CN111455064B - Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis - Google Patents
Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis Download PDFInfo
- Publication number
- CN111455064B CN111455064B CN202010287943.2A CN202010287943A CN111455064B CN 111455064 B CN111455064 B CN 111455064B CN 202010287943 A CN202010287943 A CN 202010287943A CN 111455064 B CN111455064 B CN 111455064B
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- pufa
- fish
- siganus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to application of miRNA-sc-miR-145 in LC-PUFA synthesis of fishes, wherein the fishes are siganus oramin, and a sequence table of the miRNA-sc-miR-145 is shown as SEQ ID NO: 1 is shown. The precursor sequence of the miRNA-sc-miR-145 is shown as SEQ ID NO: 2 is shown in the specification; the DNA sequence of the precursor sequence of the miRNA-sc-miR-145 is shown as SEQ ID NO: 3, respectively. The siganus oramin miR-145 fed by different fat source feeds verifies the response difference of miR-145 to different fat sources, and the obtained miR-145 and precursor pre-miR-145 thereof play an important role in regulating and controlling the anabolism of long-chain polyunsaturated fatty acid, and further molecular biology experimental verification proves that the siganus oramin miR-145 and precursor pre-miR-145 thereof play an important role in LC-PUFA synthesis, and the synthesis of LC-PUFA in a fish body can be promoted by the knock-down expression of siganus sativus miR-145 and precursor pre-miR-145 thereof. The miR-145 disclosed by the invention can be used as a molecular marker related to the synthesis capacity of the siganus oramin long-chain polyunsaturated fatty acid, and has an important practical application value in genetic auxiliary breeding.
Description
Technical Field
The invention belongs to the technical field of preparation of fish molecular markers, and particularly relates to application of miRNA-sc-miR-145 in fish LC-PUFA synthesis.
Background
microRNAs (miRNAs) are small single-stranded non-coding RNAs of 18-25 nucleotides in length, which are transcribed starting from the nucleus, initially transcribed to form pre-miRNAs of about 60-90 nucleotides in length and with a typical stem-loop structure, and then transported out of the nucleus where they are processed into mature miRNAs by Dicer enzyme action. miRNA recognizes a 3 'non-coding region (3' UTR) of a specific target mRNA by sequence complementation, degrades it or inhibits translation, and participates in post-transcriptional regulation of a gene.
Long chain polyunsaturated fatty acids (LC-PUFA) are Essential Fatty Acids (EFA) for vertebrates to maintain normal growth and development, and mainly comprise eicosapentaenoic acid (20:5n-3, EPA), docosahexaenoic acid (22:6n-3, DHA) and arachidonic acid (20:4n-6, ARA). It is generally considered that freshwater fish and salmon and trout have the same general formula C18Polyunsaturated fatty acid (C)18PUFA) to C20-22The capability of LC-PUFA is not possessed by most marine fishes or is weak, so that the fish oil rich in LC-PUFA is required to be added into the compound feed to meet the demand of normal growth and development of organisms on EFA. With the rapid development of aquaculture industry, the contradiction between the increase of fish oil demand and the shortage of fish oil is increasingly sharp, and the development of other alternative fat sources is urgently needed, and vegetable oil with rich resources and low price is undoubtedly the first choice for substitution. However, because vegetable oil is lack of LC-PUFA, the replacement of fish oil not only affects the growth and health of aquaculture fish, but also obviously reduces the content of LC-PUFA in fish bodies, and the application of vegetable oil in compound feed is limited to a great extent. The research on the molecular mechanism of fish LC-PUFA anabolism regulation and control and the culture of new fish species with high LC-PUFA synthesis capability are important ways to improve the LC-PUFA content in fish bodies and reduce the usage amount of feed fish oil.
Siganus canariculatus (Siganus canariculus) was the first one found to have C18Conversion of PUFA to C20-22The marine fish with LC-PUFA capability has two fatty acid desaturase genes (delta 4Fad and delta 6 delta 5Fad) and two carbon chain elongase genes (Elovl5 and Elovl4) cloned in the marine fish, thereby providing an ideal model fish for researching the LC-PUFA synthesis regulation mechanism of the fish.
Disclosure of Invention
The invention provides miRNA-sc-miR-145 related to fish LC-PUFA synthesis and application thereof, and aims to solve the problems in the prior art.
Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis.
Preferably, the fish is siganus oramin.
The sequence table of the miRNA-sc-miR-145 is shown as SEQ ID NO: 1 is shown.
The precursor sequence of the miRNA-sc-miR-145 is shown as SEQ ID NO: 2 is shown in the specification; the DNA sequence of the precursor sequence of the miRNA-sc-miR-145 is shown as SEQ ID NO: 3, respectively.
Application of miRNA-sc-miR-145 in preparation of fish LC-PUFA synthetic preparations.
Preferably, the preparation is a liquid injection.
The fish miRNA disclosed by the invention can inhibit the expression of the hepatocyte cytokine 4 alpha (Hnf4 alpha) and downstream LC-PUFA synthesis related enzyme genes thereof, and further influences the LC-PUFA synthesis amount in fish bodies. The miRNA is sc-miR-145 of siganus oramin. The sequence accession number of the siganidae Hnf4 alpha gene at NCBI is JF 502073.1.
Compared with the prior art, the siganus oramin miR-145 fed by different fat source feeds verifies the response difference of miR-145 to different fat sources, and miR-145 and a precursor pre-miR-145 thereof play an important role in regulating and controlling the anabolism of long-chain polyunsaturated fatty acid, and further molecular biological experiment verification proves that the siganus oramin miR-145 and a precursor pre-miR-145 thereof play an important role in LC-PUFA synthesis, and the synthesis of LC-PUFA in a fish body can be promoted by the knocking-down expression of the siganus auramin-145 and the precursor pre-miR-145 thereof. The miR-145 disclosed by the invention can be used as a molecular marker related to the synthesis capacity of the long-chain polyunsaturated fatty acid of the siganidae, and can be used as a candidate molecule for screening the siganidae parent fish with stronger endogenous LC-PUFA synthesis capacity to breed the next generation in genetic-assisted breeding, and the bred new fish variety with high LC-PUFA synthesis capacity is an important way for improving the LC-PUFA content in fish bodies and reducing the use amount of feed fish oil. In addition, the new fish species with high LC-PUFA synthetic capacity can improve the LC-PUFA content in fish bodies, and the LC-PUFA, especially EPA called as 'vascular scavenger' and DHA called as 'brain gold' by human beings, have very important physiological and biochemical functions for human health. Therefore, the miR-145 has an important practical application value in the genetic-assisted breeding of the siganus oramin.
Drawings
FIG. 1 shows the comparison of the expression level of sc-miR-145 in liver of siganus oramin fed with different fat-derived feeds.
FIG. 2 is a diagram showing a stem-loop structure of a precursor sequence of sc-miR-145.
FIG. 3 shows that sc-miR-145 targets the 3' UTR of Hnf4 α; FIG. 3 (A) shows the results of overexpression of sc-miR-145 on HEK 293T cells; FIG. 3 (B) is a schematic diagram of the sc-miR-145 binding site to the 3' UTR of HNF4 α and its corresponding mutation site; FIG. 3 (C) shows the interaction relationship between sc-miR-145 and the 3' UTR of Hnf4 α in the dual-luciferase reporter system.
FIG. 4 shows that sc-miR-145 influences the expression of LC-PUFA synthesis related genes by targeted regulation and control of the expression of Hnf4 alpha, so that the synthesis of LC-PUFA in Lanzi hepatocytes is influenced; FIG. 4 (A) shows the result of detecting the protein expression of the target gene Hnf4 alpha and its downstream gene after overexpression and knockdown of sc-miR-145 on the hepatocytes of siganids; FIG. 4 (B) shows the mRNA expression levels of Hnf4 α and its downstream genes after sc-miR-145 is overexpressed on hepatocytes of siganids; FIG. 4 (C) shows the mRNA expression levels of Hnf4 α and its downstream genes after knock-down of sc-miR-145 on hepatocytes.
FIG. 5 shows that after the siganus oramin sc-miR-145 is knocked down, the mRNA and protein expression levels of liver Hnf4 alpha and downstream gene delta 4Fad are remarkably improved, and the total content of muscle EPA, DHA and LC-PUFA is improved; wherein (A) in FIG. 5 is the expression level of liver tissue Hnf4 alpha and downstream gene delta 4Fad protein of siganus oramin after sc-miR-145antagomir injection; FIG. 5 (B) shows LC-PUFA in siganidae muscle tissue after sc-miR-145antagomir injection, including changes in EPA and DHA content.
Detailed Description
To make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings.
The specific experimental conditions or methods are not specified in the following examples and are generally carried out according to conventional conditions, i.e., the conditions described in "Molecular Cloning: A Laboratory Manual,3rd ed.), or according to the conditions recommended by the manufacturer.
Example 1
Determining the expression level change of the sc-miR-145 in liver tissues of siganus oramin under different fat source feed feeding conditions.
The siganus oramin used by the invention is harvested in the field from south Australian island of Shantou city, domesticated by indoor salty fresh water (10ppt) and adapted for one month, and then randomly divided into 2 groups, each group comprises 3 jars, and 20 fishes in each jar are respectively fed with compound feed taking vegetable oil or fish oil as a main fat source. After feeding for 8 weeks, collecting liver tissues of the siganus guttatus, extracting total RNA in the tissues by using a Trizol reagent provided by Roche company, mixing six parallel liver tissue samples of the same processing group in equal amount to obtain two mixed samples of FO and VO, and sending the mixed samples to Shenzhen Hua big gene research institute for HiSeq small RNA high-throughput sequencing.
The results of high-throughput sequencing of the HiSeq small RNAs can be seen: the expression level of sc-miR-145 in the fish oil group is obviously increased compared with that of the vegetable oil group, which indicates that the expression of sc-miR-145 is regulated by a fat source, the synthetic capacity of the fish LC-PUFA is obviously influenced by the fat source, and the result is basically consistent with the real-time qPCR experimental verification result, as shown in figure 1. The vegetable oil is rich in C18PUFA, so that the vegetable oil has the effect of promoting the expression of key enzyme genes for LC-PUFA synthesis, and on the contrary, the fish oil rich in C20-22PUFA has the inhibiting effect. The result shows that sc-miR-145 plays an important role in the LC-PUFA synthesis of siganidae.
This example was reverse transcribed using the miScript II RT Kit from Qiagen to obtain a cDNA template for miRNA. The kit can carry out Poly (A) tailing reaction on miRNA in a sample, and simultaneously introduce a Uni-miR qPCR primer binding site to carry out quantitative PCR reaction on any miRNA and cDNA in the sample.
Example 2
Sc-miR-145 has targeted regulation effect on Hnf4 alpha gene
In the embodiment, a precursor sequence of sc-miR-145 and a mature sequence thereof are obtained by cloning through a chromosome walking technology, wherein the mature sequence is as follows: GUCCAGUUUUCCCAGGAAUCCC are provided. The structure diagram of the stem-loop of the precursor sequence of the sc-miR-145 is shown in FIG. 2, and it can be seen from FIG. 2 that the precursor sequence of the sc-miR-145 is folded into a stable stem-loop structure, belongs to a typical secondary structure of a miRNA precursor, and accords with the structural characteristics of the miRNA precursor. According to the principle of complementary pairing of a target gene and a seed sequence, 9 continuous base sequences which are completely complementary paired with the sc-miR-145 seed sequence are found on the 3' UTR of the Hnf4 alpha gene.
To demonstrate whether there is an interaction effect between the two, the present example was conducted in a dual luciferase reporter system experiment. The luciferase reporter gene system is a system for detecting the activity of firefly luciferase by taking luciferin as a substrate, the luciferase can catalyze the oxidation reaction of the luciferin to emit bioluminescence, and the bioluminescence system can sensitively and efficiently detect the expression of genes and is often applied to the directional research of the regulation and control of the transcription activity of a promoter, the verification of a miRNA target gene and the like. The Promega reporter system pmirGLO plasmid used in this experiment combines the firefly and renilla luciferase dual-fluorescence system, with renilla fluorescence as an internal reference to control the stability of the experiment.
In this experiment, Hnf4 α 3' UTR (approximately 250bp) containing the predicted binding site was inserted into the pmirGLO plasmid. Furthermore, a sequence (668bp) containing a precursor sequence of sc-miR-145 was inserted into pEGFP-C3 vector to construct an overexpression vector for sc-miR-145. After the pmirGLO plasmid and the pEGFP-C3 plasmid are co-transfected into HEK 293T cells, whether the regulation relationship exists between sc-miR-145 and a target gene Hnf4 alpha 3' UTR or not is observed. In order to further confirm the accurate action site of the miRNA and the target gene, the experiment introduces base mutation on the assumed binding site according to the prediction result so as to confirm whether the miRNA and the target gene directly act.
The results show that sc-miR-145 can directly bind to and regulate the Hnf4 alpha 3' UTR, as shown in FIG. 3.
Example 3
Regulation effect of sc-miR-145 on Hnf4 alpha and downstream gene thereof
Hnf4 alpha is proved to be a transcription factor which has the function of regulating and controlling the expression of key enzyme genes delta 4Fad, delta 6 delta 5Fad and Elovl5 of the LC-PUFA synthesis of the siganus oramin.
In order to verify the regulation effect of sc-miR-145 on Hnf4 alpha and genes downstream of the Hnf4 alpha, the example detects the change of the expression levels of proteins and mRNAs of Hnf4 alpha and genes downstream of the Hnf4 alpha after the blue roe hepatocytes over-express or under-express the sc-miR-145. The precursor sequence of sc-miR-145 and a stable inhibitor antagomir thereof are synthesized by Ruibo biology, Inc., Guangzhou.
The results show that: after the sc-miR-145 precursor is over-expressed, the mRNA and protein expression levels of the Lanzi fish hepatocyte Hnf4 alpha and the downstream gene delta 4Fad are remarkably reduced, and the mRNA levels of delta 6 delta 5Fad and Elovl5 are also remarkably reduced. In contrast, after the sc-miR-145 is knocked down, the mRNA and protein expression levels of Hnf4 alpha and a downstream gene delta 4Fad of the siganus guttatus are remarkably increased, the mRNA levels of delta 6 delta 5Fad and Elovl5 are also remarkably increased, and as shown in FIG. 4, the sc-miR-145 controls the expression of Hnf4 alpha in a targeted mode, so that the expression of LC-PUFA synthesis related genes is influenced, and the LC-PUFA synthesis of the siganus guttatus hepatocyte is influenced.
Example 4
Regulation and control effect of sc-miR-145 on LC-PUFA synthesis in siganus oramin
In order to verify the regulation effect of sc-miR-145 on LC-PUFA synthesis in siganus oramin, the siganus guttatus (about 10g) is intraperitoneally injected with a stabilization inhibitor antagomir (5 nM/tail fish) of sc-miR-145 in the example, the siganus guttatus injected every 3-4 days is taken as a corresponding control group, siganus guttatus liver and muscle tissues are collected 21 days after injection, and changes of protein and mRNA expression levels of liver tissue Hnf4 alpha and downstream genes of siganus guttatus and fatty acid composition of muscle tissues, particularly deposition changes of LC-PUFA are detected.
The fish used in this example were harvested from south Australian island of Shantou City in the field, acclimatized with indoor salty fresh water (10ppt) for one month and randomly divided into 2 groups of 10 fish in each group, and the feed fed was a commercial feed using vegetable oil as the main fat source.
The results show that: after sc-miR-145 inhibitor antagomir is injected into the siganus, the protein expression level of a target gene Hnf4 alpha and a downstream gene LC-PUFA synthesis related gene is obviously adjusted, and meanwhile, the contents of muscle EPA, DHA and total LC-PUFA of the siganus are obviously improved. As shown in FIG. 5, after the knockout of siganus oramin sc-miR-145, the mRNA and protein expression levels of liver Hnf4 alpha and downstream gene delta 4Fad are remarkably improved, and the total content of muscle EPA, DHA and LC-PUFA is improved, which means that the sc-miR-145 regulates the synthesis of LC-PUFA mainly by influencing Hnf4 alpha.
It will be understood by those of ordinary skill in the art that the foregoing embodiments are specific examples of implementing the invention, and that various changes in form and details may be made therein without departing from the spirit and scope of the invention in practice.
SEQUENCE LISTING
<110> Shantou university
Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis
<130>
<160> 2
<210> 1
<211> 22
<212> RNA
<213> siganus. canalicula)
<400> 1
guccaguuuu cccaggaauc cc
<210> 2
<211> 90
<212> RNA
<213> siganus. canalicula)
<400> 2
cuccucucuc cuggggucca guuuucccag gaaucccuug accuaucaga aagggggauu 60
ccuggaaaua cuguucuugg gggcggggcu 90
<210> 3
<211> 90
<212> DNA
<213> siganus. canalicula)
<400> 3
ctcctctctc ctggggtcca gttttcccag gaatcccttg acctatcaga aagggggatt 60
cctggaaata ctgttcttgg gggcggggct 90
Claims (4)
- The application of the miRNA-sc-miR-145 inhibitor in promoting synthesis of long-chain polyunsaturated fatty acid LC-PUFA of fishes; the fish is siganus oramin; the miRNA-sc-miR-145 has a sequence shown in SEQ ID NO: 1 is shown in the specification; the inhibitor is antagomir.
- 2. The application of the miRNA-sc-miR-145 inhibitor in promoting synthesis of long-chain polyunsaturated fatty acids (LC-PUFA) of fish according to claim 1, wherein a precursor sequence of the miRNA-sc-miR-145 is shown in SEQ ID NO: 2 is shown in the specification; the DNA sequence of the precursor sequence of the miRNA-sc-miR-145 is shown as SEQ ID NO: 3, respectively.
- The application of the miRNA-sc-miR-145 inhibitor in preparing a preparation for promoting synthesis of long-chain polyunsaturated fatty acid LC-PUFA of fishes; the fish is siganus oramin; the miRNA-sc-miR-145 has a sequence shown in SEQ ID NO: 1 is shown in the specification; the inhibitor is antagomir.
- 4. The application of the miRNA-sc-miR-145 inhibitor in preparation of a preparation for promoting synthesis of long-chain polyunsaturated fatty acid LC-PUFA of fish according to claim 3, wherein the preparation is a liquid injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010287943.2A CN111455064B (en) | 2020-04-14 | 2020-04-14 | Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010287943.2A CN111455064B (en) | 2020-04-14 | 2020-04-14 | Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111455064A CN111455064A (en) | 2020-07-28 |
| CN111455064B true CN111455064B (en) | 2022-06-28 |
Family
ID=71676459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010287943.2A Active CN111455064B (en) | 2020-04-14 | 2020-04-14 | Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111455064B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011014980A1 (en) * | 2009-08-07 | 2011-02-10 | Capitalbio Corporation | Methods and compositions diagnosing cervical cancer and cervical dysplasia, guidding subsequent treatment, determining prognosis, and improving patient survival |
| CN102121020A (en) * | 2010-12-07 | 2011-07-13 | 中山大学 | Gene complete sequence of siganus oramin L-amino acid oxidase and application thereof |
| CN103820403A (en) * | 2014-02-12 | 2014-05-28 | 佳木斯大学 | Delta4 fatty acid desaturase from siganus canaliculatus and application of Delta4 fatty acid desaturase |
| CN107574168A (en) * | 2017-11-02 | 2018-01-12 | 中国水产科学研究院淡水渔业研究中心 | A kind of miRNA of regulation and control red tilapia body-color diversity and its application |
| CN109182556A (en) * | 2018-11-01 | 2019-01-11 | 菏泽学院 | One kind SNP marker relevant to Pelteobagrus vachelli growth traits and application |
-
2020
- 2020-04-14 CN CN202010287943.2A patent/CN111455064B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011014980A1 (en) * | 2009-08-07 | 2011-02-10 | Capitalbio Corporation | Methods and compositions diagnosing cervical cancer and cervical dysplasia, guidding subsequent treatment, determining prognosis, and improving patient survival |
| CN102121020A (en) * | 2010-12-07 | 2011-07-13 | 中山大学 | Gene complete sequence of siganus oramin L-amino acid oxidase and application thereof |
| CN103820403A (en) * | 2014-02-12 | 2014-05-28 | 佳木斯大学 | Delta4 fatty acid desaturase from siganus canaliculatus and application of Delta4 fatty acid desaturase |
| CN107574168A (en) * | 2017-11-02 | 2018-01-12 | 中国水产科学研究院淡水渔业研究中心 | A kind of miRNA of regulation and control red tilapia body-color diversity and its application |
| CN109182556A (en) * | 2018-11-01 | 2019-01-11 | 菏泽学院 | One kind SNP marker relevant to Pelteobagrus vachelli growth traits and application |
Non-Patent Citations (5)
| Title |
|---|
| Chen 等.miR-24 is involved in vertebrate LC-PUFA biosynthesis as demonstrated in marine teleost Siganus canaliculatus.《BBA - Molecular and Cell Biology of Lipids》.2019, * |
| Chen等.miR-146a is involved in the regulation of vertebrate LC-PUFA biosynthesis by targeting elovl5 as demonstrated in rabbitfish Siganus canaliculatus.《Gene》.2018, * |
| Zhang 等.miR-17 is involved in the regulation of LC-PUFA biosynthesis in vertebrates: Effects on liver expression of a fatty acyl desaturase in the marine teleost Siganus canaliculatus.《Biochimica et Biophysica Acta》.2014, * |
| 王树启等.黄斑蓝子鱼幼鱼对蛋白质和脂肪适宜需要量的研究.《海洋科学》.2010,(第11期), * |
| 谢帝芝等.黄斑蓝子鱼LC-PUFA合成代谢与渗透压调节的关系研究.《中国水产科学》.2015,(第05期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111455064A (en) | 2020-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xie et al. | Regulation of long-chain polyunsaturated fatty acid biosynthesis in teleost fish | |
| Li et al. | The effects of dietary fatty acids on liver fatty acid composition and Δ6-desaturase expression differ with ambient salinities in Siganus canaliculatus | |
| Hou et al. | Discovery of MicroRNAs associated with myogenesis by deep sequencing of serial developmental skeletal muscles in pigs | |
| Li et al. | MicroRNA-125a/b-5p inhibits endothelin-1 expression in vascular endothelial cells | |
| Ma et al. | Coexpression of an intronic microRNA and its host gene reveals a potential role for miR-483-5p as an IGF2 partner | |
| Zhang et al. | miR-17 is involved in the regulation of LC-PUFA biosynthesis in vertebrates: effects on liver expression of a fatty acyl desaturase in the marine teleost Siganus canaliculatus | |
| Li et al. | Genome wide identification and functional characterization of two LC-PUFA biosynthesis elongase (elovl8) genes in rabbitfish (Siganus canaliculatus) | |
| ES2724998T3 (en) | Methods for the efficient production of polyunsaturated fatty acids (PUFA) in Rhodosporidium and Rhodotorula species | |
| Zhou et al. | The high-level accumulation of n-3 polyunsaturated fatty acids in transgenic pigs harboring the n-3 fatty acid desaturase gene from Caenorhabditis briggsae | |
| Tao et al. | miR-205-5p negatively regulates hepatic acetyl-CoA carboxylase β mRNA in lipid metabolism of Oreochromis niloticus | |
| Chen et al. | miR-24 is involved in vertebrate LC-PUFA biosynthesis as demonstrated in marine teleost Siganus canaliculatus | |
| CN105087584A (en) | miRNA related to chicken abdominal fat deposition and application of miRNA | |
| Li et al. | MiR-21-3p targets Elovl5 and regulates triglyceride production in mammary epithelial cells of cow | |
| Xu et al. | Bovine bta-microRNA-1271 promotes preadipocyte differentiation by targeting activation transcription factor 3 | |
| Li et al. | Improvement of arachidonic acid and eicosapentaenoic acid production by increasing the copy number of the genes encoding fatty acid desaturase and elongase into Pichia pastoris | |
| CN111455064B (en) | Application of miRNA-sc-miR-145 in fish LC-PUFA synthesis | |
| Sun et al. | The miR-15/16 Cluster Is Involved in the Regulation of Vertebrate LC-PUFA Biosynthesis by Targeting pparγ as Demonostrated in Rabbitfish Siganus canaliculatus | |
| Huang et al. | Identification and expression analysis of cobia (Rachycentron canadum) liver-related miRNAs under hypoxia stress | |
| Oikawa et al. | Skeletal muscle‐enriched miRNAs are highly unstable in vivo and may be regulated in a Dicer‐independent manner | |
| Gong et al. | Research progress of non-coding RNAs regulation on intramuscular adipocytes in domestic animals | |
| Hu et al. | microRNA-18b modulates insulin-like growth factor-1 expression in deer antler cell proliferation by directly targeting its 3′ untranslated region | |
| WO2022233345A9 (en) | Snp molecular marker affecting duck fatty acid composition-related gene elovl3, and detection method therefor and use thereof | |
| Dong et al. | Hepatocyte nuclear factor 4α (Hnf4α) is involved in transcriptional regulation of Δ6/Δ5 fatty acyl desaturase (fad) gene expression in marine teleost Siganus canaliculatus | |
| Goh et al. | The requirements for sterol regulatory element-binding protein (Srebp) and stimulatory protein 1 (Sp1)-binding elements in the transcriptional activation of two freshwater fish Channa striata and Danio rerio elovl5 elongase | |
| Chen et al. | Molecular characterization and expression analysis of acyl-CoA synthetase 6 in golden pompano Trachinotus ovatus reveal its function in DHA enrichment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |