared to the control group, and # P <0.05 in the Diannexin intervention group compared to the PE model group.

Detailed Description

In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available.

Example 1

1 materials of interest

The mice used in the experiment are C57B L/6, and are purchased from the department of laboratory animal sciences of the department of medicine of Beijing university, the animal quality license is Beijing SCXK 2011-.

1.1 animal urine

After the female and male mice are randomly mated, vaginal pessary detection of the female mice is daily recorded as E0.5, and 0.5ml of random urine is collected before anesthesia sacrifice at 12 days after the occurrence of pessary, namely E12.5, for detecting the levels of urine protein and creatinine.

1.2 animal blood

Serum specimen: and E12.5, anesthetizing, fixing the pregnant mouse, slightly pressing two sides of the neck to enable the eyeball to fully protrude outwards, inserting the blood collection tube into the retroorbital venous sinus of the mouse along the inner canthus, taking 0.4ml of venous blood, standing at room temperature for 2h, centrifuging for 10min at 2000g after blood agglutination, sucking upper serum, and freezing and storing at-80 ℃ for later use.

Plasma specimen: after sampling the retro-orbital venous sinus, the chest was opened, the heart was exposed, the apex punctured with a needle, 0.5ml of blood was aspirated, and the volume of the blood was immediately mixed with a 3.2% sodium citrate solution at 8: 1, repeatedly centrifuging at 2500g for 10min, collecting supernatant as PPP, and freezing at-80 deg.C.

1.3 animal placental tissue and fetal rat

After blood samples were collected, the abdominal cavity was opened, the uterus was removed, and the fetal rat and placenta were isolated. Measuring the diameter of the placenta and the long diameter of a fetal mouse and observing the development condition of the fetal mouse; then, freezing and storing a part of the placenta in a refrigerator at the temperature of-80 ℃ after liquid nitrogen cryopreservation treatment for PCR and Westernblot experiments; one part of the test tube was placed in 10% neutral formaldehyde solution and fixed for immunohistochemical experiments.

2 research methods

2.1 preparation of animal models

2.1.1 instruments

Intelligent non-invasive sphygmomanometer (softron, japan), full-automatic biochemical analyzer AU5800(Beckman Coulter, usa), analytical electronic balance (aohaus, china), vernier caliper (yaowang, china).

2.1.2 reagents

PBS buffer (solibao, china), sterile normal saline (solibao, china), sodium citrate anticoagulant (L eagene, china), chloral hydrate (sahn chemistry, china), lipopolysaccharide L PS (sigma-aldrich, usa).

2.1.3 preparation of solution

(1) 5% chloral hydrate solution: 0.5mg of chloral hydrate granules was weighed out and made up to 10ml with physiological saline.

(2) L PS solution 10mg of L PS lyophilized powder is weighed and 10ml of sterile physiological saline is added to prepare 1mg/ml of L PS solution.

2.1.4 Experimental step (1) extraction of MPs, scheme 1

1) Activating well-growing SVEC4-10 cells, pouring out the culture solution, rinsing with PBS buffer solution for 3 times, adding 1ml of PBS buffer solution into a culture flask, and adding an activator L PS (20 mu g/ml) to stimulate the cells to generate MP;

2) centrifugal extraction: sucking out the supernatant from the culture flask, transferring into sterile EP tube, centrifuging at 4 deg.C and 3300g for 20min, collecting the supernatant, centrifuging at 4 deg.C and 20000g for 60min, discarding the supernatant, and washing with precooled PBS for 2-3 times to obtain extracted MPs;

3) flow cytometry counting: sucking 50 μ l of the extracted MPs, adding 5 μ l of FITC-Annexin V, incubating at room temperature in dark for 30min, and detecting the amount of MPs^[2]；

4) The amount of MPs was adjusted to 250/. mu.l with PBS buffer.

L PS lipopolysaccharide and MPs microparticle

(2) Animal model and treatment, the process is shown in figure 2

1) Randomly mating male and female C57B L/6 mice at a ratio of 2: 1 in 10-12 weeks, and checking the formation of the vaginal embolus in the morning of the next day, wherein the day of the formation of the vaginal embolus is marked as E0.5;

2) female mice with emboli formed were randomly divided into three groups (8-10 per group): control, PE model and Diannexin intervention groups were administered intravenously according to fig. 2: PBS (200. mu.l/time), MPs (200. mu.l/time), Diannexin (500 mg/kg/time);

3) e12.5, random urine of pregnant mice is collected, tail vein blood pressure is detected in a non-invasive mode, and then 5% chloral hydrate (0.1ml/10g) is used for anaesthesia, blood is taken, and tissues are taken.

Note: and (3) MPs: microparticles; DA: diannexin

(3) Evaluation of placental and fetal mouse development

1) Placenta: the placenta was taken out, placed on a clean and flat table, and the diameter of each placenta of the pregnant mice was measured with a vernier caliper, and the average value was calculated as the placenta diameter of the pregnant mice.

2) Fetal rat: taking out the placenta, placing on a clean and flat table, measuring the long diameter (top-hip line) of each fetus of the pregnant mouse by a vernier caliper, and calculating the average value to be used as the long diameter of the pregnant mouse; on the other hand, the development of fetal mice was evaluated according to the evaluation method of Theiler Stages.

(4) Detection of blood pressure and urine protein and creatinine

1) And (3) blood pressure detection: e12.5, fixing the pregnant mouse, detecting the blood pressure of the pregnant mouse for 5-7 times by using an intelligent noninvasive sphygmomanometer after the pregnant mouse is quiet, removing the unqualified detection result (such as unstable wave crest caused by defecation in the detection process), and calculating the average value (blood pressure measurement training for enabling the mouse to adapt to the tail sleeve detection procedure in the one-week mating advancing behavior period).

2) Urine protein and creatinine assay: 500 μ l of the random urine collected was collected and the urine protein and urine creatinine concentrations were measured using an automated biochemical analyzer.

2.2 blood sample detection

2.2.1 plasma MPs number detection

2.2.1.1 instruments

Desktop centrifuges (Thermo, usa), ultra-low temperature refrigerators (SANYO, japan), flow cytometers Canto II (BD corporation, usa).

2.2.1.2 reagents

TruCount absolute count tubes (BD, usa), Megamix beads (Biocytex, france), FITC-Annexin V (BD, usa), Annexin V binding buffer (BD, usa), hirudin (GenScript, usa).

2.2.1.3 reagent preparation

(1)2 × Annexin V binding buffer 10 × Annexin V binding buffer was diluted 5-fold with deionized water and was ready for use.

(2) Preparing a hirudin solution: adding 140 μ l sterilized distilled water into 10 μ g hirudin lyophilized powder, and mixing to obtain 1ATU/μ l hirudin solution. Subpackaging and storing at-20 deg.C for use.

2.2.1.4 Experimental procedures: MPs quantity detection

(1) Sucking 300 mul Megamix beads (a mixture containing three fluorescent microspheres with different diameters, the diameters are 0.5, 0.9 and 3.0 mu m respectively) into a flow tube, oscillating and mixing the mixture by a vortex mixer, and loading the sample in a low-speed mode;

(2) adjusting the threshold value of the lateral angular channel of the instrument to reduce the background noise;

(3) adjusting the voltage of the SSC and the forward angle to complete the gate arrangement;

(4) putting the frozen PPP into a room temperature for re-melting, adding 30 mu l of re-melting PPP and 5 mu l of FITC-Annexin V into a TruCount counter tube, uniformly mixing the mixture in a vortex mixer, and incubating for 30min at room temperature in a dark place;

(5) adding 500 μ l annexin V binding buffer (2 ×) and 1 μ l hirudin (final concentration 2ATU/ml) into each tube, mixing with vortex mixer, and detecting on machine;

(6) in the low speed mode, at least 10000 particles need to be collected, recorded and analyzed, and the result is analyzed.

2.2.2sFlt-1 assay

2.2.2.1 Instrument

Thermo MultiskanAscent microplate reader (Thermo, usa), low temperature high speed centrifuge (Eppendorf, germany).

2.2.2.2 reagents

Mouse VEGF R1/Flt-1E L ISA kit (R & D, USA), Thermo MultiskanAscent enzyme reader (Thermo, USA), low temperature high speed centrifuge (Eppendorf, Germany).

2.2.2.3 Experimental procedures

And balancing the reagents to room temperature according to the requirements of the kit specification, preparing a required working solution, placing the frozen serum at room temperature for re-melting, and then operating according to the reagent specification.

2.3 detection of activation of N L RP3 inflammasome in placental tissues

2.3.1RT-PCR detection of mRNA levels of N L RP3, Caspase1 and I L-1 β in placental tissue

2.3.1.1 Instrument

General PCR instrument (Eppendorf, Germany), ultramicro-spectrophotometer Nanodrop2000(Thermo, USA), real-time fluorescence quantitative PCR instrument Quantstudio 5(Thermo, USA).

2.3.1.2 reagent

TRIzol (Invitrogen, usa), chloroform (china), isopropanol (china, chloroform), absolute ethanol (china, bpc water (bi yun, china), cDNA reverse transcription synthesis kit (Thermo Fisher Scientific, usa), Talent fluorescent quantitative detection kit (tiangen, china).

2.3.1.3 Experimental procedures

(1) Primer design and Synthesis

Primer sequence and reaction

The conditions were referred to the relevant literature, synthesized and identified by Shanghai Biotech. The primer sequences are shown in Table 1.

TABLE 1 primer sequences

(2) Cellular RNA extraction

All experimental instruments were free of RNase contamination and the experiments were performed at 4 ℃.

① washing the tissue specimen with precooled PBS buffer solution for 2 times, adding 200 μ l TRIzol, grinding in tissue grinder, supplementing 800 μ l TRIzol, and mixing;

② standing at room temperature for 5min, centrifuging at 4 deg.C at 12000g for 5min, and transferring the supernatant to another EP tube;

③ adding 200 μ l chloroform, shaking vigorously for 15s, centrifuging at 4 deg.C and 12000g for 15min, and placing the upper water phase in a new centrifuge tube;

④ adding isopropanol of equal volume, mixing, and standing at room temperature for 10 min;

⑤ 4 ℃, centrifuging at 12000g for 10min, removing supernatant, adding 75% ethanol for precipitation;

⑥ adding DEPC water 30-100 μ l to dissolve RNA;

⑦ the total RNA concentration and purity are determined by mixing the samples, placing the mixture into 1 μ l RNA solution to a Nanodrop2000 analysis tank, and reading the RNA concentration and the OD260/OD280 ratio to determine the RNA purity, preferably the ratio is 1.8-2.0.

(3) Reverse transcription PCR

① re-fusing the extracted RNA and the reverse transcription reagent at 4 deg.C;

② calculating the template volume, 2. mu.g of RNA template was added to the reaction system, and the template volume of the sample was calculated based on the RNA concentration obtained by the measurement.

③ A20. mu.l reaction system was prepared, as shown in Table 2:

TABLE 2 reaction System for reverse transcription Synthesis of cDNA

④ PCR program is set at 42 deg.C, 60min, 70 deg.C, 5min, 4 deg.C, 5 min;

⑤ were frozen at-80 ℃.

(4)qRT-PCR

① qRT-PCR assay was performed using SYBR Green kit, the reaction system is shown in Table 3:

TABLE 3 qRT-PCR reaction System (20. mu.l)

② qRT-PCR reactions were carried out, the reaction procedure is shown in Table 4:

TABLE 4 qRT-PCR reaction procedure

③ melting curve analysis was performed after the reaction was completed.

2.3.2Western blot detection of N L RP3, pro-Caspase 1, cleared-Caspase 1, pro-I L-1 β and cleared-I L-1 β in placental tissues

2.3.2.1 Instrument

Low temperature high speed centrifuge (Eppendorf, germany), universal shaker (linbel, china), Thermo multiskan Ascent enzyme reader (Thermo, usa), dry thermostat (linbel, china), protein electrophoresis and transfer system (BIO-RAD, usa), chemiluminescence imaging system (Tanon, china), analytical electronic balance (ohaus, china), tissue grinder (Qiagen, germany).

2.3.2.2 reagent

RIPA lysate (priley, china), protease inhibitor (priley, china), protein phosphorylase inhibitor (priley, china), BCA protein assay Kit (Thermo, usa), PBS buffer (priley, china), skim milk powder (priley, china), prestained protein molecular weight standards (priley, china), 30% acrylamide-bisacrylamide solution (priley, china), ammonium persulfate (priley, china), tetramethylethylenediamine (priley, china), gel isolation buffer (priley, china), gel concentration buffer (priley, china), SDS-PAGE electrophoresis buffer (priley, china), 5 × loading buffer (priley, china), protein electrotransfer buffer (priley, china, germany), blocking-washing buffer TBST (priley, china), PVDF membrane (Merck millipore, germany), Mouse Reactive immobilized antibody (CST, usa), monoclonal antibody dilution, monoclonal antibody (monoclonal antibody protein substrate (mercy, milometer, mellon substrate (Merck, Merck)

2.3.2.3 reagent formulation

(1) The formulations of the separation gels at different concentrations are shown in Table 5

TABLE 5 preparation of the separation gels at different concentrations

(2) The formulation of the 5% concentrated gum is shown in Table 6

TABLE 6 preparation of concentrated gums

(3)1 × and preparing the electrophoresis solution, namely diluting 10 times of the electrophoresis solution of 10 × by deionized water.

(4)1 × preparation of electrotransfer 10-fold dilution of 10-10 × of electrotransfer with deionized water.

(5)1 × TBST solution was prepared by diluting 10-fold of 10 × TBST solution with deionized water.

(6) Preparation of 5% confining liquid, accurately weighing 5g of skimmed milk powder, adding into 100ml of TBST solution 1 ×, stirring thoroughly to dissolve, and preparing into 5% confining liquid.

(7) The primary antibody is prepared by adding different volumes of primary antibody into 5ml of primary antibody diluent respectively to prepare primary antibody solutions with different concentrations, and storing at-20 ℃ for later use, wherein the primary antibody dilution concentrations used in the invention are N L RP3 (1: 1000), Caspase1 (1: 1000), I L-1 β (1: 500) and β -actin (1: 1000).

(8) The secondary antibody is prepared by taking Anti-rabbitIgG HRP-linked antibody and Anti-mouse IgG HRP-linked antibody and diluting the antibodies with TBST solution of 1 × by 3000 times.

(9) Preparing a chemiluminescent color development liquid: according to the specification, equal volumes of the solution A and the solution B are taken and mixed uniformly, and the mixture is prepared for use.

2.3.2.4 Experimental procedures

(1) Protein extraction:

1) cutting 150mg of the extract, washing with pre-cooled PBS buffer solution for 3 times;

2) adding 200 mul of RIPA solution, 4 mul of protease inhibitor and 2 mul of protein phosphorylase inhibitor into a centrifuge tube, after cracking for 3min by a tissue grinder, supplementing 400 mul of RIPA solution, continuing cracking for 3min on the tissue grinder, standing for 5min on ice, and fully mixing by a vortex mixer;

3) centrifuging at 4 ℃ and 12000rpm for 10min, and sucking the supernatant into a new centrifuge tube;

(2) protein concentration determination by BCA method:

1) pipetting 1. mu.l of the supernatant, and diluting with 9. mu.l of PBS buffer;

2) 2 mug/mul BSA solution is diluted in a multiple ratio, the concentration is 0.0625-2 mug/mul respectively, PBS buffer solution is used as a blank control for preparing a standard curve;

3) according to the following weight ratio of 50: 1, mixing the solution A and the solution B in the kit;

4) respectively adding 10 mul of BSA solution with each concentration and diluted supernatant to be detected into a 96-well plate, then adding 200 mul of prepared mixed solution (A + B solution), and uniformly mixing;

5) incubating in 37 deg.C incubator for 30 min;

6) after balancing the room temperature, detecting the optical density (OD value) of each hole by using an enzyme-labeling instrument at the wavelength of 550 nm;

7) drawing a standard curve, and calculating the protein concentration of a sample to be detected;

8) after adding 5 × protein loading buffer, the protein was deformed by placing in a dry thermostat at 100 ℃ for 5min and stored in a refrigerator at-80 ℃.

(3) SDS-PAGE electrophoresis:

1) selecting a clean glass plate, and installing the glass plate on a glue preparation device;

2) preparing separation gel with proper concentration according to the molecular size of the target protein, uniformly mixing, and injecting into a glass plate layer;

3) sealing with anhydrous ethanol to isolate the contact of separation gel with air, standing at room temperature for 30min, waiting for the separation gel to solidify, pouring off the upper solution, and removing the residual liquid with filter paper;

4) injecting concentrated glue, inserting into a comb, standing for 20min for solidification, then pulling out the comb, mounting a plate, and adding electrophoresis liquid of 1 ×;

5) re-melting the sample to be detected, boiling for 3min, and loading;

6) and (3) performing electrophoresis from the negative electrode to the positive electrode at a constant voltage, wherein the voltage in the concentrated gel is 70V, the voltage is increased to 120V after the bromophenol blue enters the separation gel, continuing electrophoresis until the sample reaches the bottom of the separation gel, turning off the power supply, and discharging the gel.

(4) Incubation of the transmembrane with antibody:

1) cutting a PVDF membrane with the same size as the gel, soaking in anhydrous methanol for 15s, and soaking filter paper and sponge through an electrotransformation solution of 1 ×;

2) placing sponge, filter paper, gel, PVDF (polyvinylidene fluoride) membrane, filter paper and sponge in sequence from a cathode (black) to an anode (white), removing air bubbles of each layer, and clamping a rotary membrane clamp;

3) placing the transfer film clamp in the electric transfer liquid, switching on a power supply, and carrying out electric transfer for about 2 hours at 4 ℃ under a constant current of 250 mA;

4) cutting the electrically converted film according to the molecular weight, placing the cut film in 5% of sealing liquid, and sealing the film for 1 hour at the room temperature of a shaking table;

5) the membrane was placed in primary antibody and incubated overnight at 4 ℃;

6) washing the membrane with TBST solution 1 × for 3 times, 10min each time;

7) placing the membrane in a secondary antibody solution, and incubating for 1h at room temperature with gentle shaking;

8) washing the membrane with TBST for 3 times, 10min each time;

9) and (3) placing the film in a chemiluminescence imaging system, dropwise adding a color developing solution, then scanning, and calculating the gray value of each strip by using Image J software.

2.3.3 immunohistochemical detection of placental tissue N L RP3 and Caspase1

2.3.3.1 Instrument

Paraffin embedding machines (L EICA, germany), paraffin microtomes (L EICA, germany), high temperature ovens (kuntan, china), induction cookers (meic, china), autoclaves (double happiness, china), optical microscopes (Nikon, japan), digital pathological section scanners (nanoboomer, japan).

2.3.3.2 reagent

N L RP3 antibody (Abcam, uk), Caspase 1(Abcam, uk), goat anti-rabbit IgG/HRP polymer PV-6000 (sequoia argyrophylla, china), DAB color system Z L I-9019 (sequoia argyrophylla, china), 10% neutral formaldehyde (tomahu, china), PBS buffer powder (sequoia argyrophylla, china), citrate buffer (tomahuo argyrophylla, china), methanol (tomahuo, china), H₂O₂Solutions (Tongguang, China), absolute ethanol (national medicine, China), xylene substitutes (national medicine, China), hematoxylin counterstain (China fir Jinqiao, China), and encapsulated tablets (China fir Jinqiao, China).

2.3.3.3 preparation of solution

(1) PBS buffer 11.74 g/bag of PBS buffer powder was mixed with deionized water to prepare 1 × PBS buffer according to the instructions.

(2) 10% of neutral formaldehyde: formaldehyde was diluted 10-fold with PBS buffer.

(3) Ethanol solutions of different concentrations: the absolute ethanol was diluted to 80% and 95% with deionized water, respectively.

(4) 3% methanol-H₂O₂Solution: methanol was mixed with 30% H₂O₂The solution was mixed at a ratio of 9: 1, mixing uniformly.

(5) DAB working solution: 50 mul DAB stock solution is added into 1ml DAB diluent and is prepared for use.

2.3.3.4 Experimental procedures

(1) Paraffin embedding and slicing

1) Fixing: soaking placenta tissue in 10% neutral formaldehyde for 48 hr, washing with running water to remove fixative, and placing in embedding box;

2) dehydrating and transparent: the tissue blocks are dehydrated by 10 percent neutral formaldehyde for 4h, 80 percent ethanol for 1h, 95 percent ethanol for 1h, absolute ethanol for 1.5h and absolute ethanol for 1.5h in sequence; then carrying out transparent treatment on the xylene substitute for 1h in sequence and the xylene substitute for 1 h;

3) wax dipping and embedding: treating the tissue block with xylene and paraffin for 30min, adding molten paraffin, treating for 3h in a 55 deg.C incubator, and changing wax for 3 times; embedding the tissue block by preheated paraffin and cooling for later use;

4) slicing and unfolding: and continuously slicing 5 slices with the thickness of about 4 mu m by using a hand-operated slicer, flattening the slices in warm water, sticking the slices on a frosted glass slide, and storing the slices at room temperature for later use after the slices are slightly dried.

(2) Immunohistochemistry

1) Dewaxing and hydrating, drying and baking paraffin section at 60 deg.C for 2 hr, sequentially soaking the section in xylene substitute 15min × 3 times, anhydrous ethanol 5min × 2 times, 95% ethanol 5min × 2 times, 80% ethanol 5min, and distilled water 2 min;

2) fresh preparation of 3% methanol-H by immersing the slices₂O₂A solution;

3) washing with tap water, soaking in distilled water for 5min × 2 times, and soaking in PBS buffer for 5min × 3 times;

4) antigen retrieval: placing 0.01M citrate buffer solution (pH 6.0) in a pressure cooker, placing the slices on a high temperature resistant plastic slice rack, placing the slices below the liquid level, covering the cooker, adding a valve, heating the electromagnetic oven at high fire level to a pressure valve, rapidly spraying air, adjusting the electromagnetic oven to 100 deg.C, timing for 2min, taking the pressure cooker away from the heat source, rapidly cooling with cool water, uncovering, and air cooling to room temperature;

5) taking out the slices, and soaking in PBS buffer solution for 5min × 3 times;

6) 100 μ l of primary antibody working solution (diluted to a concentration of 1: 600) on sliced tissue, overnight at 4 ℃;

7) soaking in PBS buffer for 5min × 3 times;

8) dripping 100 μ l of second antibody on the sliced tissue, and incubating at room temperature for 30 min;

9) soaking in PBS buffer for 5min × 3 times;

10) dripping 100 mul of DAB working solution serving as a color developing agent on the sliced tissues, and controlling dyeing under an optical microscope; after the color development is complete, the color development is stopped by flushing with tap water;

11) hematoxylin counterstaining of cell nuclei: soaking in hematoxylin dye solution for 40s, washing with tap water for 2 times, soaking in differentiation solution for 3s, placing in a tap water tank, soaking in Return blue solution for 20s, placing in a tap water tank, and observing counterstaining condition under an optical microscope;

12) 95% ethanol for 2min × 2 times, anhydrous ethanol for 2min × 2 times, and xylene substitute for 5min × 2 times;

13) sealing by using a sealing agent;

14) and scanning the slice by using a digital pathological section scanner.

(3) Analysis of staining results

The method comprises the steps of performing two batches of experiments on each target protein, counterstaining cell nuclei by using a plectrum for judging positive positioning, and performing quantitative analysis by using another wave plate for not performing nuclear counterstaining, browsing the slices by using NDP.

2.3.4E L ISA test for I L-1 β concentration in tissues

After extracting the tissue protein, detecting the total protein concentration, and sucking a certain volume according to the total protein concentration to ensure that the total protein amount of each sample is the same. Subsequently, each sample taken was diluted 10-fold as suggested by the reagent instructions and finally, the procedure was followed according to the reagent instructions.

3 results of the experiment

3.1Diannexin can prevent MPs-induced PE-like phenotypes

MPs have the effect of amplifying thrombo-inflammatory diseases, play an important role in the pathogenesis and the development of PE, and research shows that MPs can induce mice to generate PE-like phenotypes. Therefore, the invention utilizes MPs to construct a PE-like animal model and explores whether Diannexin can prevent PE phenotype induced by MPs. The endothelial cells from the mice generate MPs after stimulation, and the MPs are injected into pregnant mice after extraction, compared with a control group, the blood pressure, the urine protein/creatinine ratio and the sFlt-1 level of the pregnant mice in the PE model group are obviously increased (t test, P is less than 0.05); following Diannexin, blood pressure in pregnant mice was significantly reduced, sFlt-1 levels were significantly reduced (t test, P <0.05), urine protein/creatinine ratio was reduced but the difference was not statistically significant (t test, P >0.05) compared to the PE model group, see fig. 3 and table 7.

TABLE 7 basic Performance and fetal development of three groups of pregnant mice

Note: DA: diannexin; SBP: systolic arterial pressure, MBP: mean arterial pressure, DBP: relaxing arterial pressure; sFlt-1: soluble fms-like tyrosine kinase 1

Further, the development conditions of the placentas and the fetal mice in each group are observed, and as a result, compared with a control group, the loss of the fetal mice in the PE model group is increased, the survival rate of the fetal mice is obviously reduced, the long diameter of the fetal mice is obviously reduced, the diameter of the placentas is obviously reduced (t test, P is less than 0.05), after the Diannexin intervention treatment, the long diameter of the fetal mice is obviously increased, the diameter of the placentas is obviously increased (ttest, P is less than 0.05), the survival rate of the fetal mice is improved, but the difference does not have statistical significance (t test, P is greater than 0.05), and the specific results are shown in fig. 4, fig. 5 and table 7. And observing the development conditions of the three groups of fetal rats, wherein the development of part of fetal rats in the PE model group is hindered, so that the smooth profile of the anterior foot plate and the light retinal pigment can be seen, and after the Diannexin intervention group, the development conditions of the fetal rats are the same as those of a control group, the fluctuation change of the anterior foot plate profile corresponding to the fingers is generated, and the retinal pigment is more, which is shown in figure 6. Thus, MPs induce pregnant mice to have PE-like phenotype, and the model is successfully constructed; the results of the Diannexin intervention group showed that Diannexin can exert a protective effect on the MPs-induced PE-like phenotype.

3.2Diannexin can reduce levels of microparticles in pregnant mice bearing PE-like phenotypes

The number of MPs in three groups of pregnant mice is detected by flow cytometry, and the result shows that the number of MPs in the PE model group is obviously increased compared with that in the control group (t test, t is 6.791, and P is 0.0002); following Diannexin intervention, the number of MPs was significantly reduced compared to the PE model group (t test, t-4.183, P-0.002), as shown in fig. 7.Diannexin was shown to reduce MPs-induced release from pregnant mice bearing the PE-like phenotype.

3.3Diannexin can reduce activation of N L RP3 inflammasome in placenta of pregnant mice with PE-like phenotype

To investigate whether Diannexin could reduce the activation of N L RP3 inflammasome in the placenta of PE-like phenotype pregnant mice, mRNA levels of N L RP3, Caspase1 and I L-1 β in the placenta were detected by RT-PCR, and protein levels and localization of N L RP3, Caspase1 and I L-1 β in the placenta were detected by Western blot and immunohistochemistry.

The results of RT-PCR showed significantly increased mRNA levels of N L RP3, Caspase1 and I L-1 β in the PE model group (t test, P <0.05) and significantly decreased mRNA levels of N L RP3, Caspase1 and I L-1 β in the Diannexin dried prognosis (t test, P <0.05) compared to the control group, as shown in FIG. 8.

Western blot results revealed that the PE model group had significantly increased levels of N L RP3, clear-Caspase 1 (active form) and clear-I L-1 β (active form) compared to the control group (t test, P <0.05), and increased levels of precursor Caspase1 and precursor I L-1 β (inactive) but not statistically different (t test, P >0.05), Diannexin dried prognosis, N L RP3, clear-Caspase 1 and clear-I L-1 β (t test, P <0.05), and decreased levels of precursor Caspase1 and I L-1 β but not statistically different (t test, P >0.05), as shown in FIG. 9.

The immunohistochemical detection of the level of N L RP3 in placenta shows that N L RP3 is mainly located in trophoblasts of giant cell trophoblasts, sponge trophoblasts and labyrinthine trophoblasts, wherein the Trophoblasts (TGC) and sponge trophoblasts (SpTC) have higher positive degree than the labyrinth (L ab), the PE model group has obviously stronger positive degree than the control group, the Diannexin stem pre-group has obviously weaker positive degree than the PE model group, the quantitative analysis of Image J is shown in figure 10(a), the results are compared in pairs, and the results show that the PE model group has higher positive degree in the giant cell trophoblasts, the sponge trophoblasts and the labyrinthin trophoblasts and has statistical significance (t test, P <0.05) compared with the PE model group, and the Diannexin stem pre-group has obvious difference in the trophoblasts and the sponge trophoblasts and the labyrinthin trophoblasts (10 c).

The expression of Caspase1 in three groups of placentas is observed, the positive degree of the PE model group is stronger than that of the control group, but the difference is not statistically significant, and the positive degree of the Diannexin stem control group is weakened, but the difference is not statistically significant, which is shown in figure 10(b) and figure 10 (d). This result was slightly different from the results of Westernblot (no statistical difference between pro-Caspase 1 expression groups, statistical difference between clear-Caspase 1), mainly considering that the immunohistochemical Caspase1 antibody detected total Caspase1 (cleaved and precursor Caspase 1) levels.

Considering that I L-1 β is secreted protein, the quantitative analysis result of E β ISA is more responsive to the level of secreted protein, therefore, the present invention extracts protein in the placental tissue, and the concentration of I L-1 β in the placental tissue is determined by the detection method of E L ISA, and as a result, the concentrations of I L-1 β in the control group, PE model group and Diannexin dried pre-group are 1.31 ± 0.199, 1.680 ± 0.293 and 1.42 ± 0.268 (unit: ng/ml), respectively, and the level of I L-1 464 in the placental tissue of the PE model group is significantly increased compared to the control group (ttest, t 2.577, P ═ 0.028), and the level of I L-1 β in the placental tissue of the Diannexin intervention group is significantly decreased compared to the PE model group (t test, t ═ 2.245, P ═ 0.049), thus, the above results show that the activation of PE in-derived placental tissues of the mouse N-induced small body inflammatory P3 in the mouse.

The foregoing describes preferred embodiments of the present invention, but is not intended to limit the invention thereto. Modifications and variations of the embodiments disclosed herein may be made by those skilled in the art without departing from the scope and spirit of the invention.

Sequence listing

<110> third Hospital of Beijing university (third clinical medical college of Beijing university)

<120> medicament for preventing or treating preeclampsia and related diseases and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>684

<212>PRT

<213> Unknown (Unknown)

<400>1

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asp Ala Gln Val Leu Arg Gly Thr Val Thr Asp Phe

20 25 30

Pro Gly Phe Asp Glu Arg Ala Asp Ala Glu Thr Leu Arg Lys Ala Met

35 40 45

Lys Gly Leu Gly Thr Asp Glu Glu Ser Ile Leu Thr Leu Leu Thr Ser

50 55 60

Arg Ser Asn Ala Gln Arg Gln Glu Ile Ser Ala Ala Phe Lys Thr Leu

65 70 75 80

Phe Gly Arg Asp Leu Leu Asp Asp Leu Lys Ser Glu Leu Thr Gly Lys

85 90 95

Phe Glu Lys Leu Ile Val Ala Leu Met Lys Pro Ser Arg Leu Tyr Asp

100 105 110

Ala Tyr Glu Leu Lys His Ala Leu Lys Gly Ala Gly Thr Asn Glu Lys

115 120 125

Val Leu Thr Glu Ile Ile Ala Ser Arg Thr Pro Glu Glu Leu Arg Ala

130 135 140

Ile Lys Gln Val Tyr Glu Glu Glu Tyr Gly Ser Ser Leu Glu Asp Asp

145 150 155 160

Val Val Gly Asp Thr Ser Gly Tyr Tyr Gln Arg Met Leu Val Val Leu

165 170 175

Leu Gln Ala Asn Arg Asp Pro Asp Ala Gly Ile Asp Glu Ala Gln Val

180 185 190

Glu Gln Asp Ala Gln Ala Leu Phe Gln Ala Gly Glu Leu Lys Trp Gly

195 200 205

Thr Asp Glu Glu Lys Phe Ile Thr Ile Phe Gly Thr Arg Ser Val Ser

210 215 220

His Leu Arg Lys Val Phe Asp Lys Tyr Met Thr Ile Ser Gly Phe Gln

225 230 235 240

Ile Glu Glu Thr Ile Asp Arg Glu Thr Ser Gly Asn Leu Glu Gln Leu

245 250 255

Leu Leu Ala Val Val Lys Ser Ile Arg Ser Ile Pro Ala Tyr Leu Ala

260 265 270

Glu Thr Leu Tyr Tyr Ala Met Lys Gly Ala Gly Thr Asp Asp His Thr

275 280 285

Leu Ile Arg Val Met Val Ser Arg Ser Glu Ile Asp Leu Phe Asn Ile

290 295 300

Arg Lys Glu Phe Arg Lys Asn Phe Ala Thr Ser Leu Tyr Ser Met Ile

305 310 315 320

Lys Gly Asp Thr Ser Gly Asp Tyr Lys Lys Ala Leu Leu Leu Leu Cys

325 330 335

Gly Glu Asp Asp Gly Ser Leu Glu Val Leu Phe Gln Gly Pro Ser Gly

340 345 350

Lys Leu Ala Gln Val Leu Arg Gly Thr Val Thr Asp Phe Pro Gly Phe

355 360 365

Asp Glu Arg Ala Asp Ala Glu Thr Leu Arg Lys Ala Met Lys Gly Leu

370 375 380

Gly Thr Asp Glu Glu Ser Ile Leu Thr Leu Leu Thr Ser Arg Ser Asn

385 390 395 400

Ala Gln Arg Gln Glu Ile Ser Ala Ala Phe Lys Thr Leu Phe Gly Arg

405 410 415

Asp Leu Leu Asp Asp Leu Lys Ser Glu Leu Thr Gly Lys Phe Glu Lys

420 425 430

Leu Ile Val Ala Leu Met Lys Pro Ser Arg Leu Tyr Asp Ala Tyr Glu

435 440 445

Leu Lys His Ala Leu Lys Gly Ala Gly Thr Asn Glu Lys Val Leu Thr

450 455 460

Glu Ile Ile Ala Ser Arg Thr Pro Glu Glu Leu Arg Ala Ile Lys Gln

465 470 475 480

Val Tyr Glu Glu Glu Tyr Gly Ser Ser Leu Glu Asp Asp Val Val Gly

485 490 495

Asp Thr Ser Gly Tyr Tyr Gln Arg Met Leu Val Val Leu Leu Gln Ala

500 505 510

Asn Arg Asp Pro Asp Ala Gly Ile Asp Glu Ala Gln Val Glu Gln Asp

515 520 525

Ala Gln Ala Leu Phe Gln Ala Gly Glu Leu Lys Trp Gly Thr Asp Glu

530 535 540

Glu Lys Phe Ile Thr Ile Phe Gly Thr Arg Ser Val Ser His Leu Arg

545 550 555 560

Lys Val Phe Asp Lys Tyr Met Thr Ile Ser Gly Phe Gln Ile Glu Glu

565 570 575

Thr Ile Asp Arg Glu Thr Ser Gly Asn Leu Glu Gln Leu Leu Leu Ala

580 585 590

Val Val Lys Ser Ile Arg Ser Ile Pro Ala Tyr Leu Ala Glu Thr Leu

595 600 605

Tyr Tyr Ala Met Lys Gly Ala Gly Thr Asp Asp His Thr Leu Ile Arg

610 615 620

Val Met Val Ser Arg Ser Glu Ile Asp Leu Phe Asn Ile Arg Lys Glu

625 630 635 640

Phe Arg Lys Asn Phe Ala Thr Ser Leu Tyr Ser Met Ile Lys Gly Asp

645 650 655

Thr Ser Gly Asp Tyr Lys Lys Ala Leu Leu Leu Leu Cys Gly Glu Asp

660 665 670

Asp Ala His His His His His His His His His His

675 680

<210>2

<211>2055

<212>DNA

<213> Unknown (Unknown)

<400>2

atggagacag acacactgct gctgtgggtg ctgctgctct gggtccccgg cagcaccggc 60

gacgcccaag tgctgagggg cacagtcacc gactttcccg gcttcgacga aagggccgac 120

gctgagacac tgaggaaggc tatgaaagga ctgggcacag acgaggaaag cattctgaca 180

ctgctgacct ctagaagcaa tgctcagaga caagagatct ccgctgcctt caagacactg 240

tttggaaggg atctgctgga cgacctcaag agcgagctca ccggcaagtt cgaaaagctg 300

atcgtggctc tgatgaagcc ctctagactg tacgatgcct acgagctcaa acatgccctc 360

aagggcgccg gaaccaacga gaaggtgctg acagagatta tcgccagcag aacccccgag 420

gagctgagag ccattaaaca agtgtacgag gaggaatatg gctcctctct ggaagacgac 480

gtcgtcggcg acacatccgg atactatcag aggatgctgg tcgtgctgct ccaagccaat 540

agagaccccg acgccggcat tgacgaggcc caagtggaac aagacgccca agccctcttt 600

caagccggag agctcaagtg gggcaccgac gaggagaagt tcatcacaat ctttggaaca 660

agaagcgtga gccatctgag aaaagtgttc gacaagtaca tgacaatctc cggcttccag 720

atcgaggaga ccatcgatag agagacctcc ggaaatctgg agcagctgct gctggctgtg 780

gtgaagtcca ttaggagcat ccccgcctac ctcgctgaaa cactctacta cgctatgaaa 840

ggagctggaa ccgacgacca cacactcatt agagtcatgg tgtctagaag cgagatcgac 900

ctcttcaaca ttagaaagga gtttaggaag aacttcgcca ccagcctcta cagcatgatc 960

aagggagaca cctccggcga ctataagaag gctctgctgc tcctctgcgg agaggacgac 1020

ggctctctgg aagtgctctt tcaaggcccc agcggaaaac tggcccaagt gctgagggga 1080

accgtgacag atttccccgg ctttgacgag agagccgacg ccgagacact gagaaaagct 1140

atgaagggac tgggcaccga tgaggaaagc attctcacac tgctgacctc tagaagcaac 1200

gcccaaaggc aagagatcag cgctgccttt aagaccctct ttggaagaga tctgctggac 1260

gatctgaaga gcgagctgac cggcaagttt gaaaagctca tcgtggccct catgaagcct 1320

agcagactct atgatgctta cgagctgaag catgctctca agggagctgg aacaaacgag 1380

aaggtgctca ccgaaatcat cgcctctaga acccccgaggaactgagggc tatcaagcaa 1440

gtgtacgagg aagagtatgg cagctctctg gaggatgacg tggtcggcga tacctccggc 1500

tattaccaga gaatgctcgt ggtgctgctg caagccaata gagaccccga tgctggaatc 1560

gacgaagccc aagtggaaca agatgctcaa gctctgtttc aagccggaga actcaagtgg 1620

ggaacagacg aagagaagtt tattacaatt ttcggcacca gaagcgtgtc ccatctcaga 1680

aaggtcttcg ataagtatat gaccatcagc ggcttccaaa tcgaggagac aattgataga 1740

gagaccagcg gaaacctcga acagctgctg ctcgctgtcg tcaagagcat taggtccatt 1800

cccgcctatc tggctgagac cctctactat gccatgaagg gagccggaac agacgatcac 1860

acactgatta gggtcatggt ctctagatcc gagattgatc tgttcaacat cagaaaggaa 1920

tttagaaaga atttcgccac aagcctctat agcatgatta agggcgacac cagcggcgat 1980

tataagaaag ctctgctgct gctgtgcgga gaagatgacg ctcatcacca ccatcaccac 2040

catcatcacc attaa 2055

Claims (8)

1. A medicament for the prevention or treatment of preeclampsia and related conditions, characterized in that the active ingredient of said medicament comprises Diannexin, said Diannexin being an Annexin a5 homodimer.

2. The medicament of claim 1, which is an injection preparation or an oral preparation; preferably an injectable formulation.

Application of Diannexin in preparation of drugs for preventing or treating preeclampsia.

Use of Diannexin in the manufacture of a medicament for improving placental development and/or fetal development in a pre-eclamptic pregnant woman or a pre-eclamptic-like phenotypic pregnant mouse.

Use of Diannexin in the preparation of a medicament for lowering blood pressure in a pregnant woman with preeclampsia or a pregnant mouse with a preeclampsia-like phenotype.

Use of Diannexin in the preparation of a medicament for reducing soluble fms-like tyrosine kinase 1 in a pre-eclamptic pregnant woman or a pre-eclamptic phenotype pregnant mouse.

Use of Diannexin in the preparation of a medicament for reducing Microparticles (MPs) released in a pregnant woman with preeclampsia or a pregnant mouse with a preeclampsia-like phenotype.

Use of Diannexin in the preparation of a medicament for reducing the level of inflammation in a pregnant woman with preeclampsia or in a pregnant mouse with a preeclampsia-like phenotype.

Images