CN111454343A

CN111454343A - Protein related to plant yield traits and stress tolerance and application thereof

Info

Publication number: CN111454343A
Application number: CN202010401427.8A
Authority: CN
Inventors: 陈明; 马有志; 黎毛毛; 张玥玮; 唐文思; 周永斌; 徐兆师; 陈隽
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2020-05-13
Filing date: 2020-05-13
Publication date: 2020-07-28
Anticipated expiration: 2040-05-13
Also published as: CN111454343B

Abstract

The invention discloses a protein related to plant yield traits and stress tolerance and application thereof. According to the invention, by adopting a minimum expression frame transformation method, the rice callus is infected by the DNA fragment only containing the promoter, the target gene SiMYB31 and the terminator, so that the SiMYB 31-transgenic rice is obtained. Experiments prove that: under the low nitrogen stress, the yield-related traits (spike number, spike length, grain number, thousand grain weight, straw weight, paddy weight and the like) of the SiMYB 31-transgenic rice are all higher than those of wild rice. The SiMYB31 protein has the function of regulating and controlling the stress tolerance and yield-related traits of plants, particularly improves the low-nitrogen tolerance and yield of the plants, and lays a foundation for cultivating stress-tolerant and high-yield plant varieties.

Description

Protein related to plant yield traits and stress tolerance and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein related to plant yield traits and stress tolerance and application thereof.

Background

Nitrogen is a mineral nutrient element with the largest demand in plant growth and development, and the nitrogen content in plant dry matter and plant total nitrogen is 1.5% -2% and 16%, respectively. Elemental nitrogen plays a very important role in crop growth, being a constituent of amino acids in the plant body, being a constituent of proteins, and also being a constituent of chlorophyll, which is decisive for photosynthesis in plants.

The millet has the characteristics of barren resistance and wide adaptability, and is an ideal material for researching the abiotic stress response process of the monocotyledon. At present, the research on functional genomes of the millet is just started, and the functions of genes participating in the low nitrogen stress resistance response of the millet are yet to be deeply researched.

Disclosure of Invention

The invention aims to provide application of SiMYB31 protein and related biological materials thereof in regulation and control of plant stress tolerance and/or plant yield related traits.

In order to achieve the above object, the present invention firstly provides a novel use of the SimYB31 protein.

The invention provides an application of SiMYB31 protein in regulation and control of plant stress tolerance and/or plant yield related traits;

the SiMYB31 protein is derived from millet (Setaria italica) and is any one of the following proteins A1) or A2) or A3) or A4):

A1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

A2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 2 in the sequence table;

A3) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table;

A4) a protein having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the amino acid sequence defined in any one of A1) -A3) and having the same function.

Wherein, the sequence 2 in the sequence table is composed of 280 amino acid residues.

The labels are specifically shown in table 1.

TABLE 1 sequences of tags

The protein represented by any one of A1) -A4) above may be artificially synthesized, or may be obtained by synthesizing the encoding gene and then performing biological expression.

In order to achieve the above object, the present invention also provides a novel use of a biomaterial related to a SiMYB31 protein.

The invention provides application of biological materials related to SiMYB31 protein in regulation and control of plant stress tolerance and/or plant yield related traits;

the biological material is any one of the following B1) -B10):

B1) a nucleic acid molecule encoding a SiMYB31 protein;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic cell line comprising the nucleic acid molecule of B1);

B10) a transgenic cell line comprising the expression cassette of B2).

In the above application, the nucleic acid molecule of B1) is any one of the following C1) -C4):

C1) DNA molecule shown in sequence 1 in the sequence table;

C2) DNA molecule shown in sequence 3 in the sequence table;

C3) a DNA molecule having at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule sequence defined in C1) or C2) and encoding a SiMYB31 protein;

C4) a DNA molecule which hybridizes under stringent conditions with a DNA molecule defined in C1) or C2) or C3) and which encodes a SiMYB31 protein.

Wherein, the sequence 1 in the sequence table is composed of 843 nucleotides.

The nucleotide sequence encoding the SiMYB31 protein of the present invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides that have been artificially modified to have 75% or greater identity to the nucleotide sequence encoding the SiMYB31 protein are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the SiMYB31 protein and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above applications, the stringent conditions are hybridization and washing of the membrane at 68 ℃ for 2 times, 5min each, in a solution of 2 × SSC, 0.1% SDS, and hybridization and washing of the membrane at 68 ℃ for 2 times, 15min each, in a solution of 0.5 × SSC, 0.1% SDS, or at 65 ℃ in a solution of 0.1 × SSPE (or 0.1 × SSC), 0.1% SDS.

In the application, the expression cassette sequentially consists of a promoter, the coding gene of the SiMYB31 protein and a terminator. In a specific embodiment of the invention, the expression cassette consists of a constitutive promoter of ubiquitin, the gene encoding the above-mentioned SiMYB31 protein, and the terminator nos 3' in that order.

In the above application, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

The recombinant vector is constructed by inserting the nucleic acid molecule into an expression vector to obtain the recombinant vector for expressing the protein, any enhanced, constitutive, tissue-specific or inducible promoter can be added before the transcription initiation nucleotide, and can be used alone or in combination with other plant promoters, furthermore, when the nucleic acid molecule is used for constructing the recombinant expression vector, an enhancer including a translation enhancer or a transcription enhancer can be used, and the enhancer region can be an ATG initiation codon or initiation codon of a contiguous region, but is required to be identical to the reading frame of the coding sequence to ensure the correct translation of the whole sequence, the translation control signal and the initiation codon can be widely derived, either naturally or synthetically.

In the above application, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium. The recombinant microorganism is a microorganism containing the expression cassette or the recombinant vector. In a specific embodiment of the present invention, the recombinant microorganism is agrobacterium EHA105 containing the above expression cassette.

The invention also provides application of the SiMYB31 protein or the biological material in cultivating transgenic plants with improved stress tolerance and/or yield.

The invention also provides application of the SiMYB31 protein or the biological material in plant breeding. The breeding aims to breed plants with high stress tolerance and/or high yield.

Further, the modulation is an increase.

Further, the stress tolerance is low nitrogen tolerance.

The regulation and control of the plant stress tolerance are specifically embodied in that: when the content and/or activity of a SiMYB31 protein in a plant is reduced, the plant's low nitrogen tolerance is reduced; when the content and/or activity of a SiMYB31 protein is increased in a plant, the plant has increased low nitrogen tolerance.

Said plant yield-related traits comprise dry grain weight and/or dry straw weight and/or number of ears and/or ear length and/or number of grains per ear and/or total number of grains per ear and/or thousand grain weight and/or rice weight and/or straw weight.

The plant yield-related traits are specifically embodied as follows: when the content and/or activity of the SimYB31 protein in a plant is reduced, the dry grain weight and/or the dry straw weight and/or the number of ears and/or the ear length and/or the number of grains per ear and/or the total number of grains per ear and/or the thousand-grain weight and/or the rice weight and/or the straw weight of the plant is reduced; when the content and/or activity of the SiMYB31 protein in a plant is increased, the dry grain weight and/or the dry straw weight and/or the number of ears and/or the ear length and/or the number of grains per ear and/or the total number of grains per ear and/or the thousand-grain weight and/or the rice weight and/or the straw weight of the plant is increased.

To achieve the above object, the present invention finally provides a method for breeding transgenic plants with improved stress tolerance and/or yield.

The method for cultivating the transgenic plant with improved stress tolerance and/or yield comprises the steps of improving the content and/or activity of SiMYB31 protein in a receptor plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance and/or higher yield than the recipient plant.

Further, the method of increasing the content and/or activity of a SiMYB31 protein in a recipient plant is by overexpressing a SiMYB31 protein in the recipient plant. The overexpression method is to introduce a gene coding for a SimYB31 protein into a recipient plant.

Further, the nucleotide sequence of the coding gene of the SiMYB31 protein is any one of C1) -C4). In a particular embodiment of the invention, the gene encoding the SiMYB31 protein is introduced into the recipient plant via an expression cassette as described above.

The stress tolerance is low nitrogen tolerance.

The transgenic plant has higher stress tolerance and/or yield than the acceptor plant and is embodied in any one of the following Y1) -Y9):

y1) the transgenic plant has a higher dry grain weight than the recipient plant;

y2) the transgenic plant has a higher straw dry weight than the recipient plant;

y3) the transgenic plant has more ears than the recipient plant;

y4) the spike length of the transgenic plant is longer than that of the recipient plant;

y5) the transgenic plant has more kernels per ear than the recipient plant;

y6) the transgenic plant has more total grains per ear than the recipient plant;

y7) the transgenic plant has a thousand kernel weight higher than that of the recipient plant;

y8) the transgenic plant has a higher straw weight than the recipient plant;

y9) the transgenic plant has a higher rice weight than the recipient plant.

In any of the above uses or methods, the plant may be a monocot or a dicot. Further, the monocotyledon may be a gramineae. Further, the gramineous plant is specifically rice (e.g., rice variety Kitaake) or millet (e.g., millet variety yu-gu No.).

The invention provides SiMYB31 protein related to plant stress tolerance and yield traits, and rice callus is infected by a DNA fragment only containing a promoter, a target gene SiMYB31 and a terminator by adopting a transformation method of a minimum expression frame (no vector skeleton sequence exists in the transformation fragment, so that the safety risk possibly brought by the vector skeleton sequence is reduced to the maximum extent), and then the transformed SiMYB31 rice is obtained. Experiments prove that: under the low nitrogen stress, the yield-related traits (spike number, spike length, grain number, thousand grain weight, straw weight, paddy weight and the like) of the SiMYB 31-transgenic rice are all higher than those of wild rice. The SiMYB31 protein has the function of regulating and controlling the stress tolerance and yield-related traits of plants, particularly improves the low-nitrogen tolerance and yield of the plants, and lays a foundation for cultivating stress-tolerant and high-yield plant varieties.

Drawings

FIG. 1 shows the molecular identification of SiMYB 31-transgenic rice, wherein the Marker is D L1000 Marker, the negative control is Kitaake, and the positive control is SiMYB31 plasmid, wherein the P is less than 0.05, indicating that the difference is obvious.

Fig. 2 is 2018 field data arrangement. Wherein CK is wild rice Kitaake; OE15 and OE21 are trans-SiMYB 31 rice.

FIG. 3 shows the low nitrogen stress identification result of SiMYB31 rice transferred in Jiangxi in 2019. FIG. 3A is a field phenotype of low nitrogen treatment (no nitrogen fertilizer application group) and normal treatment group (nitrogen fertilizer application group) at rice maturity. FIG. 3B is a table diagram showing 3 plants taken from the low nitrogen treatment (nitrogen fertilizer application group) and the normal treatment (nitrogen fertilizer application group), respectively. Wherein, the receptor (Kitaake) is wild rice Kitaake; m23543/21 is SiMYB31 transgenic rice.

FIG. 4 shows the results of the test data of 2019. Wherein, FIG. 4A shows the results of the data of the normal treatment group (nitrogen fertilizer application group). FIG. 4B shows the results of the test data of the low nitrogen treatment group (nitrogen fertilizer non-application group). WT is wild type rice Kitaake; OE21 was SiMYB31 transgenic rice.

FIG. 5 shows the results of 2019 measurements of biological yields. Wherein CK is wild rice Kitaake; OE21 was SiMYB31 transgenic rice.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

L P0471118-Bar-ubi-ED LL expression vector in the following examples is described in the literature, Ning bud, Wan Shuang Shi, Ju Peng lifting, Bai Xin Xuan, Ge Lin Hao, Qi Xin, Jiangqi, Sun Xijun, Cheng Ming, Sun Dai Zhen, over-expressed millet SiANT1 has influence on the salt tolerance of rice [ J ] China agricultural science, 2018,51(10): 1830-.

The marker gene bar expression vector pSBAR in the following examples is described in the literature: threepo, drought-resistant transgenic wheat [ D ] obtained by using an improved minimum expression cassette technology, university of inner mongolia agriculture, 2012, the public can be obtained from the institute of crop science of the Chinese academy of agricultural sciences, and the biomaterial is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

Example 1 acquisition of the SiMYB31 Gene

1. RNA extraction

Total RNA of two-week-old seedlings of millet (millet variety Yu Gu I) was extracted using RNA extraction kit (cat # ZP405K-1) of Jiang Union Internationality Biotech Co., Ltd, and the procedure was performed according to the instruction.

2. Obtaining cDNA

Mu.l of the total RNA extracted was subjected to reverse transcription using a reverse transcription kit (cat 311-02) of the all-fashioned gold Biotechnology Ltd according to the instructions to obtain cDNA.

3. PCR amplification

PCR amplification was carried out using 2. mu.l of the reverse-transcribed cDNA as a template using KOYOTO KOD FX (cat # KFX-101) which is a high fidelity enzyme to obtain a PCR amplification product (coding sequence of SiMYB 31). The primer sequences are as follows:

F：5’-ATGGGGAGGCCACCGTGCTG-3’；

R：5’-CTAGAACATGATGGGATCTG-3’。

4. PCR amplification product detection and sequencing

Carrying out 1% agarose gel electrophoresis detection on the obtained PCR amplification product, recovering and purifying to obtain a DNA fragment with the size of 843bp, recovering the PCR product by using a Takara glue recovery kit (product number: 9760) according to an instruction after the reaction is finished, sending the recovered product to Okosan biotech limited company for sequencing, and cloning the coding sequence of SiMYB31 to a pBlunt vector (the vector is carried by the kit) according to the instruction by using a zero background cloning kit (product number: CB501-01) of the whole gold biotechnology limited company after the sequencing is correct, wherein the coding sequence is named as pBlunt-SiMYB 31.

The sequencing result shows that: an amplification product with the size of 843bp is obtained by PCR amplification and is named as SiMYB31 gene, the nucleotide sequence of the amplification product is shown as sequence 1 in the sequence table, and the amino acid sequence of SiMYB31 protein coded by the SiMYB31 gene is shown as sequence 2 in the sequence table.

Example 2 obtaining of transgenic SiMYB31 Rice and analysis of stress tolerance and yield-related traits

First, obtaining of rice transformed with SiMYB31

1. Construction of recombinant vector psSiMYB31

The SiMYB31 gene fragment shown in sequence 1 was cloned between the Spe I and BamH I cleavage sites of vector L P0471118-Bar-ubi-ED LL using the seamless cloning kit (cat # 639649) from Clotech as described in the manual to obtain recombinant vector psSiMYB 31.

2. Obtaining a Linear minimum expression Box

(1) The recombinant vector psSiMYB31 obtained in the step 1 is subjected to double enzyme digestion by Hind III and EcoRI to obtain a linear minimum expression frame fragment of the SiMYB31 gene, and the linear minimum expression frame fragment of the SiMYB31 gene sequentially comprises a ubiquitin constitutive promoter (1.8kb), a SiMYB31 gene (843bp) and a terminator nos 3' (300 bp).

(2) And (3) digesting the marker gene bar expression vector pSBAR by using Hind III to obtain a linear minimum expression frame fragment of the bar gene, wherein the linear minimum expression frame fragment of the bar gene sequentially consists of a maize ubiquitin promoter, a marker gene bar and a terminator nos 3'.

3. Obtaining of recombinant bacteria

And (3) jointly transforming the linear minimum expression frame fragment of the SiMYB31 gene and the linear minimum expression frame fragment of the bar gene obtained in the step (2) into the agrobacterium EHA105 (purchased from Beijing Onggaku New Biotechnology Co., Ltd.) to obtain a recombinant strain.

4. Obtaining of transgenic Rice

And transforming the recombinant strain into a rice variety Kitaake callus by an agrobacterium infection method to obtain T0 generation transgenic rice. The specific transformation steps are as follows:

soaking immature rice embryos 12-14 days after pollination in 70% ethanol for 1 minute, then disinfecting the immature rice embryos for 15 minutes by 10% sodium hypochlorite, washing the immature rice embryos for 3-5 times by using sterile water, taking out the immature rice embryos on a super clean bench, and inoculating the immature rice embryos to SD (secure digital)₂Inducing the young embryo callus on a culture medium (MS basic culture medium (containing no vitamin) +2 mg/L2, 4-D +1 mg/L VB1+150 mg/L Asn asparagine +30 g/L sucrose +2.4 g/L plant gel with the pH value of 5.8) for 7 days, then transferring the induced callus to a hypertonic culture medium (MS basic culture medium +5 mg/L2, 4-D +0.4 mol/L mannitol +3 g/L plant gel) for hypertonic treatment for 4-6 hours, carrying out agrobacterium infection after the hypertonic treatment, continuously culturing the infected callus on the hypertonic culture medium for 16-18 hours, and then transferring the infected callus to SD (SD) plant gel₂Culturing for two weeks in the dark on a culture medium, and then placing the callus on a culture medium containing 2-3 mg/L of herbicide BialapthosSelection Medium (in SD)₂Adding 2-3 mg/L herbicide Bialaphos on the basis of the culture medium, and carrying out callus screening, differentiation and seedling strengthening on the mixture with the pH value being 5.8).

5. Identification of transgenic Rice

And (3) carrying out PCR identification on the T0 generation transgenic plants obtained in the step (4), carrying out PCR amplification to obtain plants with the size of 158bp as positive SiMYB31 rice (figure 1), and obtaining 5 positive SiMYB31 rice in total, wherein the positive rate is 2%. Through greenhouse generation adding, screening and identification, a SiMYB 31-transgenic rice strain M23543/15 (OE 15 for short) and a SiMYB 31-transgenic rice strain M23543/21 (OE 21 for short) are selected for the following functional verification experiments.

The specific steps of PCR identification are as follows:

1) extracting DNA from rice leaf by SDS method, taking 100-20M L CTAB lysate (0.1mM Tris-HCl (pH8.0), 0.02M EDTA (pH8.0), 1.5M NaCl, 2% PVP-4, 2% CTAB), adding equal volume of phenol: chloroform: isoamyl alcohol (phenol: chloroform: isoamyl alcohol volume ratio is 25:24:1) in water bath at 65 ℃ for 1-2h, mixing, standing for 5-10min, centrifuging at 12000rpm for 10min (if the rotation speed can not be reached), taking 1M L supernatant to 2M L centrifuge tube, adding isopropanol at 2/3 volume for precipitating DNA, standing at 20 ℃ for 0.5-1h, centrifuging at 12000rpm for 5min, pouring off supernatant (not pouring off precipitate), adding 1M L absolute ethanol, washing at 12000rpm, pouring off supernatant for 5min, adding 70% residual solution in a ventilating cabinet, adding 12000rpm, washing off ethanol, removing residual solution, centrifuging at 12000rpm, removing residual solution, drying by adding 70% ethanol, and drying₂And dissolving the O.

2) And (3) PCR amplification: and (2) designing primers for amplifying partial sequences according to the SiMYB31 gene sequence by using the DNA obtained in the step (1) as a template to perform PCR amplification, wherein the primer sequences are as follows:

F：5’-TCATCCACCTTCAGGCGTTG-3’；

R：5’-AGCGGTTTGGAAGGAG-3’。

the PCR conditions were as follows: denaturation at 94 deg.C for 5 min; 50sec at 94 ℃, 50sec at 62 ℃, 1min at 72 ℃ and 35 cycles; extension at 72 ℃ for 10 min.

The PCR reaction system is shown in Table 1.

TABLE 1 PCR reaction System

Composition (I)	Dosage (ul)
		10 × PCR buffer (containing Mg)²⁺)(Takara)	2.50
25mM Mg²⁺(Takara)	0.05
		2.5mM dNTP Mixture(Takara)	2.00
Primer 1	0.80
		Primer 2	0.80
r-Taq DNA Ploymerase(5U/ul)(Takara)	0.25
		Template	1.00
ddH₂O	17.6
		TOTAL	25

3) And (3) detecting a PCR product: PCR products were detected on 0.8% agarose gel and photographed by UV.

Second, stress tolerance and yield related trait analysis of SiMYB31 transgenic rice

And (3) analyzing the application of the SiMYB31 in regulation and control of the low nitrogen tolerance and yield-related traits of the rice by taking the SiMYB 31-transgenic rice strain M23543/15 (OE 15 for short) and the SiMYB 31-transgenic rice strain M23543/21 (OE 21 for short) obtained in the step one as test materials and taking wild rice Kitaake as a control.

1. 2018 test analysis method and result

Test site: transgenic test base of rice institute of agricultural science institute of Jiangxi province in Gao' an city of Jiangxi province. Seedling bed management is the same as field production. Each test material was able to grow normally.

The test method comprises the following steps of testing two treatment groups of facility nitrogen fertilizer and no nitrogen fertilizer, wherein each treatment group is provided with two repetitions, each material is planted in 6 rows with 8 bags in each row and 5 × 6 inches of row spacing, the single material is planted, the test area is 4.0 mu, and each group is specifically processed as follows:

nitrogen fertilizer application treatment group (normal treatment group): from the transplanting to the harvest time, 12 kg of pure nitrogen is applied to each mu. The nitrogen fertilizer application time is respectively a green-turning period (6 days after transplanting), a tillering period (15 days after transplanting) and a heading period. The applied nitrogen fertilizer is urea.

Nitrogen fertilizer treatment group (low nitrogen treatment group): no nitrogen fertilizer was applied from the time of transplanting to the time of harvest.

And (3) test results:

the dry grain weight and the dry straw weight of each material were measured at the rice maturity stage, respectively. Each treatment was repeated three times with 8 plants each.

The effective number of ears per plant, the number of grains per ear and the total number of grains per ear of each material were determined at the rice maturity stage. 3 plants were taken for each treatment and tested indoors for three replicates.

The results show that: under the treatment of no nitrogen fertilizer application, the average dry grain weight values of wild rice Kitaake, SiMYB 31-transgenic rice strain OE15 and SiMYB 31-transgenic rice strain OE21 are 150.5g, 144.3g and 166.4g respectively; the average dry weight of the straws of the wild type rice Kitaake, the SiMYB-transgenic 31 rice strain OE15 and the SiMYB-transgenic 31 rice strain OE21 is 92.13g, 130.08g and 105.1g respectively; the average values of the effective spike numbers of the single plants of wild rice Kitaake, SiMYB 31-transgenic rice strain OE15 and SiMYB 31-transgenic rice strain OE21 are 7.00, 9.33 and 7.00 respectively; the average number of grains per ear of wild rice Kitaake, SiMYB31 transgenic rice strain OE15 and SiMYB31 transgenic rice strain OE21 are 41.05, 41.64 and 57.24 respectively; the average total number of grains per ear of wild type rice Kitaake, SiMYB-transgenic 31 rice strain OE15 and SiMYB-transgenic 31 rice strain OE21 were 42.71, 44.07 and 61.14, respectively.

Compared with wild rice Kitaake, dry grain weight, dry straw weight, effective spike number per plant, number of grains per spike and total number of grains per spike of the SiMYB31 rice line strain are all higher than those of the wild rice Kitakke (figure 2).

2. 2019 test analysis method and result

And (3) test results:

photographs were taken during the rice maturity stage. The phenotypic results are shown in figure 3. The results show that: compared with wild rice Kitaake, the SiMYB 31-transgenic rice strain OE21 grows better and is more flourishing, and the low-nitrogen resistance is extremely obvious.

The effective ear number, ear length, seed number per ear, total seed number per ear, seed setting rate and thousand seed weight of each plant of each material are measured in the rice mature period. 3 plants were taken for each treatment and tested indoors for three replicates. The results are shown in table 2, table 3 and fig. 4. The results show that: under the treatment of applying nitrogen fertilizer and not applying nitrogen fertilizer, the biological yield traits of the SiMYB31 rice strain OE21, such as spike length, number of grains per spike, total number of grains per spike, thousand grain weight and the like, are all higher than those of wild rice kitakke. Under the condition of no nitrogen fertilizer application, the effective spike number of a single plant of the SiMYB31 rice line OE21 is also higher than that of wild rice kitakke.

The straw weight and the rice weight of each material were examined at the rice maturity stage. 20 plants were taken for each treatment and repeated three times. The results are shown in table 4, table 5 and fig. 5. The results show that: under the nitrogen fertilizer application treatment, the average rice straw weight values of Kitaake and SiMYB31 transgenic rice line OE21 are 390g and 526.7g respectively, and the average rice straw weight values of Kitaake and SiMYB31 transgenic rice line OE21 are 243.3g and 393.3g respectively; the average rice weights of Kitaake and SiMYB-transgenic 31 rice line OE21 were 193.3g and 300g, respectively, and the average rice weights of Kitaake and SiMYB-transgenic 31 rice line OE21 were 173.3g and 230g, respectively, without nitrogen fertilizer application. Under the treatment of applying nitrogen fertilizer and not applying nitrogen fertilizer, the rice straw weight and the rice weight of a SiMYB31 rice strain OE21 are higher than those of wild rice kitakke.

TABLE 2 results for the Normal treatment groups (12 kg of pure nitrogen per mu)

TABLE 3 results for low nitrogen treatment group (no nitrogen fertilizer application)

TABLE 4 weight of rice straw and weight of rice straw in nitrogen fertilizer application group

TABLE 5 weight of rice straw and rice without nitrogenous fertilizer

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> protein related to plant yield traits and stress tolerance and application thereof

<160>3

<170>PatentIn version 3.5

<210>1

<211>843

<212>DNA

<213>Artificial Sequence

<400>1

atggggaggc caccgtgctgcgacaatggc gtcggcgtca agaaggggcc ttggacgccg 60

gaggaggaca tcgtcctcgt ctcctacatc cagcagcatg gccccgggaa ctggcggtcc 120

gtgcccgaga acacagggtt gatgaggtgc agcaagagct gcaggctgcg gtggacaaac 180

tacctcaggc ccgggatcaa gcgcgggaac ttcacccctc acgaggaagg gatcatcatc 240

caccttcagg cgttgcttgg caacaagtgg gcagccatag cctcctacct ccctcaaaga 300

accgacaacg acatcaagaa ctactggaac acacacctca agaagaaggt gaagaggctg 360

caacagccag cagcggactc cttccaaacc gctccctcca acgcagtcac cagcccaaac 420

tactacagcc ccactagcag cagccaccac agtcttcaag gaatgcaacc catgaacagc 480

taccccaaca ccacctgcac cagcgcaccg agcaacaacg aggccgctgc cgtctccaac 540

ctcttccaga catggatgaa gccatcacca gcggcgacat ccaactgcaa gatcaccatg 600

caagagttcc aggaagaaca ggacgctgca gcttcaatgc tttgcaagga tcaggttgtg 660

atgacgacag gagatgttag caagtcttcg gcgttggaga tggtagtggc gccggtgatg 720

ggagcgagca ctgctacctt ctcgctgctt gaggactggc tgctcgagga catgcccggg 780

caggccatgg atgggctcat ggggatctct gccggctgct gtgcagatcc catcatgttc 840

tag 843

<210>2

<211>280

<212>PRT

<213>Artificial Sequence

<400>2

Met Gly Arg Pro Pro Cys Cys Asp Asn Gly Val Gly Val Lys Lys Gly

1 5 1015

Pro Trp Thr Pro Glu Glu Asp Ile Val Leu Val Ser Tyr Ile Gln Gln

20 25 30

His Gly Pro Gly Asn Trp Arg Ser Val Pro Glu Asn Thr Gly Leu Met

35 40 45

Arg Cys Ser Lys Ser Cys Arg Leu Arg Trp Thr Asn Tyr Leu Arg Pro

50 55 60

Gly Ile Lys Arg Gly Asn Phe Thr Pro His Glu Glu Gly Ile Ile Ile

65 70 75 80

His Leu Gln Ala Leu Leu Gly Asn Lys Trp Ala Ala Ile Ala Ser Tyr

85 90 95

Leu Pro Gln Arg Thr Asp Asn Asp Ile Lys Asn Tyr Trp Asn Thr His

100 105 110

Leu Lys Lys Lys Val Lys Arg Leu Gln Gln Pro Ala Ala Asp Ser Phe

115 120 125

Gln Thr Ala Pro Ser Asn Ala Val Thr Ser Pro Asn Tyr Tyr Ser Pro

130 135 140

Thr Ser Ser Ser His His Ser Leu Gln Gly Met Gln Pro Met Asn Ser

145 150 155 160

Tyr Pro Asn Thr Thr Cys Thr Ser Ala Pro Ser Asn Asn Glu Ala Ala

165 170 175

Ala Val Ser Asn Leu Phe Gln Thr Trp Met Lys Pro Ser Pro Ala Ala

180 185 190

Thr Ser Asn Cys Lys Ile Thr Met Gln Glu Phe Gln Glu Glu Gln Asp

195 200 205

Ala Ala Ala Ser Met Leu Cys Lys Asp Gln Val Val Met Thr Thr Gly

210 215 220

Asp Val Ser Lys Ser Ser Ala Leu Glu Met Val Val Ala Pro Val Met

225 230 235 240

Gly Ala Ser Thr Ala Thr Phe Ser Leu Leu Glu Asp Trp Leu Leu Glu

245 250 255

Asp Met Pro Gly Gln Ala Met Asp Gly Leu Met Gly Ile Ser Ala Gly

260 265 270

Cys Cys Ala Asp Pro Ile Met Phe

275 280

<210>3

<211>1800

<212>DNA

<213>Artificial Sequence

<400>3

gggacaggta ggagataaag ctgctgctgc aggttacaaa ggtgacttgg tgtggtgtgt 60

cctagaataa aaggagccag cagagagggt accagcaaga aggccggaag gtttcggagg 120

ccgttgtgca gggccatggc tgtgtaggca gcagccagag ctttcttgct cctcaacttg 180

cctatctgct agctaataag actagctcta gctaggtgta tccgaggtag gaggcagcag 240

gtatggggag gccaccgtgc tgcgacaatg gcgtcggcgt caagaagggg ccttggacgc 300

cggaggagga catcgtcctc gtctcctaca tccagcagca tggccccggg aactggcggt 360

ccgtgcccga gaacacaggt tagttgggat ctcagccagc tcatcacagg cgctctagat 420

gtttggttgc gcttggtttt ggttttcttt gagtgtgctt ggttttgtag tttgtgctta 480

gttatttgag agaagtgtgt ttcatggttt gatgttgcgt gtatgtttga tttagggttg 540

atgaggtgca gcaagagctg caggctgcgg tggacaaact acctcaggcc cgggatcaag 600

cgcgggaact tcacccctca cgaggaaggg atcatcatcc accttcaggc gttgcttggc 660

aacaagtaat caccattcct aaaattgatt cttttagcta gaacctctct aagaattgtt 720

gatgtaccac tatgcaagga ccgattaaaa gttacattaa atctagcata gactcacaac 780

tttatttcgt aaaacctacc aacttcatat ccatcattgg cttaaaaaaa tgattcaatt 840

ccatttcgat ggcaagtaca agattgaaat aggtcaagca aagccctgac taactgtata 900

ataacataat ttatagcgtc ccaacaataa tgttctttgt ctcccatact cttactaata 960

ctataatatg gtgtctaaca tatcttgtgc atacatacag gtgggcagcc atagcctcct 1020

acctccctca aagaaccgac aacgacatca agaactactg gaacacacac ctcaagaaga 1080

aggtgaagag gctgcaacag ccagcagcgg actccttcca aaccgctccc tccaacgcag 1140

tcaccagccc aaactactac agccccacta gcagcagcca ccacagtctt caaggaatgc 1200

aacccatgaa cagctacccc aacaccacct gcaccagcgc accgagcaac aacgaggccg 1260

ctgccgtctc caacctcttccagacatgga tgaagccatc accagcggcg acatccaact 1320

gcaagatcac catgcaagag ttccaggaag aacaggacgc tgcagcttca atgctttgca 1380

aggatcaggt tgtgatgacg acaggagatg ttagcaagtc ttcggcgttg gagatggtag 1440

tggcgccggt gatgggagcg agcactgcta ccttctcgct gcttgaggac tggctgctcg 1500

aggacatgcc cgggcaggcc atggatgggc tcatggggat ctctgccggc tgctgtgcag 1560

atcccatcat gttctagttg tattgtgcct tggctatcac ataggattct caatgagtcg 1620

tgcacttgta atgttggttg atcgaatgat aagatccggt cgatcctatg tttccggtaa 1680

taagccgttt gtttcctcgg ggaaaaaatc ctggagatga tccagttaat ttcgagatat 1740

tagtagtact gatggattaa taaaatggtt tagacttcag tacctaattt ggatattcat 1800

Claims

1. The application of the protein shown in A1) or A2) or A3) or A4) in regulating and controlling plant stress tolerance and/or plant yield related traits is as follows:

2. Use of a biological material related to a protein as defined in claim 1 for modulating stress tolerance and/or plant yield-related traits in a plant;

the biological material is any one of the following B1) -B10):

B1) a nucleic acid molecule encoding the protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic cell line comprising the nucleic acid molecule of B1);

B10) a transgenic cell line comprising the expression cassette of B2).

3. Use according to claim 2, characterized in that: B1) the nucleic acid molecule is any one of the following C1) -C4):

C1) the coding sequence is a DNA molecule shown in a sequence 1 in a sequence table;

C2) DNA molecule shown in sequence 3 in the sequence table;

C3) a DNA molecule having at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule sequence defined in C1) or C2) and encoding the protein of claim 1;

C4) a DNA molecule which hybridizes under stringent conditions with a DNA molecule defined in C1) or C2) or C3) and which encodes a protein as claimed in claim 1.

4. Use according to any one of claims 1 to 3, characterized in that: the modulation is an increase.

5. Use of a protein according to claim 1 or a biological material according to claim 2 or 3 for the cultivation of transgenic plants with increased stress tolerance and/or yield;

or, use of the protein of claim 1 or the biological material of claim 2 or 3 in plant breeding.

6. Use according to any one of claims 1 to 5, characterized in that: the stress tolerance is low nitrogen tolerance;

or, said plant yield-related traits comprise dry grain weight and/or dry straw weight and/or ear number and/or ear length and/or number of grains per ear and/or total grains per ear and/or thousand grain weight and/or rice weight and/or straw weight;

alternatively, the breeding is aimed at breeding plants with high stress tolerance and/or high yield.

7. A method for producing a transgenic plant with improved stress tolerance and/or yield, comprising the steps of increasing the content and/or activity of the protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance and/or higher yield than the recipient plant.

8. The method of claim 7, wherein: the method for increasing the content and/or activity of the protein of claim 1 in a recipient plant comprises overexpressing the protein of claim 1 in the recipient plant;

alternatively, the overexpression method is to introduce a gene encoding the protein of claim 1 into a recipient plant.

9. The method according to claim 7 or 8, characterized in that: the stress tolerance is low nitrogen tolerance;

or, the transgenic plant has higher stress tolerance and/or higher yield than the recipient plant in any one of the following Y1) -Y9):

y3) the transgenic plant has more ears than the recipient plant;

y5) the transgenic plant has more kernels per ear than the recipient plant;

y8) the transgenic plant has a higher straw weight than the recipient plant;

y9) the transgenic plant has a higher rice weight than the recipient plant.

10. The use according to any one of claims 1 to 6 or the method according to any one of claims 7 to 9, wherein: the plant is a monocotyledon or a dicotyledon.