CN111471736A - Method for preparing C1, 2-dehydrogenation steroid compound - Google Patents

Abstract

The invention provides a method for preparing a C1, 2-dehydrogenation steroid compound, which comprises the following steps: constructing an expression vector for expressing the recombinant KstD enzyme, wherein the amino acid sequence of the recombinant KstD enzyme is SEQ ID.3; expressing the recombinant KstD enzyme by using the expression vector and a cell culture mode to obtain a crude enzyme solution; adding a substrate androst-4-ene-3, 17-dione (4-AD) into the crude enzyme solution, and reacting to obtain the C1, 2-dehydrosteroid compound. The invention obtains a soluble KstD fusion enzyme by modifying the KstD211 enzyme of mycobacterium HGMS 2; the KstD fusion enzyme is prepared by utilizing the KstD fusion enzyme efficiently expressed by recombinant escherichia coli and adopting high-density fermentation, and the specific enzyme activity reaches 31.6U/mg.

Description

Method for preparing C1, 2-dehydrogenation steroid compound

Technical Field

The invention relates to the field of biochemistry, in particular to a method for preparing a C1, 2-dehydrogenation steroid compound.

Background

Steroid hormone drugs are clinically important drugs, have particularly significant anti-inflammatory activity, and are widely used for preventing and treating various diseases. In addition, changes in the steroid parent nucleus structure may lead to more potent steroid drugs. For example, when unsaturation is introduced into the 1, 2-position of Hydrocortisone Acetate (HA) by Δ 1-dehydrogenation, the anti-inflammatory activity of the product Prednisolone Acetate (PA) increases three to four times. However, due to the complexity of the steroid structure, the conventional chemical method is difficult to specially modify the steroid intermediate, and the chemical method has the defects of low conversion rate, more byproducts, environmental pollution and the like. Thus, enzymatic conversion has attracted much attention due to its mild reaction conditions, high efficiency and specificity (regioselectivity and stereoselectivity). Today, enzymatic conversion technology has proven to be a new, efficient and economical method for the production of new steroid drugs and active pharmaceutical ingredients.

The 3-ketosteroid-delta 1-dehydrogenase (KstD) catalyzes the dehydrogenation of androstenedione (4-AD) at C1,2 position to form 1, 4-Androstenedione (ADD) (FIG. 1). ADD, converted from 4-AD, is an important precursor for the synthesis of high-end steroid drugs, such as contraceptives, estrogens and progestins. Although chemical dehydrogenation processes have been used in the steroid pharmaceutical industry, enzymatic processes are highly efficient, produce no byproduct build-up, and produce high product purity, as compared to multi-step chemical synthesis of hormone synthesis, and thus the development of "green" highly efficient enzymatic methods for the preparation of steroid intermediates by heterologous expression of KstD has now begun to be of interest. M. smegmatis mc²155 MstKstD 1 can lead to a cortisol yield of 90% in 3 hours at a concentration of 6 g/L KstD2 of M.neoformans DSM 1381 can lead to almost complete conversion of 30 g/L4-AD, but the low substrate concentrations and low conversion rates mentioned above limit the industrial application of the KstD enzyme process.

The KstD enzymatic reaction belongs to redox reaction, and 3-sterone-1, 2-dehydrogenase (KstD) is a flavoprotein dependent dehydrogenase which takes Flavin Adenine Dinucleotide (FAD) as a cofactor in the catalytic reaction process and can catalyze the dehydrogenation of a carbon-carbon single bond (C-C) at the 1,2 position of the A ring of a 3-sterone mother nucleus into a carbon-carbon double bond (C ═ C). The cost of industrially regenerating coenzyme FAD is very high, and the development of efficient and inexpensive electron acceptors or the opening of efficient and inexpensive coenzyme regeneration systems is required, which is a key technology limiting the industrial application of the KstD enzyme process.

KstD is an inducible enzyme and is also a membrane protein. Although many examples of heterologous expression are provided, membrane proteins mostly exist in the form of inclusion bodies due to the poor solubility of the membrane proteins, and a technical problem to be solved in the industrial application is urgently needed.

The KstD enzymes from different microorganisms have different specificities for steroid substrates, because the amino acid sequences of proteins of different KstD have differences, which determine their conformational differences in local regions, and the screening or designing of KstD enzymes with substrate specificity, or the screening of a KstD enzyme with a large number of substrates in common, is also a key requirement for the industrialization of steroid enzyme processes.

Disclosure of Invention

In order to solve the above problems, the present invention provides a method for preparing C1, 2-dehydrosteroid compounds, comprising: constructing an expression vector for expressing the recombinant KstD enzyme, wherein the amino acid sequence of the recombinant KstD enzyme is SEQ ID.3; expressing the recombinant KstD enzyme by using the expression vector and a cell culture mode to obtain a crude enzyme solution; adding a substrate androst-4-ene-3, 17-dione (4-AD) into the crude enzyme solution, and reacting to obtain the C1, 2-dehydrosteroid compound.

In the above method, further comprising: before the reaction, adding electron acceptor menadione into the crude enzyme solution, wherein the mass concentration of the electron acceptor menadione in the reaction solution is less than or equal to 1%.

The method further comprises adding catalase to the crude enzyme solution before the reaction, wherein the concentration of the catalase in the reaction solution is less than or equal to 100U/L.

In the above method, wherein the recombinant KstD enzyme has Maltose Binding Protein (MBP) bound to the N-terminus or C-terminus.

The invention obtains a recombinant KstD fusion enzyme by modifying the KstD211 enzyme of mycobacterium HGMS 2; the KstD fusion enzyme is prepared by utilizing the KstD fusion enzyme efficiently expressed by recombinant escherichia coli and adopting high-density fermentation, and the specific enzyme activity reaches 31.6U/mg.

The soluble MBP/KstD fusion protein is formed by fusing MBP protein at the N terminal or C terminal of the KstD211, so as to enhance the solubility of the KstD protein, thereby solving the problem of the solubility of the enzyme. MBP can be placed either N-or C-terminal to the KstD, without altering KstD725 activity.

The method comprises the steps of optimizing the type and the using amount of an electron acceptor in KstD fusion enzyme reaction, performing low-cost and high-efficiency regeneration circulation on coenzyme, and establishing a process for converting androstenedione (4-AD) into 1, 4-Androstenedione (ADD) by using the fusion enzyme, wherein 10 g/L4-AD is used as a raw material, the KstD fusion enzyme is used for converting 4-AD, the conversion rate is more than 98%, a KstD fusion enzyme catalytic system is amplified and optimized, 80 g/L4-AD is used as a raw material in a 15L reaction kettle, the conversion rate is more than 97%, the refined purity can reach more than 99.5%, and large-scale high-efficiency conversion from 4-AD to ADD is realized in the 15-ton reaction kettle, the substrate concentration is as high as 80-100 g L^-1The conversion rate reaches 98%, and the product is single without other impurities. The enzymatic conversion of the invention has the unique advantages of high efficiency, specificity, mildness and the like. The fusion enzyme of the invention is also suitable for producing other steroid drug intermediates with high value by high-efficiency conversion.

Drawings

FIG. 1 shows that 3-ketosteroid-. DELTA.1-dehydrogenase catalyzes the dehydrogenation of 4-AD to ADD.

FIG. 2 shows SDS-PAGE analysis comparing expression of soluble KstD enzyme. a) Unfused KstD expression, 1,2 are supernatant and pellet induced for 10 h; 3. 4 is the supernatant and pellet induced for 20 h. b) The fusion protein expresses MBP-KstD, 5 and 6 are supernatant and sediment which are induced for 10 hours; 7.8 is the supernatant and pellet induced for 20 h.

FIG. 3 shows the curves of the process of fed-batch fermentation of recombinant E.coli, xxx, XX, OD600nm, ★ - ★, dissolved oxygen, ● - ●, temperature, ◆ - ◆, pH, ■ - ■, rotation speed.

FIG. 4 shows the preparation of the KstD enzyme by high density fermentation. M: a protein Marker; 1, crude enzyme liquid supernatant is carried out for-10 hours; 2: precipitating the crude enzyme solution for-10 h; 3: supernatant of the crude enzyme solution is-12 h; 4: precipitating the crude enzyme solution for-12 h; 5: supernatant of the crude enzyme solution is-20 h; 6: the crude enzyme solution is precipitated for-20 h.

FIG. 5 shows a schematic representation of the coupled C1, 2-dehydrogenase coenzyme regeneration system.

FIG. 6 shows the effect of different coenzyme regeneration systems on conversion.

FIG. 7 shows thin layer chromatography (T L C) analysis of ADD reaction generated by converting 4-AD with recombinant KstD enzyme, 1:4-AD standard, 2, 3, 4, 5 represent the products of 6h, 12h, 18h, 24h enzyme reaction, respectively.

FIG. 8 shows the reaction of HP L C to analyze the conversion of recombinant KstD enzyme into 4-AD to produce ADD, a) a table sample of 4-AD, b) a standard sample of ADD, and C) a reaction solution catalyzed by KstD.

Detailed Description

The following examples are presented to enable those skilled in the art to more fully understand the present invention and are not intended to limit the invention in any way.

The present application carried out whole genome sequencing (Genbank ID: CP031414.1) on 4-AD industrial production strain Mycobacterium HGMS2, and identified unique KstD enzyme gene from HGMS2 strain, named KstD211(SEQ ID NO.1) and amino acid sequence (SEQ ID NO. 2).

The invention clones, expresses, analyzes and transforms the KstD enzyme gene of the mycobacterium HGMS 2. The invention constructs an expression vector of escherichia coli, introduces the cloned KstD gene into the escherichia coli through a pRSV expression vector for induction expression, and characterizes the enzyme specificity and selectivity.

Previous studies have shown that the highest activity of recombinant KstD in E.coli expression systems is only 6U/mg. By comparing the amino acid sequences of the KstD211 and other mycobacteria KstD, the invention carries out sequence modification and optimal design on the KstD211 to obtain the KstD725 mutant with high activity. The KstD725 mutant has the amino acid sequence of SEQ ID NO.3. the DNA sequence coding the KstD725 mutant is optimized by the preferred codon of Escherichia coli, is suitable for efficient expression of Escherichia coli, and has the DNA sequence of SEQ ID.4.

KstD belongs to a membrane-bound enzyme protein and has low solubility. Previous studies have shown that the KstD gene obtained from rhodococcus sp SQ1 can be expressed in e.coli expression systems, but KstD has low solubility, only a small fraction of which is soluble and active, mainly in the form of inclusion bodies. In order to overcome the problem of low solubility of membrane proteins, the invention adopts a fusion expression strategy to fuse MBP protein at the N terminal or C terminal of KstD to form soluble MBP/KstD fusion protein, and the solubility of the KstD protein can be enhanced in the expression process, thereby solving the problem of enzyme solubility. MBP can be placed either N-terminal or C-terminal to KstD725, without altering KstD725 activity. This is also necessary for large scale enzymatic reactions. Then, it is overexpressed.

The invention utilizes the MBP/KstD fusion protein efficiently expressed by recombinant escherichia coli, prepares the fusion KstD enzyme by high-density fermentation, and the specific activity of the enzyme reaches 31.6U/mg after purification.

The invention optimizes the proportion of electron acceptors, regenerates the coenzyme system with low cost and high efficiency, utilizes the MBP/KstD725 fusion enzyme in vitro enzyme conversion method in a shake flask, takes 10 g/L4-AD as raw materials, and realizes the conversion rate of more than 98 percent.

According to the invention, by amplifying and optimizing an MBP/KstD725 fusion enzyme catalysis system, 80 g/L4-AD is taken as a raw material in a 15L reaction kettle, the conversion rate is more than 97%, and the purity after refining can reach more than 99.5%.

The invention realizes large-scale high-efficiency conversion from 4-AD to ADD in a 15-ton reaction kettle by using an MBP/KstD725 fusion enzyme in-vitro enzyme conversion method, wherein the concentration of a substrate is as high as 80-100 g L^-1The conversion rate reaches 98%, and the product is single without other impurities. The enzymatic conversion of the invention has the unique advantages of high efficiency, specificity, mildness and the like, and is a new technology in steroid biotransformation. The MBP/KstD725 fusion enzyme is also suitable for efficiently converting and producing other steroid drug intermediates with high value, and indicates a new direction for the development of steroid drug industry, and the enzyme conversion process of the invention reaches the requirements of industrialized production. The present invention utilizes a form of fusion expression to increase the solubility of KstD as well as the stability of expression. A soluble protein MBP, i.e. MBP-KstD, is linked to the N-terminus of KstD.

Therefore, the research provides an economic and environment-friendly method and a technical process for the biosynthesis of the steroid drug C1,2 dehydrogenation.

The following description will be given with reference to specific examples.

Example 1 construction and shake flask expression of recombinant KstD fusion enzyme plasmids:

coli B L21 (DE3) cells containing the recombinant plasmid were cultured in L B medium containing 35. mu.g/ml kanamycin and rotated at 200rpm at 37 ℃ when OD600nm reached 0.8, 0.4mM isopropyl- β -D-thiogalactopyranoside (final concentration) was added, the culture temperature was decreased to 20 ℃ and the culture was continued for 18-20 hours, and the expression of soluble target enzyme protein was significantly increased as found by SDS-PAGE gel (FIG. 2).

Example 2, high density fermentation preparation of KstD fusion enzyme:

in order to obtain a high-density cell culture with a large amount of enzyme, a high-density medium was optimized, cells were cultured in a 15L fermenter, and some modifications were made, such as replacement of glucose by glycerol, yeast powder as a nitrogen source, induction by lactose, etc., at the start of fermentation, the temperature of the fermenter was controlled at 37 ℃ to allow rapid growth of the cells, in a fed-batch phase, dissolved oxygen was controlled at 10% to 30%, and pH was controlled at 6.2 to 7.8, before the induction phase, the cell culture temperature was lowered to 20 ℃ and maintained for a certain period of time, and then lactose mother liquor was added until the final concentration reached 0.4mM, and the induction time was 18h to 20h to induce protein expression, after fermentation, escherichia coli cells were collected by centrifugation at 4 ℃, resuspended in 50mM Tris-HCl buffer (pH8.0), the suspension was disrupted by a high-pressure homogenizer at conditions of 5 ℃ or less and 1200bar, 3 cycles were performed to obtain a crude enzyme solution, after centrifugation at 4 ℃ and 6000r/min, the cell debris was removed, and then the crude enzyme solution was temporarily applied as a solid, and the enzyme was used as an enzyme-reduced.

The method comprises the steps of optimizing a high-density fermentation formula, performing high-density fermentation on recombinant escherichia coli in a fermentation tank of 15L by adopting a fed-batch fermentation mode, wherein the liquid loading amount is 10L culture medium, performing high-temperature sterilization at 121 ℃, performing inoculation for 30min when the temperature is reduced to 37 ℃, and starting fermentation by using 5% of inoculation amount, wherein the change of temperature, dissolved oxygen and pH in the whole fermentation process is shown in figure 3. from the figure, the dissolved oxygen is reduced to the minimum 5h after inoculation, then the dissolved oxygen is increased back, feeding is started, the dissolved oxygen is maintained in a certain fluctuation range (20% -30%) in the feeding process, the fermentation is started to reduce the temperature for 16h, and the inducing liquid is supplemented at a low temperature, the feeding speed is correspondingly reduced during the induction phase, the lower growth speed of the thalli is maintained, the normal expression of protein is ensured, the fluctuation of the pH is not large in the whole fermentation process, the feeding speed is not large from 7.2 at the beginning of the fermentation to 6.7 at the end, the feeding process is not supplemented with acid or alkali to adjust pH. in the whole feeding process, namely, the feeding speed is reduced, the feeding is maintained, the feeding process, the feeding speed is maintained, the feeding is maintained at a constant, the feeding speed when the feeding process, the pH is maintained after the pH is increased, the pH is maintained, the pH is increased, the pH is maintained by adopting the pH during the pH is maintained, the pH is maintained by adopting the pH during the pH adjustment process, the low-constant, the feeding process, the pH adjustment process, the feeding.

Example 3 KstD fusion enzyme Activity

Taking the appropriate amount of 2.3 centrifuged supernatant, Mbp-KstD2 was washed at 30 ℃ with Nano Drop 2000 spectrophotometer (Thermo Scientific) at 600nm (ξ 600nm ═ 18.7 × 103)

cm-1M-1) using Phenazine Methosulfate (PMS) and 2, 6-dichlorophenol-benzenediol (DCPIP). The reaction mixture (1ml) consisted of 50mM Tris-HCl buffer (pH 7.0), 150mM PMS, 8mM DCPIP, a suitable concentration of supernatant or cell extract and 100mM AD methanol. Activity is expressed in units per mg protein; 1U is defined as a 1 μmolmin-1DCPIP reduction. No activity was detected in the reaction mixture without 4-androstenone-3, 17-dione (AD). The remaining supernatant was analyzed by SDS-PAGE using 8% separation gel and 5% stacking gel to identify whether the protein was expressed correctly. Protein expression in the fermentor is shown in FIG. 4.

Example 4 enzymatic regeneration of circulating KstD fusion enzyme cofactor

As shown in FIG. 5, normally, in the KstD enzymatic Δ 1-dehydrogenation reaction, KstD, after removing two hydrogens from the substrate, passes to molecular oxygen, which is used as a hydrogen acceptor, producing hydrogen peroxide (H)₂O₂) The coenzyme regeneration thus forms a cyclic process. After dissolved oxygen in the reaction system is exhausted, the reaction is immediately terminated, and the generated hydrogen peroxide can also influence the enzyme activity.

In the invention, the enzyme conversion system is optimized and adjusted, and we find for the first time that the conversion rate of a substrate can be improved greatly by adding a small amount of catalase into the enzyme conversion system. The catalase can promote hydrogen peroxide to be decomposed to generate water and oxygen, so that the toxic effect of the hydrogen peroxide is reduced, the dissolved oxygen in the system is increased, and meanwhile, the dissolved oxygen is supplemented in the enzyme catalysis reaction system to prevent the reaction from slowing down or stopping due to insufficient dissolved oxygen.

Example 5 Shake flask KstD fusion enzyme transformation 4-AD reaction Process

Androst-4-ene-3, 17-dione (4-AD) powder was put into 50mM ofTris-HCl buffer (pH8.0) to prepare a 10% concentration, and emulsified for 2 hours with a homogenizer (to prevent generation of a large amount of bubbles, a small amount of antifoaming agent may be added) to reduce 4-AD particles, and uniformly dispersed in a buffer to prepare a substrate emulsion. The enzyme activity test was carried out as described above for the enzyme-catalyzed reaction. The high-density fermented cells were resuspended in Tris-HCl buffer (Ph8.0), and disrupted by a high-pressure homogenizer to obtain a crude enzyme solution.

The volume of the enzyme catalysis is 100ml, and the reaction is carried out according to 1 percent of feeding amount. 50ml of crude enzyme solution was weighed into a 250ml shake flask, and 25ml of 4-AD (about 1g) emulsion and 25ml of Tris-HCl buffer solution were added to conduct a coenzyme factor regeneration system experiment, and the different systems are shown in Table 1.

TABLE 1

The reaction mixture was placed in a shaker, shaken at 30 ℃ and 200rpm for reaction, samples were taken at reaction time 20, extracted with ethyl acetate, centrifuged, the extracted reaction solution was evaporated to dryness with ethyl acetate, 100 μ L of methanol to water to 6:4 mobile phase solution was added to dissolve the reactants, HP L C analysis was performed, the mobile phase was methanol to water to 6:4, the 4-AD conversion was calculated from the analysis results, as shown in fig. 6, different cofactor regeneration systems affected the conversion differently, and the conversions of systems 2,6, 7, 8 all reached more than 97%.

Example 6 reaction Process for conversion of Pilot-plant KstD fusion enzyme to 4-AD

The amplification experiment was continued to perform the enzymatic conversion test of the kilogram-level substrate, the experiment was performed in a 15L reaction kettle with a total reaction volume of 10L, again at a 10% substrate concentration (i.e. 1Kg input), the reaction conditions were the same as in the shake flask, the coenzyme factor regeneration system employed system 8, samples were taken at 6h, 12h, 18h, and 24h of reaction, respectively, extracted with ethyl acetate, centrifuged, the supernatant was dipped with ethyl acetate by a capillary tube to spot the plate, the silica gel plate was placed in a developing solvent (V petroleum ether/V ethyl acetate 5:3), the solvent was taken out and blown dry after the solvent climbed to two thirds of the silica gel plate, and then the silica gel plate was placed under 254nm uv illumination, with the results shown in fig. 7.

EXAMPLE 7 Large Scale KstD fusion enzyme conversion 4-AD reaction Process

According to the optimized enzyme catalysis system, a high-concentration substrate enzyme conversion production test is carried out, the test is carried out in a 15-ton reaction kettle, the total reaction volume is 10 tons, the same 10% substrate concentration (namely 1 ton of feeding amount) is carried out, the reaction conditions are the same as the pilot test conditions, sampling is carried out when the reaction is carried out for 24 hours, ethyl acetate is used for extraction, centrifugation is carried out, the supernatant ethyl acetate is dipped by a capillary tube for carrying out T L C point plate detection reaction process, HP L C detection is further carried out, the refining process can be carried out after the conversion rate reaches more than 97%, and the reaction is stopped after the reaction is carried out for 20-24 hours as shown in figure 8.

Those skilled in the art will appreciate that the above embodiments are merely exemplary embodiments and that various changes, substitutions, and alterations can be made without departing from the spirit and scope of the application.

Sequence listing

<110> Wuhan Emersaka Biotech Co., Ltd

<120> method for preparing C1, 2-dehydrosteroid compound

<130>HP190991LZ

<141>2020-04-22

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1692

<212>DNA

<213> Mycobacterium HGMS2()

<400>1

atgactgaac aggactacag tgtctttgac gtagtggtgg tagggagcgg tgctgccggc 60

atggtcgccg ccctcaccgccgctcaccag ggactctcga cagtagtcgt tgagaaggct 120

ccgcactatg gcggttccac ggcgcgatcc ggcggcggcg tgtggattcc gaacaacgag 180

gttctgcagc gtgacggggt caaggacacc cccgccgagg cacgcaaata cctgcacgcc 240

atcatcggcg atgtggtgcc ggccgagaag atcgacacct acctggaccg cagtccggag 300

atgttgtcgt tcgtgctgaa gaactcgccg ctgaagctgt gctgggttcc cggctactcc 360

gactactacc cggagacgcc gggcggtaag gccaccggcc gcttggtcga gcccaagccg 420

ttcaatgcca agaagctcgg tcccgacgag aagggcctcg aaccgccgta cggcaaggtg 480

ccgctgaaca tggtggtgct gcaacaggac tatgtccggc tcaaccagct caagcgtcac 540

ccgcgcggcg tgctgcgcag catcaaggtg ggtgtgcggt cggtgtgggc caacgccacc 600

ggcaagaacc tggtcggtat gggccgggcg ctgatcgcgc cgctgcgcat cggcctgcag 660

aaggccgggg tgccggtgct gttgaacacc gcgctgaccg acctgtacct cgaggacggg 720

gtggtgcgcg gaatctacgt tcgcgaggcc ggcgcccccg agtctgccga gccgaagctg 780

atccgagccc gcaagggcgt gatcctcggt tccggtggct tcgagcacaa ccaggagatg 840

cgcaccaagt atcagcgcca gcccatcacc accgagtgga ccgtcggcgc agtggccaac 900

accggtgacg gcatcgtggc ggccgaaaag ctcggtgcgg cattggagct catggaggac 960

gcgtggtggg gaccgaccgt cccgctggtg ggcgccccgt ggttcgccct ctccgagcgg 1020

aactcccccg ggtcgatcat cgtcaacatg aacggcaagc ggttcatgaa cgaatcgatg 1080

ccctatgtgg aggcctgcca ccacatgtac ggcggtcagt acggccaagg tgccgggcct 1140

ggcgagaacg tcccggcatg gatggtcttc gaccagcagt accgtgatcg ctatatcttc 1200

gcgggattgc agcccggaca acgcatcccg aagaaatgga tggaatcggg cgtcatcgtc 1260

aaggccgaca gcgtggccga gctcgccgag aagaccggtc ttgcccccga cgcgctgacg 1320

gccaccatcg aacggttcaa cggtttcgca cgttccggcg tggacgagga cttccaccgt 1380

ggcgagagcg cctacgaccg ctactacggt gatccgacca acaagccgaa cccgaacctc 1440

ggcgagatca agaacggtcc gttctacgcc gcgaagatgg tacccggcga cctgggcacc 1500

aagggtggca tccgcaccga cgtgcacggc cgtgcgttgc gcgacgacaa ctcggtgatc 1560

gaaggcctct atgcggcagg caatgtcagc tcaccggtga tggggcacac ctatcccggc 1620

ccgggtggca caatcggccc cgccatgacg ttcggctacc tcgccgcgtt gcatctcgct 1680

ggaaaggcct ga 1692

<210>2

<211>563

<212>PRT

<213> Mycobacterium HGMS2()

<400>2

Met Thr Glu Gln Asp Tyr Ser Val Phe Asp Val Val Val Val Gly Ser

1 5 10 15

Gly Ala Ala Gly Met Val Ala Ala Leu Thr Ala Ala His Gln Gly Leu

20 25 30

Ser Thr Val Val Val Glu Lys Ala Pro His Tyr Gly Gly Ser Thr Ala

35 40 45

Arg Ser Gly Gly Gly Val Trp Ile Pro Asn Asn Glu Val Leu Gln Arg

50 55 60

Asp Gly Val Lys Asp Thr Pro Ala Glu Ala Arg Lys Tyr Leu His Ala

65 70 75 80

Ile Ile Gly Asp Val Val Pro Ala Glu Lys Ile Asp Thr Tyr Leu Asp

85 90 95

Arg Ser Pro Glu Met Leu Ser Phe Val Leu Lys Asn Ser Pro Leu Lys

100 105 110

Leu Cys Trp Val Pro Gly Tyr Ser Asp Tyr Tyr Pro Glu Thr Pro Gly

115 120 125

Gly Lys Ala Thr Gly Arg Leu Val Glu Pro Lys Pro Phe Asn Ala Lys

130 135 140

Lys Leu Gly Pro Asp Glu Lys Gly Leu Glu Pro Pro Tyr Gly Lys Val

145 150 155 160

Pro Leu Asn Met Val Val Leu Gln Gln Asp Tyr Val Arg Leu Asn Gln

165 170 175

Leu Lys Arg His Pro Arg Gly Val Leu Arg Ser Ile Lys Val Gly Val

180 185 190

Arg Ser Val Trp Ala Asn Ala Thr Gly Lys Asn Leu Val Gly Met Gly

195 200 205

Arg Ala Leu Ile Ala Pro Leu Arg Ile Gly Leu Gln Lys Ala Gly Val

210215 220

Pro Val Leu Leu Asn Thr Ala Leu Thr Asp Leu Tyr Leu Glu Asp Gly

225 230 235 240

Val Val Arg Gly Ile Tyr Val Arg Glu Ala Gly Ala Pro Glu Ser Ala

245 250 255

Glu Pro Lys Leu Ile Arg Ala Arg Lys Gly Val Ile Leu Gly Ser Gly

260 265 270

Gly Phe Glu His Asn Gln Glu Met Arg Thr Lys Tyr Gln Arg Gln Pro

275 280 285

Ile Thr Thr Glu Trp Thr Val Gly Ala Val Ala Asn Thr Gly Asp Gly

290 295 300

Ile Val Ala Ala Glu Lys Leu Gly Ala Ala Leu Glu Leu Met Glu Asp

305 310 315 320

Ala Trp Trp Gly Pro Thr Val Pro Leu Val Gly Ala Pro Trp Phe Ala

325 330 335

Leu Ser Glu Arg Asn Ser Pro Gly Ser Ile Ile Val Asn Met Asn Gly

340 345 350

Lys Arg Phe Met Asn Glu Ser Met Pro Tyr Val Glu Ala Cys His His

355 360 365

Met Tyr Gly Gly Gln Tyr Gly Gln Gly Ala Gly Pro Gly Glu Asn Val

370375 380

Pro Ala Trp Met Val Phe Asp Gln Gln Tyr Arg Asp Arg Tyr Ile Phe

385 390 395 400

Ala Gly Leu Gln Pro Gly Gln Arg Ile Pro Lys Lys Trp Met Glu Ser

405 410 415

Gly Val Ile Val Lys Ala Asp Ser Val Ala Glu Leu Ala Glu Lys Thr

420 425 430

Gly Leu Ala Pro Asp Ala Leu Thr Ala Thr Ile Glu Arg Phe Asn Gly

435 440 445

Phe Ala Arg Ser Gly Val Asp Glu Asp Phe His Arg Gly Glu Ser Ala

450 455 460

Tyr Asp Arg Tyr Tyr Gly Asp Pro Thr Asn Lys Pro Asn Pro Asn Leu

465 470 475 480

Gly Glu Ile Lys Asn Gly Pro Phe Tyr Ala Ala Lys Met Val Pro Gly

485 490 495

Asp Leu Gly Thr Lys Gly Gly Ile Arg Thr Asp Val His Gly Arg Ala

500 505 510

Leu Arg Asp Asp Asn Ser Val Ile Glu Gly Leu Tyr Ala Ala Gly Asn

515 520 525

Val Ser Ser Pro Val Met Gly His Thr Tyr Pro Gly Pro Gly Gly Thr

530 535540

Ile Gly Pro Ala Met Thr Phe Gly Tyr Leu Ala Ala Leu His Leu Ala

545 550 555 560

Gly Lys Ala

<210>3

<211>515

<212>PRT

<213> Artificial sequence ()

<400>3

Met Thr Glu Gln Asp Tyr Ser Val Phe Asp Val Val Val Val Gly Ser

1 5 10 15

Gly Ala Ala Gly Met Val Ala Ala Leu Thr Ala Ala His Gln Gly Leu

20 25 30

Ser Thr Val Val Val Glu Lys Ala Pro His Tyr Gly Gly Ser Thr Ala

35 40 45

Arg Ser Gly Gly Gly Val Trp Ile Pro Asn Asn Glu Val Leu Gln Arg

50 55 60

Asp Gly Val Lys Asp Thr Pro Ala Glu Ala Arg Lys Tyr Leu His Ala

65 70 75 80

Ile Ile Gly Asp Val Val Pro Ala Glu Lys Ile Asp Thr Tyr Leu Asp

85 90 95

Arg Ser Pro Glu Met Leu Ser Phe Val Leu Lys Asn Ser Pro Leu Lys

100 105 110

Leu Cys Trp Val Pro Gly Tyr Ser Asp Tyr Tyr Pro Glu Thr Pro Gly

115 120 125

Gly Lys Ala Thr Gly Arg Ser Val Glu Pro Lys Pro Phe Asn Ala Lys

130 135 140

Lys Leu Gly Pro Asp Glu Lys Gly Leu Glu Pro Pro Tyr Gly Lys Val

145 150 155 160

Val Trp Ala Asn Ala Thr Gly Lys Asn Leu Val Gly Met Gly Arg Ala

165 170 175

Leu Ile Ala Pro Leu Arg Ile Gly Leu Gln Lys Ala Gly Val Pro Val

180 185 190

Leu Leu Asn Thr Ala Leu Thr Asp Leu Tyr Leu Glu Asp Gly Val Val

195 200 205

Arg Gly Ile Tyr Val Arg Glu Ala Gly Ala Pro Lys Leu Ile Arg Ala

210 215 220

Arg Lys Gly Val Ile Leu Gly Ser Gly Gly Phe Glu His Asn Gln Glu

225 230 235 240

Met Arg Thr Lys Tyr Gln Arg Gln Pro Ile Thr Thr Glu Trp Thr Val

245 250 255

Gly Ala Val Ala Asn Thr Gly Asp Gly Ile Val Ala Ala Glu Lys Leu

260 265 270

Gly AlaAla Leu Glu Leu Met Glu Asp Ala Trp Trp Gly Pro Thr Val

275 280 285

Pro Leu Val Gly Ala Pro Trp Phe Ala Leu Ser Glu Gly Ser Ile Ile

290 295 300

Val Asn Met Asn Gly Lys Arg Phe Met Asn Glu Ser Met Pro Tyr Ser

305 310 315 320

Glu Ala Cys His His Met Tyr Gly Gly Gln Tyr Gly Gln Glu Asn Val

325 330 335

Pro Ala Trp Met Val Phe Asp Gln Gln Tyr Arg Asp Arg Tyr Ile Phe

340 345 350

Ala Gly Leu Gln Pro Gly Gln Arg Ile Pro Lys Lys Trp Met Glu Ser

355 360 365

Gly Val Ile Val Lys Ala Asp Ser Val Ala Glu Leu Ala Glu Lys Thr

370 375 380

Gly Leu Ala Pro Asp Ala Leu Thr Ala Thr Ile Glu Arg Phe Asn Gly

385 390 395 400

Phe Ala Arg Ser Gly Val Asp Glu Asp Phe His Arg Gly Glu Ser Ala

405 410 415

Tyr Asp Arg Tyr Tyr Gly Asp Pro Thr Asn Lys Pro Asn Pro Asn Leu

420 425 430

Gly Glu Ile LysAsn Gly Pro Phe Tyr Ala Ala Lys Met Val Pro Gly

435 440 445

Asp Leu Gly Thr Lys Gly Gly Ile Arg Thr Asp Val His Gly Arg Ala

450 455 460

Leu Arg Asp Asp Asn Ser Val Ile Glu Gly Leu Tyr Ala Ala Gly Asn

465 470 475 480

Val Ser Ser Pro Val Met Gly His Thr Tyr Pro Gly Pro Gly Gly Thr

485 490 495

Ile Gly Pro Ala Met Thr Phe Gly Tyr Leu Ala Ala Leu His Leu Ala

500 505 510

Gly Lys Ala

515

<210>4

<211>1548

<212>DNA

<213> Artificial sequence ()

<400>4

atgaccgaac aggattactc ggttttcgac gtcgtggtcg tcggatctgg agcggcgggc 60

atggtggcag cgctgacggc tgcgcaccag gggttatcta cagtggtagt cgagaaagca 120

cctcactatg gcggttcgac cgcgcgttca ggtggggggg tatggatacc gaacaacgag 180

gtattacagc gggacggtgt gaaagatacg cctgctgagg cccgtaaata tttgcatgcc 240

atcattggcg atgttgttcc agcagaaaag atagatacgt atctggatcg cagtccagag 300

atgttgtctt ttgtactgaa aaactcgccg ttaaaactgt gctgggtccc cgggtacagt 360

gactattatc ctgaaacacc gggtggtaaa gctactggtc gcagcgtgga gccgaaaccc 420

ttcaatgcca aaaagttagg gccggatgag aaaggcttgg aacctccata cgggaaagtc 480

gtatgggcga atgctactgg caaaaattta gtcggcatgg gccgtgcgtt gattgctcct 540

ttacgtatag ggctgcagaa agcaggagta cccgtccttc ttaacactgc attaacagat 600

ttatatcttg aagacggcgt cgttcgtggc atctatgttc gggaagctgg agcgcctaag 660

ctgatacgtg cgcgcaaggg cgttatcctg ggcagtggcg gtttcgagca caaccaggaa 720

atgcggacca aataccagcg gcaacccatc accacagaat ggacggtcgg cgccgtagct 780

aacacgggag atggtattgt tgccgcggag aagttaggag ctgcgcttga gttgatggaa 840

gatgcgtggt ggggtcccac agtacctctg gtgggcgcac cgtggttcgc tctttctgag 900

ggtagtatca ttgttaatat gaacggaaag agatttatga acgaatctat gccttatagc 960

gaagcatgtc atcacatgta cggtggacag tatggtcagg agaatgttcc cgcttggatg 1020

gtttttgatc agcagtaccg ggaccggtac atatttgctg ggctgcaacc cgggcaacgg 1080

ataccgaaga agtggatgga gagtggggtg atcgtgaagg ccgattccgt tgctgagtta 1140

gccgaaaaga ccggtctggc cccggacgcc ttaacggcca cgatcgaacg cttcaatggt 1200

ttcgcaagaa gcggagtgga cgaggatttt cacagaggcg aatctgctta tgatcgctac 1260

tatggagatc caacgaataa acccaaccct aatctgggcg aaatcaaaaa tggaccattc 1320

tatgcggcta aaatggtgcc aggtgacctt gggaccaagg gcggaattag aacagatgtt 1380

catggaagag cactgcgcga cgacaacagc gtaatcgagg gattatacgc tgcagggaac 1440

gtcagctcac cggtgatggg acacacgtat ccgggaccag gaggcacgat aggacccgca 1500

atgacgtttg gctacttagc cgctctgcac ttagctggca aggcctga 1548

Claims (4)

1. A process for the preparation of a C1, 2-dehydrosteroid comprising:

constructing an expression vector for expressing the recombinant KstD enzyme, wherein the amino acid sequence of the recombinant KstD enzyme is SEQ ID.3;

expressing the recombinant KstD enzyme by using the expression vector and a cell culture mode to obtain a crude enzyme solution;

adding a substrate androst-4-ene-3, 17-dione (4-AD) into the crude enzyme solution, and reacting to obtain the C1, 2-dehydrosteroid compound.

2. The method of claim 1, further comprising:

before the reaction, adding electron acceptor menadione into the crude enzyme solution, wherein the mass concentration of the electron acceptor menadione in the reaction solution is less than or equal to 1%.

3. The method of claim 1, further comprising:

adding catalase into the crude enzyme solution before reaction, wherein the concentration of the catalase in the reaction solution is less than or equal to 100U/L.

4. The method according to claim 1, wherein the recombinant KstD enzyme has Maltose Binding Protein (MBP) bound to the N-or C-terminus.

Images