CN111484142B - Bioremediation technology of eutrophic water body - Google Patents

Abstract

The invention provides a bioremediation technology of eutrophic water, which belongs to the field of habitat restoration and comprises the steps of adding zingerone according to the proportion of 11-13mg/L seawater, adding asparagus which is cultured for 8-10d and grows well in advance according to the proportion of 3-4.8g/L seawater, adding immobilized composite bacteria according to the proportion of 300-500g/L seawater, and adding a regulator according to the proportion of 70-120g/L seawater after 2-3d of the asparagus. The method provided by the invention can stimulate the expression of asparagus carbonic anhydrase gene, improve the activity of carbonic anhydrase, improve the photosynthesis efficiency, enhance the capability of competing with red tide algae for nutrient salt, simultaneously improve the allelopathy of the red tide algae, and effectively improve the water quality.

Description

Bioremediation technology of eutrophic water body

Technical Field

The invention belongs to the field of habitat restoration, and particularly relates to a bioremediation technology of eutrophic water.

Background

The eutrophication of water body means that under the influence of human activities, a large amount of nutrient substances such as nitrogen, phosphorus and the like required by organisms enter into the slow-flow water body such as lakes, estuaries, gulfs and the like, so that algae and other plankton are rapidly propagated, the dissolved oxygen amount of the water body is reduced, the water quality is deteriorated, and a large amount of fish and other organisms are killed. Only in the last few decades, many previously oligotrophic estuaries and offshore waters have undergone a dramatic shift to become moderately trophic and eutrophic. Eutrophication affects the quality of the water and causes a decrease in the transparency of the water, making it difficult for sunlight to penetrate through the permeable layer, thereby affecting photosynthesis of plants in the water and possibly causing a supersaturated state of dissolved oxygen. The supersaturation of dissolved oxygen and the small amount of dissolved oxygen in water are harmful to aquatic animals, causing a great amount of fish death. Eutrophication may also cause red tides, disrupting the balance of the water ecosystem or causing structural changes and functional degradation of the original ecosystem. In northern North China, as P/Si and N/Si values are increased, diatoms are replaced by dinoflagellates, and the composition of phytoplankton species is changed; in Bay, Bohai sea and the mouth of the Yangtze river, the change of the structure of the nutritive salt causes a series of changes of the ecological environment, such as the reduction of large diatoms, the change of dominant species of phytoplankton and the like. The Bohai sea ecological environment report indicates that the economic fish yield of the Bohai sea is greatly reduced and the fish structure is more and more single due to the fact that the mass of sewage is increased year by year and red tide.

The prior art, such as the Chinese patent with the publication number of CN 101331849B, discloses an ecological restoration method of large-scale seaweed belonging to Gracilaria to eutrophic barricaded sea areas. The ecological restoration method for the eutrophic barricade sea area mainly comprises the following operation steps: collecting Gracilaria seedlings, transporting the Gracilaria seedlings, domesticating the Gracilaria seedlings in a sea area, building a dam and enclosing the sea in an eutrophic sea area, isolating the tide of the open sea, and performing ecological restoration. After the gracilaria cultivated in a eutrophic sea area in a large scale is introduced and cultivated, a large amount of dissolved nutrient salt in the water body can be absorbed for the growth of the gracilaria itself, the explosive growth of unicellular algae can be inhibited, silt can be absorbed, the gracilaria is harvested, so that nutrient substances in the water body are transferred out of a pollution system, the water quality is improved, the ecology of the sea area is repaired, the water body after ecological repair is exchanged with the outside, the aim of relieving and eliminating the eutrophication of the sea area is achieved, the eutrophication is gradually realized, and simultaneously, higher economic value is generated. The invention is suitable for ecological restoration of eutrophic barricade sea areas.

Disclosure of Invention

The invention aims to provide a sustained-release microsphere for increasing the content of polyunsaturated fatty acid in asparagus, which can increase the content of the polyunsaturated fatty acid in the asparagusKASⅡGene, gene,SADThe transcription level of the gene is obviously improvedFAD2The transcription level of the gene improves the proportion of polyunsaturated fatty acid in fatty acid, thereby improving the inhibition rate of red tide algae.

The technical scheme adopted by the invention for realizing the purpose is as follows:

provides a slow release microsphere for improving the content of polyunsaturated fatty acid in asparagus, and the slow release microsphere is embedded with stevioside and (2R,3R) -dihydroquercetin. The fatty acid is a member in allelochemicals, has an algae inhibiting effect on specific algae, the algae inhibiting activity of the fatty acid is related to the structure of the fatty acid, the algae inhibiting effect of the unsaturated fatty acid is obviously better than that of saturated fatty acid containing the same carbon chain, and the inhibiting effect is stronger when the degree of unsaturation is higher. beta-ketoacyl-ACP synthetase II (KAS II) can catalyze palmitic acid to synthesize stearic acid, and is key enzyme for regulating and controlling ratio of 16-carbon fatty acid to 18-carbon fatty acid, and delta 9-fatty acid dehydrogenase (SAD) is lipidThe key enzyme for desaturation of fatty acids, the oleic dehydrogenase FAD2, is a key enzyme for linoleic acid. Stevia rebaudiana glycoside and (2R,3R) -dihydroquercetin capable of improving asparagus qualityKASⅡGene, gene,SADThe transcription level of the gene is obviously improvedFAD2The transcription level of the gene promotes palmitic acid to synthesize stearic acid, promotes stearic acid to desaturate to form oleic acid, promotes oleic acid to further synthesize linoleic acid, and improves the proportion of polyunsaturated fatty acid in fatty acid, thereby improving the allelopathy of the asparagus to the red tide algae and improving the inhibition rate of the red tide algae.

Preferably, the preparation method of the sustained-release microspheres comprises the following steps:

a. dissolving stevioside and (2R,3R) -dihydroquercetin in sterile seawater to obtain mixed solution, dissolving sodium alginate powder in sterile seawater to obtain sodium alginate viscous solution, and mixing to obtain material colloid solution;

b. dissolving calcium chloride and chitosan powder in 1-1.3% (m/v) acetic acid solution to obtain fixing solution, wherein the concentration of calcium chloride in the fixing solution is 1.8-2.2% (m/v), and the concentration of chitosan is 0.6-1.1% (m/v);

c. dropwise adding the material colloidal solution in the step a into the stationary liquid in the step b, standing for 40-60min after dropwise adding is finished to obtain slow-release microspheres, removing the stationary liquid, washing the slow-release microspheres with deionized water, and performing vacuum freeze drying to obtain finished products;

the mass fraction of the stevioside in the sustained-release microspheres is 1-1.2%, the mass fraction of the (2R,3R) -dihydroquercetin is 0.6-0.8%, and the mass fraction of the sodium alginate is 2-3%.

Another object of the present invention is to provide a bioremediation technique for eutrophic water, which can stimulate the expression of asparagus carbonic anhydrase gene, increase the activity of carbonic anhydrase, increase the photosynthesis efficiency, enhance the ability of competing with red tide algae for nutritive salts, and simultaneously increase the allelopathy to red tide algae, thereby effectively improving water quality.

The technical scheme adopted by the invention for realizing the purpose is as follows:

method for improving carbonic anhydrase activity of asparagus by zingeroneUse is provided. Extracellular carbonic anhydrase in macroalgae can catalyze HCO^3-To CO₂Conversion of CO formed₂Then diffused or actively absorbed across the cell membrane; can also catalyze CO in air₂To HCO^3-And then utilized by the seaweed, intracellular carbonic anhydrase being able to catalyze the intracellular pool of inorganic carbon to produce CO for Rubisco supply₂And the photosynthetic carbon fixation capacity is improved. The carbon source for algae photosynthesis in natural water is mainly from CO in air₂The high cell density of algae in red tide results in CO in surface seawater₂The concentration is reduced significantly, leading to an increase in pH, a lower concentration of Dissolved Inorganic Carbon (DIC), and mainly HCO^3-Exist in the form of (1). When the large-scale alga asparagus is used for restoring the eutrophic water body, the zingerone is added, so that the expression of the asparagus carbonic anhydrase gene can be stimulated, the activity of the carbonic anhydrase is improved, the photosynthesis efficiency of the asparagus is improved, the capability of competing with red tide algae for nutrient salt is enhanced, the inhibition rate of the red tide algae is improved, and the efficiency of improving the water quality is improved.

The method for bioremediation of eutrophic seawater adopts combination of asparagus and immobilized composite bacteria to carry out bioremediation on the eutrophic water body, and specifically comprises the following steps:

s1, adding zingerone according to the proportion of 11-13mg/L seawater;

s2, adding asparagus which is cultured for 8-10 days in advance and grows well according to the proportion of 3-4.8g/L seawater, and adding immobilized composite bacteria according to the proportion of 300-500g/L seawater;

s3, adding asparagus for 2-3 days, and adding a regulator according to the proportion of 70-120g/L seawater.

Preferably, the regulator is the sustained-release microsphere.

Preferably, the complex bacteria include nitrifying bacteria, nitrosobacteria, bacillus, and flavobacterium.

Preferably, the preparation method of the immobilized complex bacteria comprises the following steps: respectively taking the bacteria liquid of nitrobacteria, nitrosobacteria, bacillus and flavobacterium which are subjected to enrichment culture, centrifuging, collecting mycelium, and respectively preparing into 1 × 10⁷-1×10⁸Mixing the CFU/mL bacterial suspension in equal proportion, mixing with the acid modified diatomite in a ratio of 2-3:1 (v/m), and oscillating to obtain the immobilized composite bacteria.

Provides the use of stevioside and (2R,3R) -dihydroquercetin in improving allelopathy of Gracilaria verrucosa to red tide algae, wherein the red tide algae comprises Skeletonema costatum.

Provides the application of the biological remediation method of the eutrophic seawater in preventing and treating the red tide.

The invention has the beneficial effects that:

1) the invention provides the sustained-release microspheres for improving the content of polyunsaturated fatty acids in asparagus, so that the asparagus can be improvedKASⅡGene, gene,SADThe transcription level of the gene is obviously improvedFAD2The transcription level of the gene promotes palmitic acid to synthesize stearic acid, promotes stearic acid to desaturate to form oleic acid, promotes oleic acid to further synthesize linoleic acid, and improves the proportion of polyunsaturated fatty acid in fatty acid, so that the allelopathy of the asparagus to red tide algae is improved, and the inhibition rate of the red tide algae is improved;

2) according to the invention, zingerone is added into eutrophic seawater, so that the expression of asparagus carbonic anhydrase genes can be stimulated, the activity of carbonic anhydrase is improved, the photosynthesis efficiency of asparagus is improved, the capability of competing with red tide algae for nutrient salts is enhanced, the inhibition rate of the red tide algae is further improved, and the efficiency of improving water quality is improved.

Drawings

FIG. 1 shows a diagram of the present invention in test example 1CARelative transcription level of the gene;

FIG. 2 shows the carbonic anhydrase activities of the extracellular and intracellular enzymes of test example 1 of the present invention;

FIG. 3 shows the daily specific growth rate of Gracilaria lemaneiformis in test example 1 of the present invention;

FIG. 4 shows a graph of the present invention in test example 2KASⅡGene, gene,SADGene, gene,FAD2Relative transcription level of the gene;

FIG. 5 is a fatty acid component analysis result in test example 2 of the present invention;

FIG. 6 shows the daily specific growth rate of Gracilaria lemaneiformis in test example 3 of the present invention;

FIG. 7 is a drawing showingInhibition ratio, NH, of Skeletonema costatum in test example 3 of the present invention₄ ⁺-N、NO₃ ^--N、NO₂ ^--N、PO₄ ³⁺-P, DIN removal rate.

Detailed Description

The present invention is further described in detail with reference to the following examples:

example 1:

1. a preparation method of sustained-release microspheres comprises the following steps:

1) dissolving 23g of stevioside and 15g of (2R,3R) -dihydroquercetin in 1L of sterile seawater to obtain a mixed solution of the stevioside and the (2R,3R) -dihydroquercetin, dissolving 50g of sodium alginate powder in 1L of sterile seawater to obtain a viscous solution of the sodium alginate, and mixing the two solutions uniformly to obtain a material colloidal solution;

2) dissolving 100g of calcium chloride and 40g of chitosan powder in 5L of 1.2% (m/v) acetic acid solution to prepare stationary liquid;

3) dropwise adding the material colloidal solution in the step 1) into the stationary liquid in the step 2), standing for 50min after dropwise adding is finished to obtain the slow-release microspheres, removing the stationary liquid, washing the slow-release microspheres for 3 times by deionized water, and carrying out vacuum freeze drying.

2. A preparation method of immobilized complex bacteria comprises the following steps:

enrichment medium of nitrifying bacteria: (NH)₄)₂SO₄ 1g；MgSO₄·7H₂O 0.02g；NaH₂PO₄ 0.25g；K₂HPO₄0.75g；MnCl₂ 0.01g；NaHCO₃1g of a compound; aging and filtering 1000mL of seawater, and sterilizing at 121 ℃ for 20 min.

Enrichment medium of nitrifying bacteria: NaNO₂ 0.5g；MgSO₄·7H₂O 0.02g；NaH₂PO4 0.25g；K₂HPO₄0.75g；MnCl₂ 0.01g；Na₂CO₃1g of a compound; aging and filtering 1000mL of seawater, and sterilizing at 121 ℃ for 20 min.

Enrichment culture medium of bacillus and flavobacterium: 20g of commercial bait, aging, filtering seawater, soaking overnight, filtering to remove residues, adding 0.5g of yeast extract, adjusting pH to 7.6, and sterilizing at 121 deg.C for 20 min.

Modification of diatomite: selecting 80-mesh diatomite, soaking in 5% hydrochloric acid for 2h, washing with distilled water to neutrality, soaking in 5% sodium hydroxide for 2h, washing with distilled water to neutrality, air drying, baking in a muffle furnace at 150 deg.C for 2h, and drying in a dryer.

Respectively inoculating nitrobacteria, nitrosobacteria, Bacillus and Flavobacterium to corresponding enrichment culture medium, shake culturing at 28 deg.C for 3d at 150r/min, centrifuging, collecting mycelium, and respectively preparing into 1 × 10⁸Mixing the CFU/mL bacterial suspension in equal proportion, mixing with the acid modified diatomite in a ratio of 2:1 (v/m), and oscillating to obtain the immobilized composite bacteria.

3. A bioremediation method of eutrophic water comprises the following steps:

water sample collection: and collecting a eutrophic sea water sample, and determining the water sample index according to the ocean survey specification GB/T12763.4-2007. The water sample indexes are as follows: NO₂ ^--N 0.328mg/L，NO₃ ^--N 1.138mg/L，NH₄ ⁺-N 0.267mg/L，PO₄ ^3--P 0.388mg/L。

Culturing microalgae: the skeletonema costatum in the microalgae for the experiment is cultured for 6 days at the temperature of 20 ℃ by using sterilized seawater as a culture medium, wherein the illumination intensity is 4000Lux, the light-dark period is L: D =12h:12 h.

Pre-culturing asparagus: the asparagus used in the experiment is cultured for 10 days at the temperature of 20 ℃ by taking sterilized seawater as a culture medium, the illumination intensity is 4000Lux, the light and dark period is L: D =12h:12h, and healthy algae are selected, surface foreign algae are removed, and the asparagus is washed by a large amount of filtered seawater.

Simulation of red tide algal bloom bioremediation experiment: mixing the culture solution with sterilized seawater, and shaking to obtain culture medium with initial density of 1 × 10⁷cells/mL to obtain a simulated skeletonema costatum algal bloom culture solution, accurately transferring 0.4L to a 1L conical flask which is sterilized at high temperature, adding 4.8mg zingerone, adding 1.6g asparagus and 150g immobilized complex bacteria, culturing at the culture temperature of 20 ℃ and the light intensity of 4000Lux, wherein the light-dark period is L: D =12h:12h, and adding 28g/L buffer bacteria after culturing for 2DReleasing the microspheres, changing water once every 5 days by using collected sterilized seawater, wherein the water change amount is 35%, and co-culturing for 9 days.

Example 2:

a method for enrichment culture of asparagus comprises the following steps:

pro broth composition: n: NaNO₃ 3.5g；P：NaH₂PO₄ 0.2723g；Fe–Solution：Fe(NH₄)₂(SO₄)₂•6H₂O 0.17525g，Na₂EDTA 0.165g；Metal Solution：Na₂EDTA 0.25g，H₃BO₃ 0.285g，FeCl₃•6H₂O 0.0125g，MnCl₂•4H₂O 0.0365g，ZnSO₄•7H₂O 0.0055g，CoCl₂•6H₂O 0.001g；H₂O 640mL。

Preparation of a culture solution A: pro medium was diluted with 100 volumes of seawater, 12mg/L zingerone was added, and HCO was set₃ ^-It was 35 mg/L.

Seawater for culturing thallus Gracilariae is obtained from the vicinity of wharf of Bay island of Jiaozhou, with salinity of 32 and pH of 8.10. Filtering with a filter membrane with the aperture of 0.45 mu m, performing damp-heat sterilization for 20min, and standing and balancing for 24 h.

After the asparagus used in the experiment is cultured in collected seawater for 10 days, healthy algae are selected, surface foreign algae are removed, 1.6g of asparagus is respectively inoculated into a 1L conical flask containing corresponding 0.4L of culture solution A after being washed by a large amount of filtered seawater, and the asparagus is cultured under the conditions that the culture temperature is 20 ℃ and the light intensity is 4000Lux, and the light-dark period is L: D =12h:12 h.

Example 3:

the culture solution A was prepared without adding zingerone, and the rest was completely the same as in example 2.

Example 4:

the zingerone is not added into the simulated skeletonema costatum algal bloom culture solution, and the rest parts are completely consistent with the example 1.

Example 5:

the sustained release microspheres were prepared without adding rebaudioside, and the rest was completely the same as in example 1.

Example 6

The sustained release microspheres were prepared without adding (2R,3R) -dihydroquercetin, and the rest was completely the same as in example 1.

Example 7:

the sustained-release microspheres were prepared without adding rebaudioside and (2R,3R) -dihydroquercetin, and the rest was completely the same as in example 1.

Example 8:

the addition of zingerone to the simulated skeletonema costatum algal bloom culture solution was not performed, and the rest part was completely the same as in example 7.

Test example 1:

1. carbonic Anhydrase (CA) transcript level analysis: taking 18S rDNA as an internal reference, wherein the 18S rDNA primer is as follows:

a forward primer: CCTGAGAGACGGCTACCACATCCA, respectively;

reverse primer: CCACAAAGGCGCCCAACCTGAGAG are provided.

CAThe gene primers are as follows:

a forward primer: AAGTCTCAAATGTCGCTCGCAA, respectively;

reverse primer: TCGGGGAGTGGAAGTGAACATT are provided.

Total RNA of the asparagus cultured in 0d, 1d, 3d and 5d in example 2 and example 3 is extracted and reverse transcribed into cDNA which is used as a template for fluorescence quantitative PCR. The reaction system was 2 XSSYBR Premix Ex Taq 10. mu.L, cDNA 2.0. mu.L, forward and reverse primers 0.5. mu.L each, and RNase-free H2O 7. mu.L. The PCR cycle parameters were: 2min at 95 ℃; 95 ℃ 10s, 58 ℃ 15s, 72 ℃ 20 s; 40 cycles. After the reaction is finished, CT value analysis is carried out, and 2 is adopted^-ΔΔCTThe method determines the relative expression level of each gene.CAThe relative transcription levels of the genes are shown in FIG. 1.

2. Determination of carbonic anhydrase Activity:

2.1 determination of extracellular Carbonic anhydrase Activity: 0.1g (fresh weight) of asparagus cultured in 0d, 1d, 3d and 5d of examples 2 and 3 respectively is cut into small pieces of 0.5cm × 0.5cm and put into a reaction tank, the reaction tank is filled with 3mL of 20mmol/L barbital buffer solution (4 ℃, pH 8.2) of artificial seawater in advance, then 2mL of CO2 saturated distilled water at the same temperature is injected, the time t required for the pH value in the mixed solution to fall from 8.2 to 7.8 is recorded, and the comparison is carried outWithout addition of algal-like t₀. The pH was measured using a digital display pH meter.

2.2 determination of intracellular and extracellular Carbonic anhydrase Activity: 0.1g (fresh weight) of Gracilaria verrucosa cultivated for 3 days in example 2 and example 3 was homogenized thoroughly at 4 ℃ in a tissue grinder containing 4mL of 20mmol/L barbital buffer solution (pH 8.2), 1mL of the homogenate was added to a reaction vessel and mixed well, and the determination method of the extracellular carbonic anhydrase activity was determined. Calculating the intracellular enzyme carbonic anhydrase activity, the carbonic anhydrase activity is expressed as WA:

WA=10×(t₀/t-1)

the extracellular and intracellular enzymes carbonic anhydrase activity are shown in FIG. 2.

3. Determination of growth rate of asparagus: separately, the asparagus cultured for 5 days in example 2 and example 3 was weighed and dried to obtain a fresh weight. The specific daily growth rate of Gracilaria lemaneiformis SGR (%/d) was calculated according to the following formula:

ηSGR=[(ln Wt-ln W₀)/t]×100%

in the formula, W₀Initial fresh weight of asparagus (g) and Wt is fresh weight of asparagus (g) at the time of the experiment till the tth day. The daily specific growth rate of Gracilaria verrucosa is shown in FIG. 3.

As can be seen from FIG. 1, the culture of 1d, 3d, 5d, example 2CAThe relative transcription levels of the genes are obviously higher than those of the gene in example 3; as can be seen from FIG. 2, the extracellular and intracellular enzymes carbonic anhydrase activity of example 2 is significantly higher than that of example 3 when the 1d, 3d and 5d are cultured; as can be seen from FIG. 3, the daily specific growth rate of Gracilaria lemaneiformis in example 2 is significantly higher than that in example 3, which shows that zingerone can stimulate the expression of Gracilaria lemaneiformis carbonic anhydrase gene, improve the activity of extracellular and intracellular carbonic anhydrase, and improve the photosynthesis efficiency of Gracilaria lemaneiformis.

Test example 2:

1. analysis of transcript levels of β -ketoacyl-ACP synthetase II (KAS II), Δ 9-fatty acid dehydrogenase (SAD), and oleate dehydrogenase (FAD 2) genes:

18S rDNA was used as an internal reference, and the 18S rDNA primers were the same as those in test example 1,

KASⅡthe primers for the genes were:

a forward primer: TACTCTCAGACGTACACGC, respectively;

reverse primer: CACTCTGACATCCTGTCTC are provided.

SADThe primers for the genes were:

a forward primer: CATGACTGCTATTCTACCTTCGCT, respectively;

reverse primer: TGAGCTTCTCCTGTGTCGCTTCAC are provided.

FAD2The primers of the target gene segment are as follows:

a forward primer: TGCGTGATCTATCCCCTTGAC, respectively;

reverse primer: CTCCTATGAGTGTACATCC are provided.

Total RNAs of the asparagus cultivated in 2d, 4d, 6d and 8d in examples 1, 4, 5, 6, 7 and 8 were extracted and reverse-transcribed into cDNAs to be used as templates for fluorescence quantitative PCR. The reaction system is Supermix 5. mu.L, cDNA 1. mu.L, forward and reverse primers 1. mu.L each, and RNase-free H2O 3. mu.L. The PCR cycle parameters were: 5min at 95 ℃; 95 ℃ 10s, 55 ℃ 20s, 72 ℃ 20 s; 39 cycles. After the reaction is finished, CT value analysis is carried out, and 2 is adopted^-ΔΔCTThe method determines the relative expression level of each gene.KASⅡGene, gene,SADGene, gene,FAD2The relative transcription levels of the genes are shown in FIG. 4.

2. Fatty acid component analysis: 200g of asparagus cultured in 2d, 4d, 6d and 8d in examples 1, 4, 5, 6, 7 and 8 were harvested, chopped with scissors, and extracted with 95% ethanol by cold immersion 3 times. After recovering ethanol under reduced pressure, the extract was dispersed in water to obtain a suspension, which was extracted with ether 3 times. Mixing the ether extract with methanol and 0.5moL/L H₂SO₄Mixing, placing in 60 deg.C water bath for 3h, and adding NH₃•H₂O neutralization pH = 7. Extracting with n-hexane for 3 times, adding water, back extracting for 2 times, and adding anhydrous Na₂SO₄Drying the organic phase, filtering, recovering n-hexane to obtain an extract, dissolving the extract with diethyl ether, filtering to obtain a filtrate, concentrating to obtain a methyl esterified organic acid sample, and performing chromatographic analysis.

Gas chromatography conditions: quartz capillary column HPFFAP (30m × 0.25mm,0.5m), temperature programmed: from 60 deg.CAt 4 ℃ for min^-1Heating to 150 deg.C, and heating at 6 deg.C for min^-1The temperature was raised to 250 ℃ and maintained for 3 min. The carrier gas is He, the column flow is 1.0 ℃ for min^-1The injection inlet temperature is 250 ℃, and the split ratio is 80: 1. Mass spectrum conditions: interface temperature: 270 ℃; an EI source; the ionization voltage is 70eV, the ion source temperature is 230 ℃, the scanning range is 40-500 um, and the sample injection amount is 1.0 muL. The NIST98 mass spectrometry database was used for retrieval. The relative content of each component is calculated by a chromatographic peak area normalization method. The fatty acid composition analysis results are shown in FIG. 5.

As can be seen from FIG. 4, in the case of culturing for 2d, in each exampleKASⅡGene, gene,SADGene, gene,FAD2No obvious difference in relative transcription level of genes, 4d, 6d and 8d, example 1 and example 4KASⅡGene, gene,SADGene, gene,FAD2The relative transcription level of the gene is obviously higher than that of the genes in example 5, example 6, example 7 and example 8; as can be seen from FIG. 5, the fatty acid compositions in examples were not significantly different when cultured for 2d, and the polyunsaturated fatty acid contents were significantly higher in examples 1 and 4 than in examples 5, 6, 7 and 8 when cultured for 4d, 6d and 8d, which indicates that rebaudioside and (2R,3R) -dihydroquercetin were able to increaseKASⅡ、SADAnd significantly increases the transcription level ofFAD2The transcription level of the gene promotes palmitic acid to synthesize stearic acid, promotes stearic acid to desaturate to form oleic acid, promotes oleic acid to further synthesize linoleic acid, and improves the proportion of polyunsaturated fatty acid in fatty acid.

Test example 3:

setting a blank group: the method of example 1 was followed to obtain a culture of Skeletonema costatum with an initial density of 1X 10 by mixing the culture of Skeletonema costatum with sterilized seawater⁷cells/mL, after shaking well, were cultured alone.

1. Growth rate of asparagus: separately, the asparagus cultured for 9 days in example 1 and example 3 was weighed fresh after the water was drained. The specific daily growth rate of Gracilaria lemaneiformis SGR (%/d) was calculated according to the following formula:

ηSGR=[(ln Wt-ln W₀)/t]×100%

in the formula, W₀Initial fresh weight of asparagus (g) and Wt is fresh weight of asparagus (g) at the time of the experiment till the tth day.

The daily specific growth rate of Gracilaria verrucosa is shown in FIG. 6.

2. Inhibition rate of skeletonema costatum: 0.1mL of culture solution of algal bloom of skeletonema costatum in the simulation of bioremediation 9d in example 1, example 4, example 5, example 6, example 7, and example 8 was collected, fixed in formalin, and counted on a hemocytometer. Inhibition Ratio (IR) calculation formula:

IR(%)=(1-N/N₀)×100%

N₀-cell density of skeletonema costatum in blank group when cultured alone; n-cell density of Skeletonema costatum in treatment group.

3. Monitoring water quality: the water sample indexes of the simulated skeletonema costatum culture fluid after 9d bioremediation in example 1, example 4, example 5, example 6, example 7 and example 8 were measured according to the marine survey code GB/T12763.4-2007. The detection items include NH₄ ⁺-N、NO₃ ^--N、NO₂ ^--N、PO₄ ³⁺And (4) P is measured by adopting a sodium hypobromite oxidation method, a zinc-cadmium reduction method, a diazo-azo method and an ascorbic acid reduction phosphomolybdic blue method respectively. Herein as NH₄ ⁺-N、NO₃ ^--N、NO₂ ^-The sum of-N as Dissolved Inorganic Nitrogen (DIN) in PO₄ ³⁺P as Dissolved Inorganic Phosphorus (DIP).

Removal rate% = [ (ρ)₀V₀-ρ_iV_i)/(ρ₀V₀)]×100%

In the formula, ρ₀Is the initial water concentration, rho_iThe mass concentration of the water sample at day i, V₀Is the initial volume of water, V_iWater volume on day i. Inhibitory rate to Skeletonema costatum, NH₄ ⁺-N、NO₃ ^--N、NO₂ ^--N、PO₄ ³⁺The removal rate of-P, DIN is shown in FIG. 7.

From FIG. 6As can be seen from FIG. 7, the daily specific growth rate of Gracilaria verrucosa in example 1, example 5, example 6 and example 7 is significantly higher than that in example 4 and example 8, and the inhibition rate of Skeletonema costatum, NH, in example 1 is shown₄ ⁺-N、NO₃ ^--N、NO₂ ^--N、PO₄ ³⁺The removal rate of-P, DIN is obviously higher than the inhibition rate of Skeletonema costatum, NH, in example 4, example 5, example 6 and example 7₄ ⁺-N、NO₃ ^--N、NO₂ ^--N、PO₄ ³⁺The removal rate of-P, DIN is significantly higher than that of example 8, which shows that zingerone can improve the photosynthesis efficiency of asparagus, enhance the ability of asparagus to compete with red tide algae for nutritive salt, and further improve the inhibition rate of red tide algae and the efficiency of improving water quality.

As can be seen from fig. 7, the inhibition rate of skeletonema costatum in example 1 is significantly higher than that in examples 5, 6 and 7, and the inhibition rate of skeletonema costatum in example 4 is significantly higher than that in example 8, which indicates that rebaudioside and (2R,3R) -dihydroquercetin can improve the allelopathic effect of gardon asparagus on red tide algae and improve the inhibition rate of red tide algae.

Conventional techniques in the above embodiments are known to those skilled in the art, and therefore, will not be described in detail herein.

The above embodiments are merely illustrative, and not restrictive, and those skilled in the art can make various changes and modifications without departing from the spirit and scope of the invention. Therefore, all equivalent technical solutions also belong to the scope of the present invention, and the protection scope of the present invention should be defined by the claims.

Sequence listing

<110> research institute for marine aquaculture in Zhejiang province

<120> bioremediation technology of eutrophic water body

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cctgagagac ggctaccaca tcca 24

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccacaaaggc gcccaacctg agag 24

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aagtctcaaa tgtcgctcgc aa 22

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcggggagtg gaagtgaaca tt 22

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tactctcaga cgtacacgc 19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cactctgaca tcctgtctc 19

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

catgactgct attctacctt cgct 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgagcttctc ctgtgtcgct tcac 24

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgcgtgatct atccccttga c 21

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcctatgag tgtacatcc 19

Claims (6)

1. The application of zingerone in improving the carbonic anhydrase activity of asparagus is characterized in that: the zingerone is used for preparing a asparagus culture solution A, and the preparation method of the culture solution A comprises the following steps: pro medium was diluted with 100 volumes of seawater, 12mg/L zingerone was added, and HCO was set₃ ^-Is 35 mg/L;

pro broth composition: n: NaNO₃ 3.5g；P：NaH₂PO₄ 0 .2723g; iron solution: fe (NH)₄)₂(SO₄)₂·6H₂O 0.17525g，Na₂0.165 g of EDTA; metal solution: na (Na)₂EDTA 0.25g，H₃BO₃ 0.285g，FeCl₃·6H₂O 0.0125g，MnCl₂· 4H₂O 0.0365g，ZnSO₄·7H₂O 0.0055g，CoCl₂·6H₂O 0.001g；H₂O 640mL；

The salinity of the seawater is 32, the pH value is 8.10, the seawater is filtered by a filter membrane with the aperture of 0.45 mu m, the seawater is sterilized by moist heat for 20min, and the seawater is kept stand and balanced for 24 h;

after the asparagus is cultured in the seawater for 10 days, healthy algae are selected, surface miscellaneous algae are removed, 1.6g of asparagus is respectively inoculated into a 1L conical flask containing 0.4L of corresponding culture solution A after being washed by a large amount of filtered seawater, and the asparagus is cultured under the conditions that the culture temperature is 20 ℃ and the light intensity is 4000Lux, and the light and dark period is L: D: 12 h.

2. A bioremediation method of eutrophic seawater, which is characterized in that: the method adopts the combination of asparagus and immobilized composite bacteria to carry out bioremediation on the eutrophic seawater, and specifically comprises the following steps:

s1, collecting a eutrophic sea water sample, wherein the water sample indexes are as follows: NO₂ ^--N 0 .328mg/L，NO₃ ^--N 1 .138mg/L，NH₄ ⁺-N 0.267mg/L，PO₄ ^3--P 0.388mg/L；

S2, microalgae culture: culturing skeletonema costatum in microalgae at 20 deg.C for 6D with sterilized seawater as culture medium under illumination intensity of 4000Lux and light-dark period of L: D: 12 h;

s3, pre-culturing asparagus: culturing thallus Gracilariae with sterilized seawater as culture medium at illumination intensity of 4000Lux and light-dark period of L: D: 12h at 20 deg.C for 10D, selecting healthy algae, removing surface impurity algae, and washing with large amount of filtered seawater;

s4, simulation of red tide algal bloom bioremediation experiment: mixing the middle costal streak algae liquid with good growth condition and index growth period with sterilized seawater, shaking thoroughly,the initial density of Skeletonema costatum is 1 × 10⁷cells/mL to obtain a simulated skeletonema costatum algal bloom culture solution, accurately transferring 0.4L to a 1L conical flask which is sterilized at high temperature, adding 4.8mg zingerone, adding 1.6g asparagus and 150g immobilized compound bacteria, culturing at the culture temperature of 20 ℃ and the light intensity of 4000Lux, wherein the light-dark period is L: D: 12h, adding 28g/L slow release microspheres after culturing for 2D, changing water by collected sterilized seawater once every 5 days, changing the water amount to 35%, and co-culturing for 9D.

3. The bioremediation method of claim 2, wherein: the preparation method of the sustained-release microspheres comprises the following steps:

a. dissolving stevioside and (2R,3R) -dihydroquercetin in sterile seawater to obtain mixed solution, dissolving sodium alginate powder in sterile seawater to obtain sodium alginate viscous solution, and mixing to obtain material colloid solution;

b. dissolving calcium chloride and chitosan powder in 1-1.3% acetic acid solution to obtain fixing solution with calcium chloride concentration of 1.8-2.2% and chitosan concentration of 0.6-1.1%;

c. dropwise adding the material colloidal solution in the step a into the stationary liquid in the step b, standing for 40-60min after dropwise adding is finished to obtain slow-release microspheres, removing the stationary liquid, washing the slow-release microspheres with deionized water, and performing vacuum freeze drying to obtain finished products;

the mass fraction of the stevioside in the slow release microspheres is 1-1.2%, the mass fraction of the (2R,3R) -dihydroquercetin is 0.6-0.8%, and the mass fraction of the sodium alginate is 2-3%.

4. The bioremediation method of claim 2, wherein: the immobilized complex bacteria comprise nitrifying bacteria, nitrosobacteria, bacillus and flavobacterium.

5. The bioremediation method of claim 4, wherein: the preparation method of the immobilized composite bacteria comprises the following steps: respectively taking nitrifying bacteria subjected to enrichment culture,The bacterial liquid of nitrosobacteria, bacillus and flavobacterium is centrifuged, and the mycelium is collected and prepared into 1 × 10⁷-1×10⁸And mixing the CFU/mL bacterial suspension in equal proportion, mixing the mixture with acid modified diatomite according to the volume-mass ratio of 2-3:1, and oscillating to obtain the immobilized composite bacteria.

6. Use of a method of bioremediation of eutrophic seawater as set forth in any one of claims 2 to 5 for the prevention and treatment of red tides.

Images