CN111471686B - Oligonucleotide sequence of targeted p53 protein, derivative probe and application thereof - Google Patents

Abstract

An oligonucleotide sequence targeting p53 protein, a derivative probe and application thereof. The sequence of the oligonucleotide is: TGGCGGAGGGGCGGTAGGGG, the sequence can be specifically combined with p53 protein, the combination constant kd value is 2.43E-08M, and the sensitivity and selectivity are higher. The derivative probes comprise Cy5-sDNAP53, Biotin-sDNAP53 and FAM-sDNAP53, and are prepared by respectively connecting anthocyanin Cy5 fluorescein, Biotin and 5(6) -carboxyfluorescein to the 5' end of the sDNAP 53. Wherein the Biotin-sDNAP53 can be used for the enrichment of p53 protein; FAM-sDNAp53 can be used for fluorescence polarization analysis of p53 protein; cy5-sDNAP53 can be used for analysis such as localization of p53 protein. Compared with the traditional detection of the p53 antibody, the probe derived based on the sequence of the sDNAP53 oligonucleotide is convenient to use and high in detection sensitivity, can accurately analyze the p53 protein in cells and tissues, and can be used for clinical diagnosis and early cancer discovery.

Description

Oligonucleotide sequence of targeted p53 protein and derivative probe and application thereof

Technical Field

The invention belongs to the technical field of detection, enrichment and function evaluation of target protein, and relates to a high-affinity oligonucleotide sequence of a target p53 protein and application of a derivative probe thereof.

Background

p53(TP53) is an important cancer suppressor gene which controls the initiation of the cell cycle, prevents DNA damage, repairs damaged DNA, and monitors cell proliferation and differentiation. Play an important role in cell cycle, apoptosis and DNA damage repair. Therefore, rapid and accurate detection and functional evaluation of p53 protein are always one of the hot spots in cancer research. At present, there are many methods for p53 analysis and detection research, including various immunoassay methods, electron-mediated enzymatic electrochemical detection methods, biosensor methods based on nanoparticle amplification technology, and fluorescence detection methods. For example, the principle of the conventional competitive ELISA detection method is that a p53 protein monoclonal antibody is labeled with horseradish peroxidase (HRP), and a competitive ELISA detection method is established through competition between the labeled antibody and recombinant p53 protein; chinese patent (CN201410724706.2) discloses an electrochemical immunodetection method of p53 protein, and the detection method detects p53 protein through sandwich immunoreaction; chinese patent (CN201510004601.4) also discloses a biosensor for detecting p53 protein based on nanoparticle amplification technology, which is characterized in that specific identification is carried out on wild type p53 protein by utilizing specific immunoreaction of antigen and antibody, and the detection of p53 protein is realized by signal amplification of nanoparticles.

However, the basic principle of the detection method reported at present is mostly based on the immune reaction against the p53 protein epitope, and the use of the detection method is limited by the higher cost and the complicated operation steps. In addition, p53 function has been found to change in more than 50% of human malignancies. By utilizing the characteristic that a DNA binding pocket specific to the p53 protein can be specifically bound to DNA, a novel probe which replaces a traditional antibody can be designed to realize functional detection of the p53 protein. For example, chinese patent (CN201710885397.0) discloses a fluorescent detection method of p53 protein, which is characterized in that a specific DNA fragment (CN2017 for short) coated by magnetic nanoparticles is combined with p53 protein, and p53 protein in cell lysate is detected by a fluorescence method, wherein the combination ability of the DNA sequences CN2017 and p53 protein is low, so the specificity and sensitivity of detection need to be improved.

Disclosure of Invention

The invention aims to solve the problems that the specificity and the sensitivity of the existing probe for detecting the p53 protein are low and the application is limited. In order to detect the p53 protein specifically, with high sensitivity and high efficiency, the invention designs and synthesizes a novel oligonucleotide sequence targeting the p53 protein, three derived probes and application thereof.

Technical scheme of the invention

An oligonucleotide sequence targeting a p53 protein, consisting of 20 nucleotides: TGGCGGAGGGGCGGTAGGGG, abbreviated as sDNAP 53.

The sDNAP53 oligonucleotide sequence can be specifically combined with p53 protein, the combination constant kd value of the sDNAP53 oligonucleotide sequence and p53 protein is 2.43E-08M through surface plasma resonance technology (SPR), and the sDNAP53 oligonucleotide sequence has higher sensitivity and selectivity.

The invention also provides three probes derived from the sDNAP53, wherein the derived probes are respectively covalently bound with different probe molecules for detection and capture at the 5' end of the sDNAP53, comprise anthocyanin Cy5 fluorescein (Cy 5 for short), Biotin (Biotin for short) and 5(6) -carboxyfluorescein (FAN for short), and are respectively prepared into three oligonucleotide probes with different purposes, a Cy5-sDNAP53 probe, a Biotin-sDNAP53 probe and a FAM-sDNAP53 probe.

The Cy5-sDNAP53 probe is a Cy5-sDNAP53 probe formed by covalently linking the 5' end of an oligo-nucleotide sequence of sDNAP53 and a Cy5 molecule, and is used for detecting the fluorescent localization of p53 protein in tissue cells by using the good fluorescent characteristic of Cy5 and the specificity of sDNAP53 through a microscopic fluorescent detection means.

The FAM-sDNAP53 probe is prepared by covalently linking the 5' end of an sDNAP53 oligonucleotide sequence and FAM molecules to form a FAM-sDNAP53 probe, and evaluating the function of a small molecule compound interacting with p53 protein by a fluorescence polarization detection means by utilizing the fluorescence polarization characteristic of FAM and the specificity of sDNAP53, and is used for screening drugs aiming at p53 protein.

The Biotin-sDNAP53 probe is formed by covalently linking the 5' end of an sDNAP53 sequence and a Biotin molecule to form a Biotin-sDNAP53 probe, and p53 protein in cell and tissue lysate is enriched by utilizing the specific binding capacity of the Biotin and streptavidin and the specificity of the sDNAP53 through a streptavidin coupled magnetic bead capture means, so that the probe can be used for capturing research of p53 protein.

The invention has the advantages and beneficial effects that:

the invention designs and synthesizes a novel oligonucleotide sequence sDNAp53 fragment which can be specifically combined with p53 protein. Compared with the disclosed p 53-binding oligonucleotide fragment, the sDNAP53 fragment binds more strongly to the p53 protein. Compared with the traditional detection of the p53 antibody, the DNA probe derived from the sequence of the sDNAP53 is more convenient to use, can accurately analyze and capture the p53 protein in cells and tissues, and can be used for the diagnosis and detection of the p53 protein and the early discovery of cancers.

Drawings

FIG. 1 is a determination of the binding ability of sDNAP53 to p53 protein. Wherein miR-760 and miR-493-5p are natural microRNA precursors capable of being combined with p53 protein; CN2017 is a disclosed DNA sequence binding to p53 protein; the sDNA is a DNA fragment newly designed and synthesized by the invention.

FIG. 2 shows the preparation and application of Cy5-sDNAP53 probe. Wherein (a) is LC-MS identification of the Cy5-sDNAP53 probe prepared by activating Cy5 with succinimide ester and then attaching to the 5' -end of sDNAP 53; (b) the figure shows the correlation coefficient and overlap coefficient analysis of the cell fluorescence co-localization staining experiment of Cy5-sDNAP53 probe and p53 antibody (n is 3).

FIG. 3 is the preparation of FAM-sDNAp53 probe and its use. Wherein (a) is 5(6) -carboxyfluorescein (FAM) by LC-MS identification of FAM-sDNAp53 probe prepared by activating succinimide ester and then attaching to 5' end of sDNA; (b) the figure is a test of the binding efficiency of FAM-sDNAP53 probe and p53 protein measured by a fluorescence polarization method, (n-3).

FIG. 4 is a fluorescent polarization assay for detecting the binding of protopanaxatriol promotion FAM-sDNAP53 probe to p53 protein, (n-3).

FIG. 5 is the preparation and application of the Biotin-sDNAP53 probe. Wherein (a) is the LC-MS identification of Biotin (Biotin) connected to the 5' end of the sDNAP53 after being activated by succinimide ester, prepared Biotin-sDNAP53 probe; (b) p53 protein was enriched from cell lysates using a Biotin-sDNA probe. (c) The graph shows that the western blot detects the enriched p53 protein. Wherein (b), (c) said M is a protein Marker; r is cell lysate group (no probe and streptavidin); c1, C2 and C3 as control group (streptavidin was added to the cell lysate, no probe); s1, S2 and S3 are used as sample groups (streptavidin and probe are added into cell lysate).

Detailed Description

The invention is further described below with reference to the accompanying drawings. It should be understood that these embodiments are merely illustrative of the present invention and are not intended to limit the scope of the invention, and that various changes or modifications may be made to the present invention based on the principle of the present invention and are also defined in the appended claims.

Example 1: design and synthesis of p53 protein binding sDNAP53 sequence

The sequence of the sDNAp53 described in this example is a newly designed non-natural DNA sequence targeting the p53 protein, and the sequence consists of 20 nucleotides, specifically as follows:

sDNAP53: TGGCGGAGGGGCGGTAGGGG (see sequence listing for details)

Alignment of uniport blast sequences did not reveal any sequence identity to sdnp 53.

Example 2: determination of the binding constants of sDNAp53 and p53 protein

To further evaluate the binding constant kd values of each oligonucleotide fragment and p53 protein, assay analysis was performed using Surface Plasmon Resonance (SPR).

Coupling of protein chips: the target p53 protein was first coupled using a CM5 sensor chip, and recombinant p53 protein (available from Millipore, cat # 506165-10UG) was diluted to 50. mu.g/mL with 10mmol/L sodium acetate buffer (pH 5.0) and mobile phase 10mmol/L phosphate buffered saline (pH7.4) plus 5% dimethyl sulfoxide. Selecting a coupling channel and a reference channel, setting the flow rate to be 10 mu L/min, feeding samples for 120 seconds, coupling the amount of 5000-7000 Ru protein in each channel, sealing the channels for 30 seconds by 10mmol/L ethanolamine after coupling the proteins, and coupling the p53 protein with a CM5 chip for 4 ℃ storage for later use before use.

The new sequence of sDNAp53, the DNA sequences corresponding to the known regulatory microRNA of p53, miR760 and miR493-5p, and the published probe sequence in patent CN2017 were assigned to the synthesis of DNA fragments by Jinzhi organism GmbH (Suzhou) and used for the following experimental analysis.

Detection of binding constants: each oligo DNA fragment was serially diluted from 2.5 μ M to 2.5nM using 10mmol/L phosphate buffered saline (ph7.4) plus 5% dmso buffer, then passed through CM5 chip coupled with p53 protein in sequence from low to high concentration, recording detection parameters in real time, eliminating molecular effects of nonspecific binding and signal drift by molecular weight adjustment and solvent correction, and the data were analyzed and processed using Biacore T200 software to calculate binding constants.

As shown in FIG. 1, the binding constants of sDNAp53 and p53 proteins were approximately 2.43E-08M, which is much lower than the native sequence (miR760, 1.36E-07M; miR493-5p, 1.41E-07M) and the published sequence (CN2017, 1.66E-07M). Experimental results show that the oligonucleotide sequence sDNAp53 of the targeted p53 protein has high ultrasensitiveness and can be used for preparing a derivative probe of the oligonucleotide sequence sDNAp 53.

Example 3: preparation and application of Cy5-sDNAP53 probe

In order to investigate the fluorescent localization ability of the sDNAP53 oligonucleotide sequence provided by the invention to the p53 protein in cells, the Cy5-sDNAP53 fluorescent probe was designed and synthesized in the present example. The Cy5-sDNAp53 probe was prepared by activating Cy5 with succinimide ester and attaching it to the 5' end of sDNA, which was synthesized by the agency of the research on the synthesis of specific probes (King Zhi Biol., Suzhou). The mass spectrometric detection result of the Cy5-sDNAP53 fluorescent probe is shown in FIG. 2(a), and the fluorescent labeling molecule of Cy5 is correctly linked to the 5' end of the sDNAP 53.

In this example, the immunofluorescent staining of p53 protein fluorescent antibody (doctor's biological engineering Co., Ltd., cat # BM4026) was used as a reference control, and the double staining localization of Cy5-sDNAP53 probe and p53 fluorescent antibody was performed on p53 protein in A549 non-small cell lung cancer cells. The effect of the Cy5-sDNA p53 probe was evaluated by detecting the fluorescence signals of both and calculating the correlation coefficient and the overlap coefficient. Wherein the excitation wavelength of the Cy5-sDNAP53 probe is set to 460nm, and the emission wavelength is 670 nm; the excitation wavelength of the p53 fluorescent antibody is 490nm, and the emission wavelength is 518 nm.

The specific operation steps of immunofluorescence positioning are as follows:

1) placing the A549 cells in a 20mm laser confocal culture dish, culturing for 12 hours, removing the culture medium, washing for 3 times at room temperature by using a shaking table at 100 revolutions per minute, and shaking for 10 minutes by using 500 mu LPBS buffer solution each time.

2) The washed A549 cells were fixed with 200. mu.L of 4% paraformaldehyde at room temperature for 15 minutes. Then, the mixture was washed 3 times with 500. mu.L PBS buffer solution each time in a shaker at 100 rpm for 10 minutes.

3) Adding 500 μ L of 0.3% Triton-X100, permeabilizing at room temperature for 5 min, then placing on a shaker at 100 rpm, washing 3 times with 500 μ L PBS buffer each time, and shaking for 10 min.

4) To the cells were added 500. mu.L of salmon sperm DNA 100. mu.g/mL, after blocking at room temperature for 1 hour, the cells were again placed on a shaker at 100 rpm, washed 3 times with 500. mu.L of LPBS buffer each time, and shaken for 10 minutes.

5) To the cells, 100nM Cy5-sDNAP53 probe 500. mu.L was added, incubated for 5 hours at room temperature in the dark, and then placed on a shaker at 100 rpm, washed 3 times with 500. mu. LPBS buffer each time, and shaken for 10 minutes.

6) To the above cells was added 1: 1000 sheep serum (1X) diluted p53 fluorescent antibody, incubated overnight at 4 ℃ protected from light. Then, the mixture was washed 3 times with 500. mu.L PBS buffer solution each time in a shaker at 100 rpm for 10 minutes.

7) The confocal laser culture dish was placed under a confocal laser microscope (Leica TCS SP8, germany, come card) to perform multicolor fluorescence analysis of cells.

The cell culture time, the number of washing times, the cell permeabilization concentration and time, the use concentration and time of the Cy5-sDNAP53 probe, and the like, which are described in the above steps, are exemplary embodiments, and can be appropriately adjusted, substituted, and changed without departing from the spirit and scope of the present invention.

The experimental result is shown in FIG. 2(b), the Cy5-sDNAP53 probe disclosed by the invention can effectively locate the intracellular p53 protein; compared with the commercial p53 fluorescent antibody, the fluorescence localization effect shows higher correlation between the correlation coefficient and the overlapping coefficient of the Pearson. Compared with the traditional p53 fluorescent antibody, the Cy5-sDNAP53 probe designed and synthesized based on sDNAP53 provided by the invention has the advantages of low use concentration, high sensitivity, low detection cost and good specificity, and can meet the fluorescent detection and cell localization of p53 protein.

Example 4: preparation and performance evaluation of FAM-sDNAp53 probe

In order to investigate the binding ability of the sDNAP53 oligonucleotide sequence provided by the present invention to p53 protein, this example designed and synthesized FAM-sDNAP53 fluorescent probe. The FAM-sDNAp53 probe was prepared by activating FAM with succinimide ester and attaching it to the 5' end of sDNA, and was synthesized by the company consignment for the synthesis of the specific probe (King Zhi Biometrics, Inc., Suzhou). The mass spectrometric detection result of the FAM-sDNAp53 fluorescent probe is shown in FIG. 3(a), and the fluorescent labeling molecule of FAM is correctly linked to the 5' end of sDNAp 53.

In this example, the binding of FAM-sDNAP53 probe to p53 protein was examined by fluorescence polarization experiments. The basic principle is that when the FAM-sDNAP53 probe can rotate freely (brownian motion) in the solution and emits light in all directions, the fluorescence polarization value is inversely related to the rotation speed of the FAM-sDNAP53 probe, i.e., the faster the rotation is, the smaller the fluorescence polarization value is. The speed of rotation of the FAM-sDNAp53 probe is also inversely related to mass, i.e., the greater the mass, the slower the rotation, and thus the greater the fluorescence polarization. Therefore, when the FAM-sDNAP53 probe is combined with the p53 protein, the molecular weight is increased, the rotation speed is slowed, the fluorescence polarization value is increased, and the combination of the sDNAP53 and the p53 protein can be determined by measuring the change of the fluorescence polarization value.

The specific operation steps of the fluorescence polarization detection method are as follows:

recombinant p53 protein (purchased from Millipore, Cat. No.: 506165-10UG) was serially diluted with protein buffer (200mM NaCl, 20mM Tris-HCl, 5mM DDT, pH 8.0) to obtain 200. mu.M, 100. mu.M, 50. mu.M, 25. mu.M, 12.5. mu.M, 6.25. mu.M, 3.125. mu.M, 1.5625. mu.M, 0.78125. mu.M, and 0.390625. mu.M protein solutions at different concentrations, respectively. 50 mu L of the solution is respectively put into a 96-hole black fluorescent plate (Sammerfei company, Cat: 237108), 50 mu L of FAM-sDNAP53 probe with the final concentration of 100nM is sequentially added, after shaking and mixing for 10 minutes, the mixture is centrifuged at 4 ℃ and 1,000g for 3 minutes, air bubbles are removed, and a multifunctional microplate detector (TECAN company, model: spark) is adopted to detect the fluorescence bias positive light. After programmed shaking for 10 seconds, the fluorescence polarization was measured with excitation wavelength set to 492nm and emission wavelength at 518nm with a 20nm offset. And performing nonlinear analysis on the data by adopting GraphPad Prism 5.0 software, and drawing a fluorescence polarization curve by taking the protein concentration as an abscissa and the fluorescence polarization value as an ordinate. As a result, as shown in FIG. 3(b), the FAM-sDNAP53 probe was able to specifically bind to the p53 protein, and its EC was₅₀The value was 4.74. mu.M.

Example 5: application of FAM-sDNAp53 probe

In order to examine the capability of the FAM-sDNAp53 fluorescent probe provided by the invention to detect the binding capacity of a small molecule compound interacting with the p53 protein by a fluorescence polarization detection means, the FAM-sDNAp53 fluorescent probe can be evaluated and used for drug screening of the p53 protein. This example designed and implemented a fluorescence polarization method based on the FAM-sDNAp53 probe described in example 4 for drug binding ability detection.

Protopanaxatriol was selected as the subject for examination, and was serially diluted in protein buffer (200mM NaCl, 20mM Tris-HCl, 5mM DDT, pH 8.0) to 1000. mu.M, 500. mu.M, 250. mu.M, 125. mu.M, 62.5. mu.M, 31.25. mu.M, 15.62. mu.M, 7.81. mu.M, 3.90. mu.M and 1.95. mu.M solutions. The final concentration of the dilution of the p53 protein was 20. mu.M, and the final concentration of the dilution of the FAM-sDNAp53 probe was 1. mu.M. Respectively taking 45 mu L of the protopanaxatriol solution with different concentrations, 45 mu L of the p53 protein solution and 10 mu L of FAM-sDNAP53 probe, placing the protopanaxatriol solution, the p53 protein solution and the FAM-sDNAP53 probe in a 96-hole black fluorescent plate, setting the final reaction system to be 100 mu L, shaking and mixing the mixture for 10 minutes, centrifuging the mixture for 3 minutes at 4 ℃ and 1,000g, removing bubbles, and detecting fluorescence bias light by using a multifunctional microplate detector. After programmed shaking for 10 seconds, the fluorescence polarization was measured with excitation wavelength set to 492nm and emission wavelength at 518nm with a 20nm offset. And performing nonlinear analysis on the data by adopting GraphPad Prism 5.0 software, and drawing a fluorescence polarization curve by taking the concentration of the original panaxatriol as an abscissa and the fluorescence polarization value as an ordinate. As shown in FIG. 4, protopanaxatriol (protopanaxatriol) can concentration-dependently promote the binding of p53 to FAM-sDNAP53 probe, with its EC₅₀The value was 29.30. mu.M.

The protein concentration, probe concentration, drug concentration, etc. described in the above steps are exemplary embodiments, and appropriate adjustments, substitutions, and changes may be made without departing from the spirit and scope of the present invention. The results of examples 4 and 5 show that the FAM-sDNAP53 probe designed and synthesized based on the sDNAP53 provided by the invention has low use concentration, high sensitivity, low price and good specificity, and can be used for activity evaluation of small molecules of drugs combined with the p53 protein and screening of drugs combined with the p53 protein.

Example 6: preparation and application of Biotin-sDNAP53 probe

In order to expand the binding capacity of the sDNAP53 oligonucleotide sequence provided by the invention and the p53 protein, the Biotin-sDNAP53 probe is designed and synthesized in the embodiment and is used for enrichment and capture of the p53 protein. The method for preparing the Biotin-sDNAP53 probe is that Biotin is activated by succinimide ester and then is connected to the 5' end of sDNA, and the specific probe is synthesized by entrusted companies for synthesizing the probe (Jinzhi biology, Inc., Suzhou). The mass spectrometric detection of the Biotin-sDNAP53 probe is shown in FIG. 5(a), where the Biotin molecule is correctly ligated to the 5' end of sDNAP 53.

In this example, the A549 non-small cell lung cancer cell was used as an implementation object, and the enrichment capacity of the Biotin-sDNAP53 probe for p53 protein was examined. The A549 cell is lysed by RIPA lysate (Solebao corporation, cat # R0020), supernatant protein is taken as enrichment object by centrifugation, and target protein is captured by the adsorption elution of Biotin-sDNAP53 probe and streptavidin magnetic bead (Beijing Zhongyuan Synbiotic Biotech Co., Ltd., cat # 30152104010150).

The specific operation steps of the probe for enriching the target protein are as follows:

1) mu.g of the Biotin-sDNAP53 probe and 500. mu.g of the cell protein lysate were added as follows: mix at 100 vol%, 16 deg.C, incubate with shaking for 1 hour.

2) Mu.l of streptavidin magnetic beads were washed once with 1mL of precooled PBS, 5,000g, centrifuged for 1 minute, and the supernatant was discarded.

3) Adding the probe and protein incubation mixed solution obtained in the step 1) into the washed streptavidin magnetic beads obtained in the step 2), performing shaking incubation for 1 hour at 16 ℃.

4) Placing the suspension obtained in the step 3) on a magnetic frame (MagReck 6, GE healthcare company), standing for 1 minute, then removing a supernatant, and collecting streptavidin magnetic beads.

5) Beads were washed repeatedly 10 times with 1mL of pre-chilled PBS, magnetic beads were collected, and 100 μ l of protein loading buffer (Yeasen, cat #: 20315ES05), mixing, and heating at 100 deg.C for 10 min. Centrifuging at 12,000g for 10 min, collecting supernatant, and performing SDS-PAGE gel staining and western blot detection.

The protein concentration, probe concentration, streptavidin magnetic bead amount, incubation time, washing frequency, and the like in the above steps are exemplary embodiments, and appropriate adjustment, substitution, and change may be made without departing from the spirit and scope of the present invention.

As a result, as shown in FIG. 5(b), Biotin-sDNAP53 was enriched in p53 protein from A549 cell lysate, and the captured protein was confirmed to be p53 by western blot analysis using p53 antibody (Bausch & Debiol., Ltd., cat # BM4026), as shown in FIG. 5 (c).

The Biotin-sDNAP53 probe designed and synthesized based on sDNAP53 provided by the invention can quickly and accurately capture p53 protein in cell lysate, and realizes high-selectivity and high-accuracy capture of p53 protein.

Sequence listing

<110> university of southern kayak

<120> oligonucleotide sequence of targeting p53 protein, and derived probe and application thereof

<130> 2020-03-26

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggcggaggg gcggtagggg 20

Claims (5)

1. An oligonucleotide molecule targeting a p53 protein, consisting of 20 nucleotides: TGGCGGAGGGGCGGTAGGGG, abbreviated as sDNAP 53.

2. The Cy5-sDNAp53 probe derived from sDNAp53, which is characterized in that the Cy5-sDNAp53 probe is a Cy5-sDNAp53 probe formed by covalently linking the 5' end of the sDNAp53 oligonucleotide molecule of claim 1 and an anthocyanin Cy5 fluorescein molecule, and the probe is used for the fluorescence localization detection of the p53 protein by a microscopic fluorescence detection means by utilizing the good fluorescence characteristics of Cy5 and the specificity of the sDNAp 53.

3. The FAM-sDNAp53 probe derived from sDNAp53, which is characterized in that the FAM-sDNAp53 probe is a FAM-sDNAp53 probe formed by covalently linking the 5' end of the sDNAp53 oligonucleotide molecule and 5(6) -carboxyfluorescein FAM molecule, and the function of a small molecule compound interacting with the p53 protein is evaluated by a fluorescence polarization detection means by utilizing the fluorescence polarization property of FAM and the specificity of sDNAp53, so that the FAM-sDNAp53 probe is used for drug screening aiming at the p53 protein.

4. A Biotin-sDNAP53 probe derived from sDNAP53, which is characterized in that the Biotin-sDNAP53 probe is a Biotin-sDNAP53 probe formed by covalently linking the 5' end of the sDNAP53 oligonucleotide molecule of claim 1 and a Biotin molecule, and p53 protein in cell and tissue lysates is enriched by a streptavidin coupled magnetic bead capture means by utilizing the specific binding capacity of Biotin and streptavidin and the specificity of sDNAP53, and is used for capturing research of p53 protein.

5. Use of the probe according to any one of claims 2 to 4 for the preparation of reagents for the tracing, enrichment and functional assessment of p53 protein.

Images