CN111485030A - Application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice - Google Patents
Application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice Download PDFInfo
- Publication number
- CN111485030A CN111485030A CN201910073594.1A CN201910073594A CN111485030A CN 111485030 A CN111485030 A CN 111485030A CN 201910073594 A CN201910073594 A CN 201910073594A CN 111485030 A CN111485030 A CN 111485030A
- Authority
- CN
- China
- Prior art keywords
- rice
- transcription factor
- btf3
- indica
- japonica
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides application of a rice transcription factor BTF3 in identification of japonica rice and indica rice and a method for identifying japonica rice and indica rice, and relates to the technical field of rice variety identification. The application of the rice transcription factor BTF3 in the identification of japonica rice and indica rice utilizes the polymorphism difference of the transcription factor BTF3 in japonica rice and indica rice, and can conveniently and accurately distinguish germplasm resources of indica rice and japonica rice of rice cultivars. The invention also provides a method for identifying japonica rice and indica rice by using the rice transcription factor BTF3, and rapid identification of japonica rice and indica rice can be realized only by carrying out PCR and enzyme digestion. The identification method of the invention has low cost, high flux and high specificity (namely high accuracy), and is suitable for production practice.
Description
Technical Field
The invention relates to the technical field of rice variety identification, in particular to application of a rice transcription factor BTF3 in identification of japonica rice and indica rice and a method for identifying japonica rice and indica rice.
Background
The rice cultivars are mainly cultivated rice in Asia, and are divided into Indica rice (Oryza sativa subsp Indica) and japonica rice (Oryza sativa subsp Japan) according to a series of phenotypic differences, and thousands of Indica rice and japonica rice cultivars are developed and cultivated in China according to planting conditions and production requirements in different regions. To ensure high and stable yield, the seed purity of rice varieties is one of the most critical factors. Traditionally, the purity of rice varieties is identified in different growth periods such as seedling period, heading period, and wax ripening period. The characteristics identified mainly have three aspects, namely plant characteristics, ear characteristics and grain characteristics, but are greatly influenced by the experience of an identifier in actual production application. Furthermore, with the development of modern breeding, the phenotypic characters of some varieties are greatly different from those of classical indica rice and japonica rice, for example, the grains of some japonica rice are not wide and short, thick, oval or oval but rather biased to be long and narrow, and the like. Therefore, in the production practice, it is necessary to find a method for rapidly and accurately identifying the difference between indica rice and japonica rice. The molecular marker identification is a high-efficiency and accurate method aiming at the genetic difference of rice genetic information DNA sequences between indica rice and japonica rice.
SNP (single nucleotide polymorphism) markers and CAPS (clean amplified polymorphic sequence) technology developed according to the SNP markers can obtain more abundant polymorphisms which cannot be shown by other molecular marker technologies (Rafalski A. applications of single nucleotide polymorphism PCR protein cloning genes. curr Opin Plant Biol, 1542, 5(2) 94-100).
Disclosure of Invention
The invention provides an application of a rice transcription factor BTF3 in distinguishing japonica rice and indica rice in order to overcome the defect that the existing method for distinguishing japonica rice and indica rice is not fast and accurate enough, the transcription factor BTF3 is used as a molecular marker, polymorphism difference exists between indica rice and japonica rice by utilizing the transcription factor BTF3, and the japonica property and the indica property of rice can be rapidly distinguished by detecting the transcription factor BTF 3.
The invention also provides a method for identifying japonica rice and indica rice, which is characterized in that restriction enzyme is further used for enzyme digestion on the basis of the rice transcription factor BTF3, and the result can be judged without sequencing a target product amplified by PCR.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides application of a rice transcription factor BTF3 in identification of japonica rice and indica rice.
Preferably, the transcription factor BTF3 comprises a nucleotide sequence with C/T polymorphism located on chromosome 3 of a rice genome and at the 409 th base of a complete cds sequence of a BTF3 sequence.
Preferably, the transcription factor BTF3 of japonica rice comprises a nucleotide sequence with C polymorphism of 409 th base of complete cds sequence of BTF3 and located on No.3 chromosome of rice genome.
Preferably, the nucleotide sequence of the transcription factor BTF3 of japonica rice is shown in SEQ ID No. 1.
Preferably, the transcription factor BTF3 of indica rice comprises a nucleotide sequence with the nucleotide polymorphism of T at the 409 th base of chromosome 3 of rice genome and complete cds sequence of BTF 3.
Preferably, the nucleotide sequence of transcription factor BTF3 of indica rice is shown in SEQ ID No. 2.
7. A method for distinguishing japonica rice from indica rice comprises the following steps:
1) extracting the genome DNA of the rice to be detected;
2) designing a PCR primer pair of a transcription factor BTF3 in the application of the technical scheme;
3) amplifying the genome DNA in the step 1) by using the primer pair in the step 2) to obtain a target sequence;
4) carrying out enzyme digestion on the target product obtained in the step 3) by using a restriction enzyme which can distinguish polymorphic site C/T located in No.3 chromosome of a rice genome and 409 th base of a complete cds sequence of a BTF3 sequence and has only one enzyme digestion site in the transcription factor BTF3, and if two fragments exist in the enzyme digestion product, judging that the rice to be detected is japonica rice; if only one fragment exists in the enzyme digestion product, the rice to be detected is judged to be indica rice.
Preferably, in the primer pair designed in step 2), the nucleotide sequence of the upstream sequence is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID NO. 4.
Preferably, the restriction enzyme in step 4) is Alu I.
Compared with the prior art, the invention has the beneficial effects that:
(1) the invention provides a rice transcription factor BTF3 for identifying japonica rice and indica rice, wherein the transcription factor BTF3 comprises a nucleotide sequence with C/T polymorphism of 409 th base of complete cds sequence of BTF3 sequence and chromosome 3 of rice genome. The rice transcription factor BTF3 provided by the invention has high specificity, and can conveniently and accurately distinguish germplasm resources of indica rice and japonica rice of rice cultivars.
(2) The invention also provides a method for identifying japonica rice and indica rice by using the rice transcription factor BTF3, and rapid identification of japonica rice and indica rice can be realized only by carrying out PCR and enzyme digestion. The identification method of the invention has low cost, high flux and high specificity (namely high accuracy), and is suitable for production practice.
Drawings
FIG. 1 is an electrophoretogram of a BTF3 molecular marker and an electrophoretogram of a restriction enzyme digestion product for identifying rice varieties indica rice and japonica rice by using the BTF3 molecular marker in example 1; wherein, the upper graph is an electrophoresis graph of a PCR target product of each rice variety, and the lower graph is an electrophoresis graph of a target product enzyme digestion product of each rice variety;
wherein, the lanes from left to right are common wild rice, indica rice varieties 1-7, Nivala wild rice and japonica rice varieties 1-7 in sequence;
indica rice varieties 1-7 are 93-11, dwarf southern China, Guangdong short No.4, Zhenshan 97, Minghui 63, Huangsi zhan and Huanghuazhan in sequence;
the japonica rice varieties 1-7 are Nipponbare, Taizhong 65, Zhonghua 11, agricultural reclamation 58, Yunyuan No. 23, Huidong No.3 and Jindao No.1 in sequence.
Detailed Description
The invention provides application of a rice transcription factor BTF3 in identifying japonica rice and indica rice, and preferably, the transcription factor BTF3 comprises a nucleotide sequence with C/T polymorphism of 409 th base of complete cds sequence of BTF3 sequence and chromosome 3 of rice genome. In the present invention, the complete cds sequence of the BTF3 sequence is shown in GenBank: KF017618.1 (https:// www.ncbi.nlm.nih.gov/nuccore/KF 017618.1).
In the invention, the transcription factor BTF3 of japonica rice preferably comprises a nucleotide sequence which is located on chromosome 3 of a rice genome and has C at the 409 th base of the complete cds sequence of BTF3 sequence; more preferably, the nucleotide sequence of the transcription factor BTF3 of japonica rice is shown in SEQ ID No. 1:
cttgaaaaga gtaggagtga acaacattcc tggtatcgaa gaggtcaata tcttcaagga
tgatgtggtt atccaatttc agaatccaaa agcagtgcaa gcatccattg gtgcaaatac
atgggtagtg agtggaacac cacagacgaa gaagctgcaa gatctgcttc caacaatcat
caaccagttg ggacctgata acctggacaa cctcaggagg cttgctgagc agttccagaa
gcaggtacccggtgctgagg ctggtgccag cgcaggtaac gctcaggacg acgacgatga
tgtccctg。
in the present invention, the transcription factor BTF3 of indica rice preferably comprises a nucleotide sequence which is located on chromosome 3 of rice genome and has T at the 409 th base of the complete cds sequence of BTF3 sequence; more preferably, the nucleotide sequence of transcription factor BTF3 of indica rice is shown as SEQ ID NO. 2;
cttgaaaaga gtaggagtga acaacattcc tggtatcgaa gaggtcaata tcttcaagga
tgatgtggtt atccaatttc agaatccaaa agcagtgcaa gcatccattg gtgcaaatac
atgggtagtg agtggaacac cacagacgaa gaagttgcaa gatctgcttc caacaatcat
caaccagttg ggacctgata acctggacaa cctcaggagg cttgctgagc agttccagaa
gcaggtaccc ggtgctgagg ctggtgccag cgcaggtaac gctcaggacg acgacgatga
tgtccctg。
the research of the invention shows that indica rice and japonica rice have only one polymorphic site difference in the transcription factor BTF3 sequence, namely, polymorphism C/T exists in 409 th base of complete cds sequence of BTF3 sequence and the rice genome number 3, the transcription factor BTF3 has high specificity for identifying indica rice and japonica rice, and the identification result is more accurate.
The invention also provides application of the transcription factor BTF3 in the technical scheme in identification of japonica rice and indica rice, and the rice to be detected can be determined to be japonica rice or indica rice only by amplifying the transcription factor BTF3 by using PCR and further identifying the polymorphic site base in the transcription factor BTF 3.
The invention also provides a method for identifying japonica rice and indica rice, which comprises the following steps:
1) extracting the genome DNA of the rice to be detected;
2) designing a PCR primer pair of a transcription factor BTF3 in the application of the technical scheme;
3) amplifying the genome DNA in the step 1) by using the primer pair in the step 2) to obtain a target sequence;
4) carrying out enzyme digestion on the target product obtained in the step 3) by using a restriction enzyme which can distinguish polymorphic site C/T located in No.3 chromosome of a rice genome and 409 th base of a complete cds sequence of a BTF3 sequence and has only one enzyme digestion site in the transcription factor BTF3, and if two fragments exist in the enzyme digestion product, judging that the rice to be detected is japonica rice; if only one fragment exists in the enzyme digestion product, the rice to be detected is judged to be indica rice.
The invention extracts the genome DNA of the rice to be detected so as to facilitate the subsequent PCR amplification. The invention has no special limitation on how to extract the rice genome DNA, and any method or kit known in the art can be adopted, such as CTAB method or chlorination centrifugation method.
The invention designs a PCR primer pair according to the transcription factor BTF3 sequence in the technical scheme, and the PCR primer pair is used for amplifying the transcription factor BTF3 in the genome DNA. In the preferred primer pair of the transcription factor BTF3, the nucleotide sequence of the upstream sequence is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream sequence is shown as SEQ ID NO. 4:
SEQ ID NO.3：5’-CTTGAAAAGAGTAGGAGTG-3’；
SEQ ID NO.4：5’-CAGGGACATCATCGTCGTC-3’。
after the primer pair of the genome DNA and the transcription factor BTF3 is obtained, the invention utilizes the primer pair to amplify the genome DNA of the rice to be detected by PCR to obtain the target sequence. Preferably, the primer pair consisting of SEQ ID NO.3 and SEQ ID NO.4 is used to amplify the target product as SEQ ID NO.1 (japonica rice) or SEQ ID NO.2 (indica rice).
In the present invention, the reaction system for PCR amplification preferably comprises 10 mmol/L dNTP mixture 0.2. mu. L, 0.1. mu. mol/L primer pair 1. mu. L for upstream and downstream primers, respectively, high fidelity PCR polymerase 5U (1. mu. L), 0.2. mu.g genomic DNA (the amount of. mu. L added may be different depending on the concentration of extraction, but the amount of DNA added is substantially the same, and the total volume of the reaction system may be adjusted to the amount of water finally added as required), 10 times of reaction buffer 10. mu. L, and the balance of deionized water per 100. mu. L.
In the present invention, the reaction conditions of the PCR reaction are preferably: performing pre-denaturation at 95 ℃ for 2min, and performing 30 cycles at 95 ℃ for 15s, 52 ℃ for 20s and 72 ℃ for 30 s; after the circulation, the extension was carried out at 72 ℃ for 5 min.
After a target product is obtained, the method adopts restriction enzyme which can distinguish polymorphic site C/T of 409 th base of complete cds sequence of No.3 chromosome and BTF3 sequence of rice genome, and has only one restriction enzyme cutting site in the transcription factor BTF3 to cut the obtained target product, and if two fragments exist in the restriction enzyme cutting product, the rice to be detected is judged to be japonica rice; if only one fragment exists in the enzyme digestion product, the rice to be detected is judged to be indica rice.
In the invention, the restriction enzyme which can distinguish polymorphic site C/T located in chromosome 3 of rice genome and 409 th base of complete cds sequence of BTF3 sequence and has only one enzyme cutting site in the transcription factor BTF3 is preferably Alu I, and the enzyme cutting recognition sites are as follows: AGCT. The restriction endonuclease can recognize and cut the BTF3 molecular marker of japonica rice into two bands by enzyme cutting; the base of indica rice at the polymorphic site of the transcription factor BTF3 is 'T', namely 'AGTT', and cannot be cut by restriction enzyme Alu I to form a band. Therefore, the method for identifying japonica rice and indica rice can distinguish indica rice from japonica rice by the number of bands, and has the advantages of simple and easily obtained result and high specificity.
Preferably, the number of fragments in the enzyme-cleaved product is determined by electrophoresis of the enzyme-cleaved product.
The transcription factor BTF3 of the invention can also be applied to the identification of common wild rice (Oryza rufipogon) and Nivara wild rice (O.nivara). The research of the invention shows that the transcription factor BTF3 sequence of the ordinary wild rice is consistent with that of the japonica rice, while the transcription factor BTF3 sequence of the Niva wild rice is consistent with that of the indica rice, so that the difference of the BTF3 molecular markers of the japonica rice and the indica rice is also reflected between the ordinary wild rice and the Niva wild rice, and when a person skilled in the art needs to determine whether the rice is the ordinary wild rice or the Niva wild rice, the transcription factor BTF3 can be effectively identified. The specific identification method is as above mentioned, and is not described herein again.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1. Materials and methods
1.1 Experimental materials
The experimental materials used as the molecular marking method for identifying the varieties of the indica rice and the japonica rice of the rice comprise common wild rice and Nivara wild rice (Nivara wild rice); indica rice varieties 1-7 are 93-11, dwarf southern China, Guangdong short No.4, Zhenshan 97, Minghui 63, Huangsi zhan and Huanghuazhan respectively; japonica rice varieties 1-7 are Nipponbare, Taizhong 65, Zhonghua 11, agricultural reclamation 58, Yunyuan No. 23, Huidong No.3 and Jindao No.1 respectively.
1.2 Experimental methods
Step 1)
(1) Taking about 0.5g of rice leaves, cutting the leaves into pieces, putting the pieces into a precooled mortar, adding liquid nitrogen, grinding the leaves into powder, putting the powder into a 2m L centrifugal tube, adding 800 mu L2 × CTAB extraction buffer solution, uniformly mixing, and carrying out water bath at 65 ℃ for 30 min;
(2) adding equal volume of chloroform, isoamyl alcohol and anhydrous alcohol (76: 4: 20), shaking for 10min, and mixing well;
(3) centrifuging for 12min under the condition of 11540 r/min, transferring the supernatant into another 1.5m L centrifuge tube, adding 0.6 volume time of isopropanol or two volume times of absolute ethanol, mixing uniformly, centrifuging for 2min at 11540 r/min, removing the supernatant, rinsing twice with 0.5ml of 70% ethanol, air-drying, and dissolving in 100-154 mu L0.5 × TE buffer solution;
(4) 1 μ L was taken for subsequent PCR amplification reactions.
Step 2)
In PCR amplification reactions
a. The reaction volume of the reaction solution is 100 mu L as reference, the composition and content of the used articles are 10 mmol/L dNTP mixture 0.2 mu L, 0.1 mu mol/L PCR primer (SEQ ID NO.3, SEQ ID NO.4)2 mu L, high fidelity PCR polymerase 5U (1 mu L), 0.2 mu g genomic DNA, 10 times reaction buffer solution 10 mu L, and deionized water added to 100 mu L;
b. PCR amplification reaction is carried out on a DNA amplification instrument, and after the reaction condition is pre-denaturation at 95 ℃ for 2min, 30 cycles are carried out according to the settings of 95 ℃ for 15sec, 52 ℃ for 20sec and 72 ℃ for 30 sec; after circulation, extending at 72 ℃ for 5min, and then storing at 4 ℃ for later use;
step 3)
And (3) carrying out Alu I enzyme digestion on the PCR amplification product, carrying out electrophoresis on the PCR amplification product subjected to enzyme digestion on 1.2% agarose gel for 1.5h (5V/cm), staining the PCR amplification product by ethidium bromide (EtBr), observing the product by using a gel imaging system, and photographing and recording the product.
2 results and analysis
2.1 sequencing of BTF3
The primers (SEQ ID NO.3 and SEQ ID NO.4) are used for carrying out PCR amplification on the genomic DNA of 16 different rice materials, all the primers can amplify a very clear single band, 8 bands have the same size, and the result is stable and consistent after 3 times of repetition (see figure 1). The length of 16 PCR products is 308bp through positive and negative sequence determination; furthermore, all primers used for PCR amplification were correctly detected at both ends. Wherein, the sequences of japonica rice varieties and common wild rice are shown in a sequence table SEQ ID NO.1, and the sequences of indica rice and Nivara wild rice are shown in a sequence table SEQ ID NO. 2.
2.2 SNP labelling and characterisation of the BTF3 sequence
The Blastn analysis of the 16 sequences tested showed that the DNA fragment cloned in this study was BTF 3. ClustalW analysis is carried out on the cloned DNA sequence to find that the cloned sequences of the japonica rice variety and the ordinary wild rice are the same, and the sequences of indica rice and Nivara wild rice; compared with the sequence of indica rice and japonica rice, the SNP locus difference of C ← → T exists. The japonica rice has restriction enzyme Alu I restriction recognition site in the adjacent sequence: AGCT. And the SNP mutation AGTT of the indica rice at the enzyme digestion recognition site cannot be recognized by the restriction enzyme Alu I. Therefore, after Alu I enzyme-digested and identified the above PCR fragments, the japonica rice fragments were digested into DNA fragments of 154bp size, while indica rice still maintained DNA fragments of 308bp size (FIG. 1).
From the above examples, it can be seen that the rice transcription factor BTF3 provided by the present invention has a nucleotide sequence difference of C/T polymorphism between japonica/indica rice, Oryza sativa (Oryza rufipogon) and nivale Oryza sativa (o.nivara) located on chromosome 3 of the rice genome and at base 409 of the complete cds sequence of BTF3 sequence, and can distinguish japonica rice from indica rice, vitis vinifera and nivale Oryza sativa by the polymorphism, so that the specificity is high, and the method is simple and easy to implement.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice
<141>2019-01-24
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>308
<212>DNA
<213>Oryza sativa subsp. geng
<400>1
cttgaaaaga gtaggagtga acaacattcc tggtatcgaa gaggtcaata tcttcaagga 60
tgatgtggtt atccaatttc agaatccaaa agcagtgcaa gcatccattg gtgcaaatac 120
atgggtagtg agtggaacac cacagacgaa gaagctgcaa gatctgcttc caacaatcat 180
caaccagttg ggacctgata acctggacaa cctcaggagg cttgctgagc agttccagaa 240
gcaggtaccc ggtgctgagg ctggtgccag cgcaggtaac gctcaggacg acgacgatga 300
tgtccctg 308
<210>2
<211>308
<212>DNA
<213>Oryza sativa subsp. xian
<400>2
cttgaaaaga gtaggagtga acaacattcc tggtatcgaa gaggtcaata tcttcaagga 60
tgatgtggtt atccaatttc agaatccaaa agcagtgcaa gcatccattg gtgcaaatac 120
atgggtagtg agtggaacac cacagacgaa gaagttgcaa gatctgcttc caacaatcat 180
caaccagttg ggacctgata acctggacaa cctcaggagg cttgctgagc agttccagaa 240
gcaggtaccc ggtgctgagg ctggtgccag cgcaggtaac gctcaggacg acgacgatga 300
tgtccctg 308
<210>3
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cttgaaaaga gtaggagtg 19
<210>4
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cagggacatc atcgtcgtc 19
Claims (9)
1. Application of rice transcription factor BTF3 in identification of japonica rice and indica rice.
2. The use of claim 1, wherein the transcription factor BTF3 comprises a nucleotide sequence with C/T polymorphism located on chromosome 3 of rice genome and at the 409 st base of the complete cds sequence of BTF 3.
3. The use of claim 2, wherein the transcription factor BTF3 of japonica rice comprises a nucleotide sequence with T polymorphism at the 409 th base of the complete cds sequence of BTF3 and chromosome 3 of the rice genome.
4. The transcription factor BTF3, according to claim 3, wherein the nucleotide sequence of the transcription factor BTF3 of japonica rice is shown in SEQ ID No. 1.
5. The rice transcription factor BTF3 of claim 2, wherein the transcription factor BTF3 of indica rice comprises a nucleotide sequence of rice genome No.3 chromosome and C polymorphism at position 409 of complete cds sequence of BTF3 sequence.
6. The rice transcription factor BTF3, according to claim 5, wherein the nucleotide sequence of the indica rice transcription factor BTF3 is shown in SEQ ID No. 2.
7. A method for distinguishing japonica rice from indica rice comprises the following steps:
1) extracting the genome DNA of the rice to be detected;
2) designing a PCR primer pair of the transcription factor BTF3 for the application of claims 1-6;
3) amplifying the genome DNA in the step 1) by using the primer pair in the step 2) to obtain a target sequence;
4) carrying out enzyme digestion on the target product obtained in the step 3) by using a restriction enzyme which can distinguish polymorphic site C/T located in No.3 chromosome of a rice genome and 409 th base of a complete cds sequence of a BTF3 sequence and has only one enzyme digestion site in the transcription factor BTF3, and if two fragments exist in the enzyme digestion product, judging that the rice to be detected is japonica rice; if only one fragment exists in the enzyme digestion product, the rice to be detected is judged to be indica rice.
8. The method as claimed in claim 7, wherein the primer pair designed in step 2) has the upstream sequence shown in SEQ ID NO.3 and the downstream sequence shown in SEQ ID NO. 4.
9. The method according to claim 7, wherein the restriction enzyme of step 4) is Alu I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910073594.1A CN111485030A (en) | 2019-01-25 | 2019-01-25 | Application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910073594.1A CN111485030A (en) | 2019-01-25 | 2019-01-25 | Application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111485030A true CN111485030A (en) | 2020-08-04 |
Family
ID=71812194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910073594.1A Pending CN111485030A (en) | 2019-01-25 | 2019-01-25 | Application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111485030A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100736152B1 (en) * | 2006-02-08 | 2007-07-06 | 재단법인서울대학교산학협력재단 | Sts marker set for identification of subspecies in rice |
| CN101215609A (en) * | 2008-01-21 | 2008-07-09 | 中国农业大学 | Auxiliary screening method for indica rice and japonica rice |
| CN101215608A (en) * | 2008-01-21 | 2008-07-09 | 中国农业大学 | Auxiliary screening method for indica rice and japonica rice, and special-purpose primer for the same |
| CN107475426A (en) * | 2017-09-25 | 2017-12-15 | 山东省水稻研究所 | A kind of molecular labeling for differentiating cultivation rice varieties indica rice type and application |
| CN107630103A (en) * | 2017-10-13 | 2018-01-26 | 华南农业大学 | A kind of CAPS molecule labelling methods for identifying rice varieties and application |
-
2019
- 2019-01-25 CN CN201910073594.1A patent/CN111485030A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100736152B1 (en) * | 2006-02-08 | 2007-07-06 | 재단법인서울대학교산학협력재단 | Sts marker set for identification of subspecies in rice |
| CN101215609A (en) * | 2008-01-21 | 2008-07-09 | 中国农业大学 | Auxiliary screening method for indica rice and japonica rice |
| CN101215608A (en) * | 2008-01-21 | 2008-07-09 | 中国农业大学 | Auxiliary screening method for indica rice and japonica rice, and special-purpose primer for the same |
| CN107475426A (en) * | 2017-09-25 | 2017-12-15 | 山东省水稻研究所 | A kind of molecular labeling for differentiating cultivation rice varieties indica rice type and application |
| CN107630103A (en) * | 2017-10-13 | 2018-01-26 | 华南农业大学 | A kind of CAPS molecule labelling methods for identifying rice varieties and application |
Non-Patent Citations (5)
| Title |
|---|
| KAWAHARA,Y.等: "登录号：NC_029258.1", 《GENBANK》 * |
| LIU,X.等: "登录号：CT833533.1", 《GENBANK》 * |
| WANG WENYI: "Basal transcription factor 3 plays an important role in seed germination and seedling growth of rice", 《BIOMED RESEARCH INTERNATIONAL》 * |
| 佚名: "登录号：XM_015772333.2", 《GENBANK》 * |
| 佚名: "登录号：XM_015774959.2", 《GENBANK》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN107630103B (en) | CAPS molecular marker method for identifying rice varieties and application | |
| CN109207574B (en) | Cucumber female SNP molecular marker and application thereof | |
| KR20140039866A (en) | Ssr primer sets for discrimination of oriental melon line or cultivar and uses thereof | |
| CN110894542A (en) | Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer | |
| CN105255873B (en) | The related SNP marker of cucumber female character is marked and its applied with InDel | |
| CN109234446B (en) | Cucumber female SNP molecular marker and application thereof | |
| CN112301142B (en) | Leymus speetanus anti-powdery mildew gene Pm12 molecular marker and application thereof | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| CN102690812A (en) | Molecular marker SIsv0067 closely linked with Setaria italica L. Beauv. heading stage gene | |
| Qi et al. | Molecular tagging wheat powdery mildew resistance gene Pm21 by EST-SSR and STS markers | |
| CN109735646B (en) | CAPS molecular marker and method for identifying rice variety and application thereof | |
| CN111485031A (en) | Rice molecular marker DOF8 and application thereof, and method for identifying japonica rice and indica rice by using rice molecular marker DOF8 | |
| Halász et al. | Preliminary characterization of the self-incompatibility genotypes of European plum (Prunus domestica L.) cultivars | |
| CN112760319B (en) | Development and application of aegilops tauschii 2Sl chromosome specific molecular marker | |
| CN111485030A (en) | Application of rice transcription factor BTF3 in identification of japonica rice and indica rice and method for identifying japonica rice and indica rice | |
| CN109652579B (en) | Codominant molecular marker of rice blast resistance gene Pi2, detection method and application thereof | |
| CN114717352A (en) | Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof | |
| KR100671213B1 (en) | Development of molecular markers linked to the stability gene of pepper cgms and its use for determining the types of allele | |
| CN102912027A (en) | Primer pairs used for identification of wheat vernalization gene VRN-1 and application thereof | |
| CN109628444B (en) | Microsatellite molecular marker and method for identifying rice variety and application thereof | |
| CN111826462A (en) | Marker related to early and late flowering period of Siberian apricot and detection primer, method and application thereof | |
| CN102690818A (en) | Molecular marker SIsv0832 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN102154284B (en) | Molecular marker SIsv0408 capable of being closely linked to Setaria italica pollen color gene | |
| CN112143830A (en) | Molecular marker of rice sword leaf width regulation gene NAL1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200804 |
|
| RJ01 | Rejection of invention patent application after publication |