CN111440238B - Nano antibody of anti-human transforming growth factor beta 1 and preparation method and application thereof - Google Patents

Abstract

The invention discloses a nano antibody of anti-human transforming growth factor beta 1 and a preparation method and application thereof, belonging to the field of biological pharmacy. The preparation method adopts phage display technology and biological panning technology to obtain the nano antibody of the anti-human transforming growth factor beta 1 with higher binding force with antigen. The nano-antibody can be specifically matched with three forms of natural TGF-beta 1 protein: the LAP precursor, the TGF-beta 1 monomer and the dimer are combined, and the composition has the characteristics of strong specificity and high affinity, can effectively neutralize autocrine or paracrine TGF-beta 1 in a tumor microenvironment, and provides a gene tool for the aspects of tumor immunotherapy, wound healing treatment, tissue repair, embryonic development promotion and the like.

Description

Nano antibody of anti-human transforming growth factor beta 1 and preparation method and application thereof

Technical Field

The invention belongs to the field of biological pharmacy, relates to a nano antibody resisting human transforming growth factor beta 1 and a preparation method and application thereof, and particularly relates to 6 nano antibodies resisting human transforming growth factor beta 1 and having high specific recognition and high affinity for human transforming growth factor beta 1, and a preparation method and application thereof.

Background

Transforming growth factor beta (TGF- β) is one of the cytokines that regulate cell growth, differentiation, and immune function. At present, the human TGF-beta superfamily has four members of TGF-beta 1, TGF-beta 2, TGF-beta 3 and TGF-beta 1 beta 2, wherein, the TGF-beta 1 has the functions of regulating cell proliferation and differentiation, controlling synthesis and degradation of extracellular matrix protein and the like, and can also participate in the processes of embryogenesis, bone generation, tissue remodeling, wound healing and the like. However, during malignant progression of tumors, highly activated expression of TGF-. beta.1 is detectable in almost all tumor cells, and its action switches from cancer suppressor to cancer promotor. Clinically, the level of TGF-beta 1 in serum of a tumor patient is also closely related to the malignancy degree and prognosis of the tumor. After TGF-beta 1 is combined with a receptor thereof, the growth, invasion and metastasis of tumors can be promoted by accelerating angiogenesis, epithelial-mesenchymal transformation, enhancing matrix modification and other modes; TGF-. beta.1 signaling pathways may also prevent T cells from differentiating into cytotoxic T lymphocytes, reduce the antigen presenting capacity of dendritic cells, inhibit the production of IFN-. gamma.and TNF-. alpha.and the like. Therefore, TGF-beta 1 can inhibit anti-tumor immune response and plays an important role in the immune escape process of tumor, so that the blocking of TGF-beta 1 by a neutralizing antibody is one of the key points of tumor immunotherapy.

Research has shown that blocking antibodies targeting TGF-beta 1 signal pathway, such as anti-TGF-beta 1 antibody Fressolimumab (GC1008), anti-TGF-beta 1 receptor antibody Lapatimab (AB0213) and the like, can significantly reduce the synthesis of tumor matrix protein and the number of fibroblasts, and further inhibit the growth and migration of tumors; however, most of the existing complete antibodies have the defects of high immunogenicity, poor solubility, easy adhesion and aggregation, easy degradation by protease and the like, and limit the application of the protein antibodies in blocking TGF-beta 1 and further inhibiting the growth and migration of tumors.

Disclosure of Invention

In view of one or more of the problems of the prior art, an aspect of the present invention provides a nanobody against human transforming growth factor beta 1, having high specificity and high affinity for human transforming growth factor beta 1, the nanobody having an amino acid sequence comprising any one of the following a) to f):

a) an amino acid sequence shown as SEQ ID NO. 10 in the sequence table;

b) an amino acid sequence shown as SEQ ID NO. 12 in the sequence table;

c) an amino acid sequence shown as SEQ ID NO. 14 in the sequence list;

d) an amino acid sequence shown as SEQ ID NO. 16 in the sequence list;

e) 18 in the sequence table;

f) 20 in the sequence table.

In another aspect, the invention provides a nucleotide coding sequence encoding the amino acid sequence of the nanobody.

The nucleotide coding sequence comprises any one of the following a ') -g'):

a') a nucleotide sequence shown as SEQ ID NO. 11 in the sequence table;

b') a nucleotide sequence shown as SEQ ID NO. 13 in the sequence table;

c') a nucleotide sequence shown as SEQ ID NO. 15 in the sequence table;

d') a nucleotide sequence shown as SEQ ID NO. 17 in the sequence table;

e') a nucleotide sequence shown as SEQ ID NO. 19 in the sequence table;

f') a nucleotide sequence shown as SEQ ID NO. 21 in the sequence table;

g ') a nucleotide sequence which hybridizes under high stringency conditions with a nucleotide sequence set forth in any one of a ') to f '); the high stringency conditions are hybridization and membrane washing in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃.

In yet another aspect, the present invention provides an expression vector comprising the nucleotide coding sequence described above.

The expression vector is obtained by inserting the nucleotide coding sequence into a pGEX6P.1 prokaryotic expression vector.

Host cells containing the above-described expression vectors, including but not limited to E.coli DH5 alpha competent cells, E.coli BL21(DE3) competent cells, are also included in the present invention.

In yet another aspect, the present invention provides a tumor therapeutic drug, which comprises the aforementioned nanobody and/or the aforementioned nucleotide coding sequence and/or the aforementioned expression vector and/or the aforementioned host cell;

preferably, the tumor therapy medicament further comprises a pharmaceutically acceptable carrier, including but not limited to: a cytotoxin, a radioisotope, an immunomodulator, an anti-angiogenic agent, an antiproliferative agent, a pro-apoptotic agent, a chemotherapeutic agent or a therapeutic agent for a therapeutic nucleic acid.

Such tumors include, but are not limited to: lung cancer, ovarian cancer, breast cancer, lymphoma, cervical cancer, liver cancer, gastric cancer, and glioma.

The invention also provides a preparation method of the nano antibody, which comprises the following steps:

1) constructing recombinant plasmid for expressing fusion protein TGF-beta 1, expressing and purifying to obtain purified fusion protein TGF-beta 1;

2) immunizing alpaca with the purified fusion protein TGF-beta 1 obtained in the step 1) as an antigen;

3) screening a gene sequence which can have high binding force with the purified fusion protein TGF-beta 1;

4) carrying out protein induction expression on the gene sequence obtained in the step 3).

The screening in the step 3) adopts an affinity elutriation screening method.

The preparation method of the nano antibody TGF-beta 1-VHH based on the technical scheme adopts the phage display technology to express the nano antibody TGF-beta 1-VHH; the nano antibody with higher binding force with the antigen is screened out by a biological elutriation technology. The data show that the nano antibody TGF-beta 1-VHH obtained by the invention can be specifically matched with three forms of natural TGF-beta 1 protein: the LAP precursor, the TGF-beta 1 monomer and the dimer are combined, and the composition has the characteristics of strong specificity and high affinity, can effectively neutralize autocrine or paracrine TGF-beta 1 in a tumor microenvironment, and provides a new effective means for the immunotherapy of tumors.

Drawings

FIG. 1 is an agarose gel electrophoresis image of construction and identification of eukaryotic expression plasmid cFUGW-TGF-beta 1;

FIG. 2 is a transient expression image of recombinant TGF-beta 1 protein in HEK-293T cells, wherein A and B represent fluorescence detection images for green fluorescent protein expression, and C and D represent images for polyacrylamide gel electrophoresis detection of recombinant TGF-beta 1 protein expression;

FIG. 3 is a Coomassie brilliant blue identification image of gel electrophoresis of affinity chromatography purified protein of recombinant TGF-beta 1;

FIG. 4 is an image of agarose gel electrophoresis detection and a photograph of a phage library bacterial plate in the construction of a phage VHH display library;

FIG. 5 is a histogram of ELLSA binding detection and sequence alignment images of the Nanobody TGF-beta 1-VHH and recombinant TGF-beta 1 protein;

FIG. 6 is a gel electrophoresis image of prokaryotic induced expression and purification of a nanobody TGF-beta 1-VHH;

FIG. 7 is a detection image of the binding specificity of a nano antibody TGF-beta 1-VHH and a tumor cell TGF-beta 1;

FIG. 8 is a graph showing the affinity detection of the nano antibody TGF-beta 1-VHH and the recombinant TGF-beta 1.

Detailed Description

The nano-antibody is a special antibody with a natural deletion of a light chain in the peripheral blood of alpaca, is the currently known minimum antigen binding unit of natural origin, is called a nano-antibody, only consists of a VHH heavy chain variable region and CH2 and CH3 constant regions, and an independent VHH region has the same specific antigen binding capacity. In addition, the recombinant human antibody has the advantages of small molecular drugs and anti-transfer antibodies, has the advantages of good solubility, low immunogenicity, strong penetrating power, simple humanization and the like, and is suitable for various expression systems. Aiming at the defects that most of the blocking antibodies targeting a TGF-beta 1 signal path in clinical application are complete antibodies and have high immunogenicity, poor solubility, high tendency to be adhered and aggregated, high tendency to be degraded by protease and the like, the invention prepares the alpaca-derived anti-TGF-beta 1 nano antibody on the basis of the nano antibody.

The present invention will be described in further detail with reference to the following specific embodiments and the accompanying drawings.

The following disclosure provides many different embodiments, or examples, for implementing different aspects of the invention. The present invention provides examples of various specific processes and materials, but one of ordinary skill in the art may recognize the application of other processes and/or the use of other materials.

The embodiments are implemented on the premise of the technical scheme of the invention, and detailed implementation modes and specific operation processes are given, but the disclosure of the invention is not limited to the following embodiments.

The methods used in the following examples are conventional methods unless otherwise specified.

Cell lines used in the examples of the invention:

NCI-H520 Lung cancer cells: performing adherent culture in RPMI-1640 culture medium containing 10% FCS; HEK-293T human embryonic kidney epithelial cell line: carrying out adherent culture by using a DMEM culture medium containing 10% fetal calf serum; the cell lines were purchased from the cell center of the Chinese academy of medical sciences.

The experimental animal alpaca used in the examples of the present invention was an adult healthy alpaca of 3 years old, purchased from inner mongolian farms.

Strains and plasmid vectors used in the examples of the invention:

escherichia coli DH 5. alpha. competent cells and Escherichia coli TG1 cells were purchased from Takara Bio Inc. The genotype is: supE44 Δ lacU169

hsdR17 recA1 end1 gyr96 thi-1 relA1。

M13K07 helper phage was purchased from Beijing Quanjin Biotechnology, Inc.

The cFUGW eukaryotic expression vector (Lois et al Science 2002 Feb 1:295(5556):868-72 Germine transmission and tissue-specific expression of genes delayed by viral vectors), pGEX6P.1 prokaryotic expression vector, and phage pMECS vector are all stored in the laboratory of national institute of medicine and technology, Inc. (Beijing).

The main tools used in the examples of the invention were enzymes and reagents:

FastStart Taq DNA polymerase (Roche Bio Inc., Switzerland); phusion high-fidelity DNA polymerase, Nde I, Xho I, No tI, EcoR I, Age I, T4 DNA ligase (New England Biolabs bioengineering, Inc., USA); IPTG, protease inhibitors, TaqMix (Toyobo Co., Japan); glycine, bromophenol blue (Amresco, usa); ammonium persulfate, acrylamide, methanol and protein membrane imprinting regeneration liquid (China kang is century Co., Ltd.); skimmed milk powder for sealing (Chipley corporation).

The main instruments used in the examples of the present invention:

OptimaL-100XP ultrarefrigerated centrifuge (Beckman, USA); LSM780 laser confocal microscope (Zeiss, germany); AccuriC6 flow cytometer (BD, usa); thermal cycler, ultraviolet transilluminator, Transblot SD semidry transfer apparatus, electrophoresis apparatus (BioRad, usa); ECL autovisualizer (CLiNx Science Instruments); an electroporator and a 0.1cm electroporation cuvette (Gene Pulser).

Example 1 construction of eukaryotic expression plasmid cFUGW-TGF-. beta.1 and purification of protein expression

The human TGF-beta 1 standard full-length DNA sequence (containing three parts of N-terminal signal peptides (1-39 aa), LAP precursor structures (30-278 aa) and C-terminal TGF-beta monomers (279-390 aa), wherein the length of the coding nucleotide sequence is 1173bp, and is shown as SEQ ID NO:1 in the sequence table) used in the embodiment is stored in a Gateway Cloning vector (obtained by a conventional Gateway gene Cloning technology).

The embodiment specifically comprises the following steps:

1.1, firstly, designing an upstream primer F and a downstream primer R for amplifying and obtaining a TGF-beta 1 standard full-length DNA sequence by utilizing a Snapgene program, and respectively introducing Age I and EcoR I enzyme cutting sites (underlined parts in sequences of the upstream primer F and the downstream primer R) and protective bases thereof; in addition, a Kozak sequence (black bold part in the sequence of the upstream primer F) is added before the initiation codon of the target sequence, and a 6His sequence (black bold part in the sequence of the downstream primer R) is introduced downstream for subsequent purification of the target protein.

An upstream primer F:

a downstream primer R:

1.2, using the standard full-length DNA sequence of human TGF-beta 1 in the Gateway Cloning vector as a template, and using 2 XPisuion Master PCR enzyme, an upstream primer F and a downstream primer R as a system to perform polymerase chain reaction, wherein the annealing temperature is 70 ℃ and 0 system. Collecting the PCR products, and performing gel electrophoresis test on the products, as shown in A in FIG. 1, wherein lane 1-2 respectively represents the electrophoresis results of the PCR products at the annealing temperatures of 70 ℃ and 65 ℃, M represents Marker, and it can be seen that the target PCR product band with the fragment size of 1188bp (as indicated by the arrow in the figure) is obtained under the conditions of the annealing temperatures of 70 ℃ and 65 ℃. Purifying the PCR product by using a column type DNA recovery kit (purchased from Biotechnology engineering Co., Ltd.), respectively carrying out double enzyme digestion reaction on a cFUGW no-load vector and the PCR purified product by using restriction enzymes Age I and EcoR I to obtain two linearized fragments with the same viscosity ends, connecting the enzyme digestion products of the two linearized fragments at 16 ℃ overnight in the presence of T4 ligase, and transforming to obtain a recombinant plasmid named as cFUGW-TGF-beta 1 recombinant plasmid, wherein an original GFP fragment in the cFUGW vector is replaced by a TGF-beta 1 fragment. Pac I and Ahd I double enzyme digestion identification is carried out on the obtained cFUGW-TGF-beta 1 recombinant plasmid, as shown in B in figure 1, wherein lane 1-3 is expressed as cFUGW-TGF-beta 1/PacI + AhdI (3518bp +6895bp), lane4 is expressed as cFUGW-TGF-beta 1 non-enzyme digestion negative control, and M is expressed as 1kb DNA Ladder. The result is the same as the predicted result of Snapgene software in the process of designing the primers; and further sequencing results show that the construction of the cFUGW-TGF-beta 1 recombinant plasmid is successful.

1.3 according to the requirements of the jetPRIME Polyplus transfection kit, using HEK-293T cells to transiently transfect the cFUGW-TGF-beta 1 recombinant plasmid as a test group, and performing 5% CO at 37 DEG C ₂ Continuously culturing under the conditionAnd (3) culturing cells, and setting a cFUGW no-load plasmid as a negative control group. When the test and control groups were observed for Green Fluorescent Protein (GFP) after 24 hours of culture, as shown in FIG. 2, it was found that in the cFUGW-TGF-. beta.1 recombinant plasmid, no fluorescence appeared (B in FIG. 2) since the original GFP of the cFUGW vector had been replaced with a TGF-. beta.1 fragment, whereas the cFUGW-unloaded plasmid could normally detect green fluorescence (A in FIG. 2).

After culturing for 48-72 h, aseptically collecting cell culture supernatant and filtering with a 0.45 μm filter membrane to obtain a crude recombinant fusion protein with a 6His tag. As the molecular weight of the 6His label introduced into the end of the obtained fusion protein TGF-beta 1 is extremely small, and the fusion protein TGF-beta has the advantages of low immunogenicity, no change of self solubility, no influence on protein folding, simple and easy affinity chromatography operation and the like, the HisTrap-Ni SepharoseExcel series filler can be used for purifying the recombinant fusion protein, and the immunological activity of the recombinant fusion protein can be maintained to the maximum extent. In this example, crude 6 His-tagged fusion protein obtained as described above was purified on-machine using HisTrap Column. Wherein the balance buffer solution is a 20mM sodium phosphate solution with pH of 7.2, the washing buffer solution is a sodium phosphate solution containing 20mM imidazole, and the elution buffer solution is a sodium phosphate solution containing 500mM imidazole; the flow rates of the sample loading and elution were set to 2mL/min and 4mL/min, respectively. And collecting the protein sample before and after purification and the flow-through liquid, and detecting the protein purity by using Coomassie brilliant blue staining and detecting the protein expression by using Western Blot. Wherein 12% SDS-PAGE gel is prepared, electrophoresed, added with primary antibody (CST/rabbit source His-Tag, D3I10XPO) and corresponding species secondary antibody (goat anti-rabbit IgG-HRP (purchased from Beijing Tribloyue biotechnology, Inc.)) (1:2000 dilution) for incubation for 1h, and then placed into an ECL autoradiograph for exposure and imaging.

As shown in the C and D panels in FIG. 2, protein expression results were detected by Western blot, wherein Lane1/2 represents cell culture supernatant/cell lysate of untransfected recombinant plasmids, Lane 3/4-5/6 represents cell culture supernatant/cell lysate of transfected recombinant plasmids, M represents protein molecular weight standard, and GAPDH is used as internal reference. The result shows that LAP precursor (55kDa), TGF-beta 1 monomer (12kDa) and a small amount of dimer (25kDa) can be successfully detected in culture supernatant after HEK-293T cells are transfected by the recombinant plasmid; whereas only LAP precursors were detected in cell lysates. Since TGF-. beta.1 is a pluripotent cytokine secreted by most cells, expression of a small amount of LAP precursor was also detectable in the supernatant of untransfected HEK-293T cells.

FIG. 3 (panels A and B) shows the results of Coomassie brilliant blue staining for detecting the protein purification effect by affinity chromatography, wherein lane1 represents the supernatant before purification, 2 represents the flow-through solution, 3 to 7 represent different purification elution wells, and M represents the protein molecular standard. The results show that three forms of TGF-beta 1 in Lane3/4 holes are well purified.

According to the above fusion protein assay results, it was confirmed that this example obtained a fusion protein with a good purity, in which a 6His tag was introduced into the end, and named TGF- β 1 purified protein, which contained three forms of TGF- β 1: LAP precursors, TGF- β 1 monomers and dimers thereof.

Example 2: construction of alpaca phage VHH display library

In this embodiment, the construction of a VHH gene library by immunizing alpaca with the TGF- β 1 purified protein obtained in example 1 specifically includes the following steps:

2.1, primary immunization, 1mg of TGF-beta 1 purified protein (obtained in example 1) and complete Freund's adjuvant 1:1 are mixed in equal volume and fully emulsified, and the alpaca is immunized by adopting a subcutaneous injection mode; then, 0.5mg of TGF-beta 1 purified protein 1:1 is used for 4 times of boosting immunity by equal volume of incomplete Freund's adjuvant mixing; a total of 5 immunizations were given at 20 days intervals. And (3) extracting a small amount of alpaca peripheral blood to carry out potency detection, carrying out boosting immunization again when the immune potency is more than 1:60000, and collecting 100mL of anticoagulated blood at the jugular vein of the immunized alpaca after 24 hours. Extracting peripheral blood lymphocytes from the anticoagulated blood, and isolating total RNA using TRIZOL reagent in SuperScript ^TM II obtaining the cDNA under the action of reverse transcriptase and oligo-dT primer.

2.2, using the cDNA obtained as a template, performing first PCR amplification by using a CALL001 primer, a CALL002 primer and FastStart Taq DNA polymerase shown in the following table 1, wherein the reaction systems are all 50 mu L, incubating for 7 minutes at 95 ℃, and then performing 30-35 PCR cycles to denature the cDNA and activate the polymerase, wherein each cycle comprises 94-60 s, 55-60 s and 72-60 s. After the last PCR cycle, a final DNA extension step was performed at 72 ℃ for 10 min. The first PCR product was then subjected to agarose electrophoresis, as shown in FIG. 4, panel A, and the 700bp bands were recovered and pooled for the electrophoresis result to be used as a template for the second PCR (nested PCR); subsequently, a second PCR amplification was performed using the VHH-BACK primer and PMCF primer shown in Table 1 below, the reaction system was identical to the first PCR amplification, the DNA template was denatured and the polymerase was activated by incubating at 95 ℃ for 7 minutes, and then 17-20 PCR cycles were performed, each cycle consisting of 94-45 s, 55-45 s and 72-45 s. After the last PCR cycle, a DNA extension step was performed at 72 ℃ for 10 min. And then, carrying out agarose electrophoresis on the obtained PCR product, as shown in B in figure 4, collecting and purifying a 400bp estimated amplification band as an electrophoresis result, and obtaining a heavy chain variable region (VHH) fragment of the antibody of the natural deleted light chain in the alpaca peripheral blood.

Table 1: primers for construction of alpaca phage VHH display library

2.3, after the purified nested PCR product (400bp amplification band) and the phage pMECS vector are subjected to double enzyme digestion of Pst I and Not I, the enzyme digestion products are connected at 16 ℃ in the presence of T4 ligase according to the molar ratio of 1:3, and then are electrically transformed into Escherichia coli TG1 competent cells. Shake culturing the electrically transformed bacterial liquid in LB liquid culture medium at 37 deg.C for 1 hr, diluting 1 microliter to 10 deg.C ³ 、10 ⁶ 、10 ⁹ After doubling, the surface of an LB solid culture dish is coated for library capacity determination, the rest of the bacterial liquid is coated on the surface of the LB solid culture dish, TG1 cells are cultured in an incubator at 37 ℃ overnight, and all colonies are collected as a VHH antibody library the next day. The positive cloning efficiency (i.e. the VHH fragment insertion rate) of the VHH fragment was identified by colony PCR using the primers: MP 57: TTATGCTTCCGGCTCGTATG (SEQ ID NO: 8); GIII: CCACAGACAGCCCTCATAG (SEQ ID NO:9) at a final concentration of 0.4m M, and the results in FIG. 4, panel C, show that the positive cloning efficiency of the VHH fragment is around 70%, demonstrating that VHH is obtainedAntibody libraries. The following formula was used according to the PCR positive cloning efficiency: the library capacity (number of clones on a measuring culture dish, dilution times, PCR identification positive cloning rate and bacterial liquid volume (unit: microliter) is 1.2 multiplied by 10 ⁸ 。

2.4 streaking M13K07 helper phage on 2YT solid medium. Well-spaced plaques are picked for propagation, and the titer is 1 multiplied by 10 ¹² cfu/ml of helper phage M13K 07. And (3) infecting the VHH antibody library obtained in the step 2.3 by using the auxiliary phage M13K07, performing overnight culture, precipitating supernatant by using a PEG/NaCl (20 percent and 2.5M) solution, performing sterile PBS suspension precipitation, and separating recombinant phage particles, namely the alpaca phage VHH display library.

Determination of alpaca phage VHH display library titers: subjecting the obtained recombinant phage particle stock solution to 1:10 ⁶ 、1:10 ⁷ 、1:10 ⁸ The cells were subjected to gradient dilution, 1. mu.l each of the infected TG1 cells was used for 15 minutes, the ampicillin-resistant LB solid plate was coated, and the colony formation in the plate was observed the next day according to the formula (number of colonies. times.10 times dilution factor) ³ ) Phage titers (pfu) were calculated. As shown in D in FIG. 4, the numbers of plaques at 1:10000000 and 1:1000000 dilution times are shown in the left and right panels, respectively, so that the titer of the alpaca phage VHH display library can be estimated to be 1.2X 10 ¹³ pfu。

Example 3: screening of Positive clones expressing Nanobody TGF-beta 1-VHH

3.1: simplified steps of affinity panning:

(1) the tubes were coated with the TGF-. beta.1 purified protein obtained in example 1 overnight at 4 ℃.

(2) The tube was washed 3 times with PBS and patted dry.

(3) Blocking with 3% MPBS (3% skim milk in PBS), incubating at 37 deg.C for 2h, decanting the blocking solution, washing the tube with PBS 3 times, and patting dry.

(4) The alpaca phage VHH display library (phage library) prepared in example 2 above was added to the blocked immune tubes at 2 ml/tube, incubated with gentle shaking for 30min, and then incubated with standing for 1.5 h.

(5) Discard the in-tube phage library, wash 3 times with PBST, wash 3 times with PBS, pat dry.

(6) The bound phage library was eluted by adding host bacterium TG 1. This completes the first round of panning to obtain the primary screening antibody library.

(7) Repeating the steps 4), 5) and 6) of panning, and performing circulating panning, and finally performing 4 rounds of panning to obtain a four-level screening antibody library.

3.2, indirect Phage Elisa primary screening of antigen-positive nanobodies:

(1) after 4 rounds of panning, individual colonies growing on 2YTAG plates were picked and plated onto 72-well plates, labeled MasterPlate, incubated overnight at 30 ℃ with shaking.

(2) The next day, another 72 well Plate was taken and 400. mu.L of the Plate containing M13K07 adjuvant was added to each well, and the Plate was designated as P1 Plate.

(3) From the overnight culture of MasterPlate each hole 40 u L culture fluid to P1Plate, 37 degrees C shaking culture overnight; centrifuging at 1500g for 20min, and carefully keeping the supernatant for later use to obtain the recombinant expression antibody.

(4) The 96-well elisa plate was coated with TGF- β 1 purified protein.

(5) 160. mu.L of the recombinant expression antibody was mixed with 40. mu.L of PBS and incubated at room temperature for 20 min. Adding into the sealed enzyme labeling hole, and binding reaction at 37 ℃ for 2 hours.

(6) Washing and adding an enzyme-labeled secondary antibody: the enzyme-labeled anti-M13K 07 antibody was diluted with PBS at a ratio of 1:4000, and incubated at 200. mu.L/well at 37 ℃ for 1 hour.

(7) Adding 200 μ L/well TMB color developing solution, incubating at 37 deg.C for about 45min for color development, stopping color development with 100 μ L/well stopping solution, and reading at 405 nm. A reading at least 2-fold greater than the negative control is considered a positive clone.

Through indirect Phage Elisa primary screening, and comparison with negative control, the result is shown in A frame in figure 5, 6 strains of positive clones which are respectively numbered as C5, F6, C8, F4, G6 and G8 are obtained through co-screening in 17 randomly selected clones, can express nanometer antibodies which are specifically combined with TGF-beta 1 purified protein, and are uniformly named as nanometer antibodies TGF-beta 1-VHH (nanometer antibodies TGF-beta 1-VHH which are correspondingly expressed by C5, F6, C8, F4, G6 and G8 positive clone strains are respectively named as C5 nanometer antibodies, F6 nanometer antibodies, C8 nanometer antibodies, F4 nanometer antibodies, G6 nanometer antibodies and G8 nanometer antibodies). Sequencing the nanometer antibody TGF-beta 1-VHH (namely VHH region) expressed by the 6 strains of positive clones, wherein the amino acid sequences of the nanometer antibody TGF-beta 1-VHH expressed by the six strains of positive clones are respectively as follows: c5 nano antibody (SEQ ID NO:10, corresponding nucleotide sequence is shown as SEQ ID NO:11 in the sequence table), F6 nano antibody (SEQ ID NO:12, corresponding nucleotide sequence is shown as SEQ ID NO:13 in the sequence table), C8 nano antibody (SEQ ID NO:14, corresponding nucleotide sequence is shown as SEQ ID NO:15 in the sequence table), F4 nano antibody (SEQ ID NO:16, corresponding nucleotide sequence is shown as SEQ ID NO:17 in the sequence table), G6 nano antibody (SEQ ID NO:18, corresponding nucleotide sequence is shown as SEQ ID NO:19 in the sequence table), and G8 nano antibody (SEQ ID NO:20, corresponding nucleotide sequence is shown as SEQ ID NO:21 in the sequence table). Homology alignment analysis is performed on amino acid sequences, and as shown in B frame in FIG. 5, the results show that the amino acid sequences of the nanobody TGF-beta 1-VHH expressed by 6 strains of positive clones are not completely consistent in length, and the differences are mainly expressed in the complementarity determining regions (CDRs, including CDRs, CDR2 and CDR3) of the antibody, wherein the amino acid residues in the CDR3 region are most strongly changed. The CDRs jointly form an antigen-binding site of the antibody, determine the specificity of the antibody, and are sites where the antibody recognizes and binds to the antigen; FR1, FR2, FR3 and FR4 denote Framework Regions (FR), respectively.

Example 4: prokaryotic induced expression and purification of nano antibody TGF-beta 1-VHH

This example first utilized 6 positive clones obtained by screening as described in example 3 above, and recombinant pMECS phagemids were prepared as per the instructions using the GenElute Plasmid Miniprep Kit, respectively. The recombinant pMECS phagemid is used for constructing expression plasmids of nano antibody TGF-beta 1-VHH, the expression plasmids are transferred into escherichia coli for induced expression to obtain nano antibody TGF-beta 1-VHH, and nano antibodies TGF-beta 1-VHH correspondingly expressed by positive clone strains of C5, F6, C8, F4, G6 and G8 are respectively C5 nano antibody, F6 nano antibody, C8 nano antibody, F4 nano antibody, G6 nano antibody and G8 nano antibody, and the method specifically comprises the following steps:

4.1, carrying out double enzyme digestion on the recombinant pMECS phagemid and the pGEX6P.1-GST prokaryotic expression vector by BamH I and EcoR I respectively to obtain a VHH target fragment and a pGEX6P.1 linearized vector, connecting in the presence of T4 ligase, and constructing the pGEX6P.1-VHH prokaryotic expression vector after connection. The pGEX6P.1-VHH prokaryotic expression vector is transferred into escherichia coli DH5 alpha competent cells for expression, positive strains are obtained by screening and are named as a C5 positive strain, an F6 positive strain, a C8 positive strain, an F4 positive strain, a G6 positive strain and a G8 positive strain respectively.

4.2, carrying out 1mM IPTG on the positive strain, carrying out overnight prokaryotic induction at 22 ℃, carrying out high-speed centrifugation to enrich the thallus, repeatedly freezing and thawing for 4 to 6 times, and then carrying out ultrasonic thorough thallus lysis (working for 2s, intermittent for 6s, and the power is 40%). Then, the relatively clear lysate is subjected to high-speed centrifugation at 12000rpm, supernatant is obtained, precipitates are redissolved by 8M urea to respectively obtain nano antibodies in the supernatant and inclusion bodies, and the nano antibody expression (CST/murine GST monoclonal antibody; China fir gold bridge/goat anti-mouse secondary antibody) is detected by using a Coomassie brilliant blue staining method and a Western blot method (electrophoresis and anti-GST-Western blot).

The results are shown in panel a and panel B in fig. 6, wherein panel a shows coomassie brilliant blue staining results, panel B shows Western blot detection results, Lane 1/2-11/12 in panel a and panel B respectively correspond to detection results of nano antibodies in supernatants/inclusion bodies of C5, F6, C8, F4, G6 and G8 positive strains, and M shows protein molecule standards. It can be seen that the fusion protein (molecular weight 36kDa) of the nano antibody TGF-beta 1-VHH and GST is expressed in the culture supernatant and inclusion bodies of each positive strain, wherein the expression effect of the supernatant is better.

4.3 according to the results of panel A and panel B in FIG. 6, C8 positive strains with high expression level of the Nanobody TGF-. beta.1-VHH were selected from 6 positive strains, and GSTrap was performed on the supernatant of bacterial lysate and inclusion body reconstitution solution after treatment ^TM FF1mL chromatographic column is purified, and the chromatographic column is made of biocompatible polypropylene and is endowed with strong binding capacity with GST tag positive protein and other glutathione binding protein. Wherein the elution buffer solution is Tris-HCl solution (pH) containing 10mM reduced glutathione8.0). Use of

An Advantage 25 purifier, the loading and elution flow rates are set to 0.5mL/min and 1mL/min, respectively; the column was equilibrated with binding buffer (PBS) before loading the different positive strains. The purified protein sample (supernatant/inclusion body) and the protein sample before purification (supernatant/inclusion body) are collected and subjected to Coomassie brilliant blue staining and SDS-PAGE electrophoresis detection.

The results are shown in FIG. 6, panel C and panel D, wherein panel C shows Coomassie brilliant blue staining results, panel D shows SDS-PAGE electrophoresis detection results, in panel C and panel D, Lane1/2 shows the detection results of the nanobodies in the supernatant/inclusion bodies before purification, Lane3/4 shows the detection results of the nanobodies in the supernatant/inclusion bodies after purification, and M shows the protein molecule standard. Therefore, the nano antibody expressed in the supernatant after purification is effectively enriched.

The purified supernatant/inclusion body can be effectively enriched in the C5 nanobody, the F6 nanobody, the F4 nanobody, the G6 nanobody and the G8 nanobody by the same method as in the step 4.3.

Example 5: detection of binding specificity of Nanobody TGF-beta 1-VHH

In this example, nanobodies in the supernatant obtained by purification in example 4 were collected, and binding specificity to native TGF- β 1 protein was examined using commercially available TGF- β 1 antibody as a control.

5.1, detecting the binding specificity of the nano antibody to TGF-beta 1 by Western Blot

The human lung cancer cell line NCI-H520 is amplified and cultured in RPMI-1640 medium, the cell holoprotein is fully released by RIPA lysate, and 10 mu g of the cell holoprotein is quantitatively loaded in each well to 12% SDS-PAGE gel prepared in advance. Respectively incubating with primary antibodies (respectively C8 nano antibody, C5 nano antibody, F6 nano antibody, F4 nano antibody, G6 nano antibody, G8 nano antibody and commercially available rabbit TGF-beta 1 monoclonal antibody (positive control)), at 4 ℃ overnight, and then using HRP-labeled corresponding species-derived secondary antibody (Alexa Fluor) ^R 555) (1:2000 dilution) was incubated with the secondary antibody at room temperature for 1 hour, followed by placing in an ECL AutoAnalyzer (CLinX Co.)And (5) exposing and imaging.

The results are shown in panel A of FIG. 7, wherein M represents the protein molecular weight standard, C8, C5, F6, F4, G6, G8 and rTGF-beta 1Ab are respectively represented by the Western Blot detection result of NCI-H520 tumor cell lysate/10 μ G incubated by using primary anti-C8 nano antibody, C5 nano antibody, F6 nano antibody, F4 nano antibody, G6 nano antibody, G8 nano antibody and commercially available rabbit TGF-beta 1 monoclonal antibody, and show that the above 6 nano antibodies and the rabbit TGF-beta 1 monoclonal antibody have better binding to different forms of TGF-beta 1 (precursor, monomer and dimer) and have fewer non-specific bands of the commercially available antibody group. Among the 6 kinds of nanobodies, the binding specificity of the C8 nanobody is better.

5.2, immunofluorescence detection of the binding specificity of Nanobodies to TGF-beta 1

The experiment takes C8 nanometer antibody as a representative to carry out detection, NCI-H520 cell slide is prepared, the temperature is 37 ℃, and the CO content is 5 percent ₂ Adhering the walls in an incubator overnight, fixing 4% paraformaldehyde, and then carrying out antigen specificity reaction: primary antibodies are respectively C8 nano antibody (C8-VHH) and commercially available TGF-beta 1 monoclonal antibody (positive control), and the primary antibodies are incubated for 4 hours at room temperature; then, the same species of fluorescent secondary antibody (Alexa Fluor) was used separately ^R 555) Specific binding is carried out again; after staining the two groups of slide for 15min by DAPI, the slide is sealed, and images are collected on a Zeiss confocal microscope.

The results are shown in panel B of FIG. 7, in which the top-down primary antibodies were commercially available TGF-. beta.1 monoclonal antibody and Nanobody C8, respectively, and both of them were able to specifically recognize NCI-H520 cell surface TGF-. beta.1.

5.3 Fortebio experiment detection of binding affinity of Nanobody and TGF-beta 1 protein

The experiment takes C8 nano antibody as a representative to carry out detection, and the Fortebio Octet experiment utilizes a biological membrane interference technology (Bio-Layer interference), a pre-installed GST sensor is non-covalently combined with the nano antibody TGF-beta 1-VHH, and the interaction with the target protein TGF-beta 1 is detected. The loading dilution was PBST solution containing 0.02% Tween-20 and 0.1% BSA, and the equilibration/solidification buffer was identical to the loading buffer. TGF-. beta.1 purified protein (obtained in example 1) was diluted 6 units by a 1000nM gradient while setting the buffer set for background subtraction. Sample (I)Loading buffer, solidified sample (C8 nanometer antibody) and combined sample (TGF-beta 1 purified protein with gradient dilution) are respectively added into a plate (Greiner PN 655209); the program setting comprises three steps of solidification, combination and dissociation, and the time is respectively 5min, 10min and 20 min. The affinity was judged as follows: KD>10 ^-8 M is weak in binding ability; 10 ^-9 M<KD<10 ^-8 M has stronger binding capacity; 10 ^-11 M<KD<10 ^-9 M is high in binding capacity; KD<10 ^-11 M has strong binding ability.

The results are shown in FIG. 8, and show that the C8 nano antibody belongs to slow combination and slow dissociation modes, and the affinity constant KD (M) is 1.48X 10 ^-9 mol/L, which is a strong bond.

The examples show that the anti-TGF-beta 1 nano antibody (C5 nano antibody, F6 nano antibody, C8 nano antibody, F4 nano antibody, G6 nano antibody and G8 nano antibody) prepared by the invention has high specific recognition capability and high affinity binding capability, can effectively neutralize autocrine or paracrine TGF-beta 1 (including LAP precursor (LAP primordium and TGF-beta 1 monomer are combined by non-covalent bond), TGF-beta 1 monomer and dimer) in a tumor microenvironment, makes up the inherent escape of the traditional TGF-beta 1 antibody, and plays an important role in offsetting tumor immunity and inhibiting the generation and development of tumors. Therefore, the prepared anti-TGF-beta 1 nano antibody can be used for preparing a tumor treatment medicament, and the tumor treatment medicament can also comprise a pharmaceutically acceptable carrier, such as cytotoxin, radioactive isotope, immunomodulator, anti-angiogenesis agent, antiproliferative agent, pro-apoptotic agent, chemotherapeutic agent or therapeutic agent of therapeutic nucleic acid, and the like. The tumor treatment medicine can be used for treating tumors including but not limited to lung cancer, ovarian cancer, breast cancer, lymphoma, cervical cancer, liver cancer, gastric cancer, glioma and the like, and can promote wound healing, tissue repair, embryonic development and the like.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> national classic (Beijing) pharmaceutical technology Co., Ltd

<120> antihuman transforming growth factor beta 1 nano antibody, preparation method and application thereof

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1173

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgccgccct ccgggctgcg gctgctgccg ctgctgctac cgctgctgtg gctactggtg 60

ctgacgcctg gccggccggc cgcgggacta tccacctgca agactatcga catggagctg 120

gtgaagcgga agcgcatcga ggccatccgc ggccagatcc tgtccaagct gcggctcgcc 180

agccccccga gccaggggga ggtgccgccc ggcccgctgc ccgaggccgt gctcgccctg 240

tacaacagca cccgcgaccg ggtggccggg gagagtgcag aaccggagcc cgagcctgag 300

gccgactact acgccaagga ggtcacccgc gtgctaatgg tggaaaccca caacgaaatc 360

tatgacaagt tcaagcagag tacacacagc atatatatgt tcttcaacac atcagagctc 420

cgagaagcgg tacctgaacc cgtgttgctc tcccgggcag agctgcgtct gctgaggctc 480

aagttaaaag tggagcagca cgtggagctg taccagaaat acagcaacaa ttcctggcga 540

tacctcagca accggctgct ggcacccagc gactcgccag agtggttatc ttttgatgtc 600

accggagttg tgcggcagtg gttgagccgt ggaggggaaa ttgagggctt tcgccttagc 660

gcccactgct cctgtgacag cagggataac acactgcaag tggacatcaa cgggttcact 720

accggccgcc gaggtgacct ggccaccatt catggcatga accggccttt cctgcttctc 780

atggccaccc cgctggagag ggcccagcat ctgcaaagct cccggcaccg ccgagccctg 840

gacaccaact attgcttcag ctccacggag aagaactgct gcgtgcggca gctgtacatt 900

gacttccgca aggacctcgg ctggaagtgg atccacgagc ccaagggcta ccatgccaac 960

ttctgcctcg ggccctgccc ctacatttgg agcctggaca cgcagtacag caaggtcctg 1020

gccctgtaca accagcataa cccgggcgcc tcggcggcgc cgtgctgcgt gccgcaggcg 1080

ctggagccgc tgcccatcgt gtactacgtg ggccgcaagc ccaaggtgga gcagctgtcc 1140

aacatgatcg tgcgctcctg caagtgcagc tga 1173

<210> 2

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggaccggtgc caccatgccg ccctccgggc tg 32

<210> 3

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggaattct agagtcgcgg ccgcttcagt ggtgatggtg atgatggctg cacttgcag 59

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcctggctg ctcttctaca agg 23

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtacgtgct gttgaactgt tcc 23

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gatgtgcagc tgcaggagtc tggrggagg 29

<210> 7

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctagtgcggc cgctgaggag acggtgacct gggt 34

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttatgcttcc ggctcgtatg 20

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ccacagacag ccctcatag 19

<210> 10

<211> 110

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ser Met Tyr Trp Val

20 25 30

Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Leu Thr Pro

35 40 45

Gly Gly Asp Ile Thr Ser Tyr Ala Thr Ser Val Lys Gly Arg Phe Thr

50 55 60

Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu Gln Met Asn Asn

65 70 75 80

Leu Thr Val Glu Asp Thr Ala Leu Tyr Tyr Cys Ala Thr Ser Gln Thr

85 90 95

Gly Ala Gly Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser

100 105 110

<210> 11

<211> 330

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gagtctggag gaggcttggt gcagcctggg gggtctctga gactctcctg tgcagcctct 60

ggattcacct tcagtagtta ctcgatgtat tgggtccgtc aggcgccagg gaaggggctc 120

gagtgggtct catcgcttac tcctggtggt gatatcacat cctacgcaac gtccgtgaag 180

ggccgattca ccatctccag agacaacgcc aaaaacacgc tgtatctgca aatgaacaac 240

ctgacagtgg aggacacggc cctatattac tgtgcgacat cgcagaccgg cgccggccgg 300

ggacagggga cccaggtcac cgtctcctca 330

<210> 12

<211> 118

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Gly Arg Phe Ser Thr Tyr Gly Met Gly Trp Phe

20 25 30

Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val Gly Ala Ile Asp Gly

35 40 45

Ser Gly Ser Gly Lys Tyr Val Pro Asp Ser Val Lys Gly Arg Phe Ser

50 55 60

Ile Ser Arg Glu Asn Ala Lys His Met Ala Tyr Leu Gln Met Asn Ser

65 70 75 80

Leu Lys Leu Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala Thr Glu Gln

85 90 95

Arg Ile Gly His Ser Ala Glu Glu Tyr Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Gln Val Thr Val Ser Ser

115

<210> 13

<211> 354

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gagtctggag gaggcttggt gcagcctggg gggtctctga gactctcctg tgcagcctct 60

ggtggccgct tcagtactta tggcatgggc tggttccgcc aggctccagg gaaggagcgt 120

gaattggtag gagctattga cgggagtggt agtggcaaat acgttccaga ctcggtgaag 180

ggccgattca gcatctccag agagaacgcc aagcacatgg cgtatctgca aatgaacagc 240

ctgaaactgg aggacacggc cgtttactac tgcgcagcaa ccgaacaacg aattggacac 300

agcgcagagg agtatgacta ctggggccag gggacccagg tcaccgtctc ctca 354

<210> 14

<211> 114

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 14

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Ser Gln Ser Ser Phe Asn Ala Met Gly Trp Phe

20 25 30

Arg Gln Ala Pro Gly Lys Gln Arg Glu Val Val Ala Arg Ile Arg Ala

35 40 45

Gly Asp Lys Thr Asp Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

50 55 60

Ser Arg Glu Asn Ala Lys Asn Thr Val His Leu Gln Met Asn Asn Leu

65 70 75 80

Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys His Ala Asp Pro Asp Tyr

85 90 95

Pro Leu Leu Thr Thr Thr Tyr Trp Gly Gln Gly Thr Gln Val Thr Val

100 105 110

Ser Ser

<210> 15

<211> 342

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gagtctgggg gaggcttggt gcagcctggg gggtctctga gactctcctg cgcagcgtct 60

gggtcccagt ccagcttcaa tgccatgggc tggttccgcc aggctccagg gaagcagcgc 120

gaagtggtcg cacgtattcg tgctggtgat aaaacagact atgcagactc cgtgaagggc 180

cgattcacca tctccagaga gaacgccaag aacacggtgc acctgcaaat gaacaacctg 240

aaacctgagg acacggccgt ttattactgt catgccgatc ccgactaccc cctccttacg 300

acgacctact ggggccaggg gacccaggtc accgtctcct ca 342

<210> 16

<211> 115

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 16

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Arg Thr Ser Gly Ile Ile Phe Arg Ile Tyr Glu Leu

20 25 30

Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala Arg

35 40 45

Ile Thr Tyr Glu Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg

50 55 60

Phe Thr Val Ser Arg Asp Asn Ile Lys Asn Thr Val Tyr Leu Gln Met

65 70 75 80

Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Glu

85 90 95

Ser Arg Ile Ile Met Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr

100 105 110

Val Ser Ser

115

<210> 17

<211> 345

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gagtctggag gaggcttggt gcagcctggg gagtctctga gactctcctg tgcagcctct 60

agaacctctg gaattatctt cagaatctat gagctgggct ggtaccgcca ggctccaggg 120

aagcagcgcg agttggtcgc acgtattact tatgagggta gcacaaacta tgccgactcc 180

gtgaagggcc gattcaccgt ctccagagac aacatcaaga acacggtgta tctgcaaatg 240

aacagcctga aacctgagga cacggccgtc tattactgta atgcagaatc tcgaatcata 300

atgtatgact attggggcca ggggacccag gtcaccgtct cctca 345

<210> 18

<211> 113

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 18

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Ser Thr Arg Leu Phe Asn Val Met Gly Trp Tyr

20 25 30

Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala Thr Ile Thr Thr

35 40 45

Gly Gly Thr Thr Asn His Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

50 55 60

Ser Arg Asp Asn Ala Lys Asn Ile Val Tyr Leu Gln Met Ser Ser Leu

65 70 75 80

Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Arg Tyr Thr Thr

85 90 95

Leu Gly Pro Arg Asn Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser

100 105 110

Ser

<210> 19

<211> 339

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gagtctgggg gaggcttggt gcaggctggg gggtctctga gactctcctg tgcagcctct 60

ggaagcacca ggcttttcaa tgtgatgggc tggtaccgcc aggctccagg gaagcagcgc 120

gagttggtcg caactattac tactggtggt accacaaacc atgcggactc cgtgaaaggc 180

cgattcacca tctccagaga caacgccaag aacatagtgt atctgcaaat gagcagcctg 240

aaacctgagg acacggccgt ctattactgt aatgcccgct atacgacttt gggtcctcgt 300

aattactggg gccaggggac ccaggtcacc gtctcctca 339

<210> 20

<211> 113

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 20

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Lys Leu Ser

1 5 10 15

Cys Ala Ala Ser Ser Ser Ile Arg Asn Phe Asn Phe Met Gly Trp Tyr

20 25 30

Arg Gln Ala Pro Gly Lys Gln Arg Gly Leu Val Ala His Ile Ile Ser

35 40 45

Gly Thr Gly Pro Val Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

50 55 60

Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Arg Met Asn Ser Leu

65 70 75 80

Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Gly Lys Glu Ile Gly

85 90 95

Gly Asn Trp Ser Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser

100 105 110

Ser

<210> 21

<211> 339

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gagtctggag gaggcttggt gcagcctggg gggtctctga aactctcctg tgcagcctct 60

agcagcatca gaaatttcaa tttcatgggt tggtaccgcc aggctccagg gaagcagcgc 120

ggattagtcg cgcatattat tagtggtact ggcccagtct atgcagactc cgtgaagggc 180

cgattcacca tctccagaga caacgccaaa aacacggtgt atctgcgaat gaacagcctg 240

aaacctgagg acacggccgt ctattactgt aatggcaagg agataggcgg aaattggtct 300

gactactggg gccaggggac ccaggtcacc gtctcctca 339

Claims (8)

1. The nanobody resisting human transforming growth factor beta 1 is characterized in that the amino acid sequence of the nanobody is any one of the following a) to d):

a) an amino acid sequence shown as SEQ ID NO. 10 in the sequence table;

b) an amino acid sequence shown as SEQ ID NO. 12 in the sequence table;

c) an amino acid sequence shown as SEQ ID NO. 14 in the sequence list;

d) the amino acid sequence shown as SEQ ID NO. 16 in the sequence table.

2. A nucleotide coding sequence encoding the amino acid sequence of the nanobody of claim 1.

3. The nucleotide coding sequence of claim 2, wherein the nucleotide coding sequence is any one of the following a ') -d'):

a') a nucleotide sequence shown as SEQ ID NO. 11 in the sequence table;

b') a nucleotide sequence shown as SEQ ID NO. 13 in the sequence table;

c') a nucleotide sequence shown as SEQ ID NO. 15 in the sequence table;

d') the nucleotide sequence shown as SEQ ID NO. 17 in the sequence table.

4. An expression vector comprising the nucleotide coding sequence of claim 2 or 3.

5. The expression vector of claim 4, wherein the expression vector is obtained by inserting the nucleotide coding sequence of claim 2 or 3 into a pGEX6P.1 prokaryotic expression vector.

6. A host cell containing the expression vector of claim 4 or 5, wherein the host cell includes but is not limited to E.coli DH5 a competent cell, E.coli BL21(DE3) competent cell.

7. The method for preparing nanobody of claim 1, which comprises the following steps:

1) constructing recombinant plasmid for expressing fusion protein TGF-beta 1, expressing and purifying to obtain purified fusion protein TGF-beta 1;

2) immunizing alpaca with the purified fusion protein TGF-beta 1 obtained in the step 1) as an antigen;

3) screening a gene sequence which can have high binding force with the purified fusion protein TGF-beta 1;

4) carrying out protein induction expression on the gene sequence obtained in the step 3).

8. The method according to claim 7, wherein the screening in step 3) is performed by affinity panning.

Images