CN111424115A - Method for detecting novel coronavirus by using glucometer - Google Patents
Method for detecting novel coronavirus by using glucometer Download PDFInfo
- Publication number
- CN111424115A CN111424115A CN202010177163.2A CN202010177163A CN111424115A CN 111424115 A CN111424115 A CN 111424115A CN 202010177163 A CN202010177163 A CN 202010177163A CN 111424115 A CN111424115 A CN 111424115A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- acid probe
- sucrase
- detected
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/54—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving glucose or galactose
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/66—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood sugars, e.g. galactose
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/924—Hydrolases (3) acting on glycosyl compounds (3.2)
Abstract
The invention discloses a method for detecting novel coronavirus by using a glucometer, which comprises the following steps: (1) designing a nucleic acid probe 1 and a nucleic acid probe 2 according to a target nucleic acid sequence of the novel coronavirus, and preparing a magnetic bead-nucleic acid probe 1 and a sucrase-nucleic acid probe 2; (2) mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected to obtain a mixture for capturing a target nucleic acid sequence in the sample to be detected; (3) converting the signal of the target nucleic acid sequence captured in the step (2) into a glucose signal to obtain a mixed solution to be detected; (4) and detecting the converted glucose signal in the mixed solution to be detected by using a glucometer to obtain the amount of the novel coronavirus in the sample to be detected. The method of the invention obtains the amount of the biomarker by detecting the amount of glucose through the glucometer, can realize the aim of simple and rapid detection, can obtain a quantitative detection result, can output the result in a digital way through the glucometer, and has short time consumption and low cost.
Description
Technical Field
The invention relates to the field of virus biomolecule detection, and relates to a method for detecting novel coronavirus by utilizing glucose recognition of a glucometer and sucrose decomposition characteristic of sucrase.
Background
The novel coronavirus pneumonia (COVID-19) is an acute respiratory infectious disease caused by 2019 novel coronavirus (SARS-Cov-2) infection. The infection rate is high, the epidemic situation is serious, the detection and diagnosis of the novel coronavirus is an important link for effectively controlling the epidemic situation, and the high-efficiency virus detection technology also becomes a hotspot of research and development. The detection methods of viruses include electrophoresis, radioactive analysis, conventional fluorescence spectroscopy, immunization, chromatography, etc., and in recent years, molecular biological detection methods based on PCR have become an important means for virus detection, and in this time, detection methods based on PCR technology are also mainly used in the diagnosis of the novel coronavirus. Therefore, it is not suitable for rapid detection and identification of virus in clinic and large-scale sample detection and analysis.
Disclosure of Invention
In view of the above, the present invention provides a method for detecting a novel coronavirus by a glucometer, which is not a medical purpose, and can rapidly and simply detect the virus.
Another object of the present invention is to provide a kit for detecting a novel coronavirus using a blood glucose meter.
In order to achieve the above object, the present invention provides the following technical solutions:
a method for detecting novel coronavirus by using a glucometer for non-diagnosis and treatment purposes comprises the following steps:
(1) designing a nucleic acid probe 1 and a nucleic acid probe 2 according to a target nucleic acid sequence of the novel coronavirus, connecting the nucleic acid probe 1 with magnetic beads to prepare a magnetic bead-nucleic acid probe 1, and connecting the nucleic acid probe 2 with sucrase to prepare a sucrase-nucleic acid probe 2;
(2) mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected to obtain a mixture for capturing a target nucleic acid sequence in the sample to be detected;
(3) converting the signal of the target nucleic acid sequence captured in the step (2) into a glucose signal to obtain a mixed solution to be detected;
(4) and detecting the converted glucose signal in the mixed solution to be detected by using a glucometer, and detecting the amount of glucose by using the glucometer so as to obtain the amount of the novel coronavirus in the sample to be detected.
As a preferred embodiment, the target nucleic acid sequence includes, but is not limited to, conserved gene sequences of Open reading frame lab (Open reading frame 1ab, ORF1ab), Nucleocapsid protein (N) and envelope protein (Envelop, E) of SARS-CoV-2.
As a preferred technical scheme, the process for preparing the magnetic bead-nucleic acid probe 1 in the step (1) comprises the following steps: incubating the magnetic beads and the nucleic acid probe 1 under the condition of stirring, and performing magnetic adsorption and washing through a magnetic frame to obtain magnetic beads-nucleic acid probes 1; preferably, the magnetic beads and the nucleic acid probes 1 are incubated for 0.5 to 2 hours at a temperature of 20 to 30 ℃ (namely normal temperature) under the condition of stirring, and the rotating speed of the stirring is 20 to 30 r/min; further preferably, the magnetic rack is used for magnetic adsorption washing for three times, and each adsorption time is 2 min; more preferably, the amount of the nucleic acid probe 1 added is 1 to 2 times the amount of the magnetic beads, so that the magnetic beads are saturated.
As a preferred technical scheme, the process for preparing the sucrase-nucleic acid probe 2 in the step (1) is as follows:
(a) mixing and connecting sucrase and coupling agent under the condition that the pH value is 6-9, and reacting for 30-60 min to obtain a coupling agent-sucrase compound;
(b) mixing the nucleic acid probe 2, a PB buffer solution and tris (2-carboxyethyl) phosphine, and standing for 30-60 min to obtain an activated nucleic acid probe 2;
(c) and mixing the coupling agent-sucrase compound with the activated nucleic acid probe 2, standing for 24-48 h, and performing ultrafiltration to obtain the nucleic acid probe 2 (namely, the sucrase-nucleic acid probe 2) connected with the sucrase.
Preferably, in the step (a), the reaction temperature for uniformly mixing and connecting the sucrase and the coupling agent is 20-30 ℃ (namely normal temperature), the pH value is 6.5-7.5, and the uniformly mixing and connecting are carried out at the rotating speed of 20-30 r/min.
As a preferred technical scheme, the magnetic beads are streptavidin-magnetic beads; the nucleic acid probe 1 is a biotinylated nucleic acid probe; the nucleic acid probe 2 is a chemical group modified nucleic acid probe, preferably a sulfhydryl group modified nucleic acid probe; the sucrase is sucrase with naked amino modification; the coupling agent is sulfo-SMCC.
As a preferred technical scheme, the process of capturing the target nucleic acid sequence in the sample to be detected in the step (2) is as follows: and mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected at 20-30 ℃ for 30-60 min, and combining to form a magnetic bead-nucleic acid probe 1+ target nucleic acid sequence + nucleic acid probe 2-sucrase compound.
As a preferred embodiment, the process of converting the signal of the captured target nucleic acid sequence into a glucose signal in step (3) is: and (3) mixing the mixture obtained in the step (2) with a sucrose solution at 20-30 ℃ for 0.5-3 h, and converting a signal of a target nucleic acid sequence to be detected into a glucose signal.
A kit for detecting a biomarker by using a glucometer comprises a biomarker capturing reagent, a signal conversion reagent of the biomarker and an auxiliary reagent; the capture biomarker reagent comprises a capture reagent connected with an active matrix, an active recognition reagent and a connector; the signal conversion reagent of the biomarker comprises an active sucrose solution; the auxiliary reagent comprises a BufferA solution and a morpholine ethanesulfonic acid-Tween 20 solution.
A kit for detecting novel coronavirus by using a glucometer comprises a reagent for capturing a target nucleic acid sequence of the virus, a signal conversion reagent of the virus and an auxiliary reagent; the reagent for capturing the virus target nucleic acid sequence comprises a nucleic acid probe 1 connected with a magnetic bead and a nucleic acid probe 2 connected with sucrase; the virus signal conversion reagent comprises a sucrose solution; the auxiliary reagent is used in the virus detection process.
As a technical scheme, the nucleotide sequence of ORF1ab region of the novel coronavirus is used as the target nucleotide sequence of the novel coronavirus, but the nucleotide sequences of the nucleic acid probe 1 and the nucleic acid probe 2 designed according to the target nucleotide sequence are as follows:
the sequence of the nucleic acid probe 1 is (50 bp): (5 '-3') biotin-
AAAAACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTT
The sequence of the nucleic acid probe 2 is (44 bp): (5'-3')
ATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCA-SH。
As a detailed technical scheme, the auxiliary reagent comprises BufferA and morpholine ethanesulfonic acid-Tween 20 solution, wherein the BufferA solution is PBST solution with pH of 7.2 and containing 0.5% Tween-20 and 1 g/L BSA;
the formula of the morpholine ethanesulfonic acid-Tween 20 solution is as follows: 100mM morpholine ethanesulfonic acid, 0.05% Tween 20, pH 5.0.
The concentration of the sucrose solution is 0.2-1M, and the most preferable concentration is 0.5M. The sucrose solution is prepared by dissolving sucrose in Buffer A.
The room temperature of the invention is 25 +/-5 ℃.
The invention has the beneficial effects that:
the method provided by the invention converts the signal of the biological marker into a glucose signal, uses the glucometer as a detection instrument, obtains the quantity of the biological marker by detecting the quantity of glucose through the glucometer, can realize the aim of simple and quick detection, can obtain a quantitative detection result, can output the result in a digital way through the glucometer, and has the advantages of short time consumption and low cost.
Drawings
FIG. 1 is a schematic diagram showing quantitative detection of novel coronavirus by glucometer
Detailed Description
The invention provides a method for detecting novel coronavirus by using a glucometer for non-diagnosis and treatment purposes, which comprises the following steps of:
(1) designing a nucleic acid probe 1 and a nucleic acid probe 2 according to a target nucleic acid sequence of the novel coronavirus, connecting the nucleic acid probe 1 with magnetic beads to prepare a magnetic bead-nucleic acid probe 1, and connecting the nucleic acid probe 2 with sucrase to prepare a sucrase-nucleic acid probe 2;
(2) mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected to obtain a mixture for capturing a target nucleic acid sequence in the sample to be detected;
(3) converting the signal of the target nucleic acid sequence captured in the step (2) into a glucose signal to obtain a mixed solution to be detected;
(4) and detecting the converted glucose signal in the mixed solution to be detected by using a glucometer, and detecting the amount of glucose by using the glucometer so as to obtain the amount of the novel coronavirus in the sample to be detected.
The present invention preferably captures viral nucleic acid sequences using two nucleic acid probes complementary to the target nucleic acid sequence of the novel coronavirus. In the invention, the nucleic acid probe connected with the magnetic beads and the nucleic acid probe connected with the sucrase are respectively complementary with a target nucleic acid sequence of the virus to be detected;
in the present invention, the virus target nucleic acid sequence includes, but is not limited to, conserved gene sequences of Open reading frame 1ab (ORF 1ab), Nucleocapsid protein (N) and envelope protein (Envelop, E) of SARS-CoV-2, which have been disclosed in the prior art, and the nucleic acid probe 1 and nucleic acid probe 2 designed for the above target nucleic acid sequence are obtained by optimization of researchers of the present invention; the nucleic acid probe 1 is a capture probe corresponding to the nucleic acid sequence, and the nucleic acid probe 2 is a recognition probe corresponding to the nucleic acid sequence.
In the present invention, the active matrix is a magnetic bead, preferably a streptavidin magnetic bead, and the nucleic acid probe 1 is preferably a biotinylated nucleic acid probe, and is thereby bound to the magnetic bead.
As a preferred technical scheme, the process for preparing the magnetic bead-nucleic acid probe 1 in the step (1) comprises the following steps: incubating the magnetic beads and the nucleic acid probe 1 under the condition of stirring, and performing magnetic adsorption and washing through a magnetic frame to obtain magnetic beads-nucleic acid probes 1; preferably, the magnetic beads and the nucleic acid probes 1 are incubated for 0.5 to 2 hours at the temperature of 20 to 30 ℃ under the condition of stirring, and the rotating speed of the stirring is 20 to 30 r/min; further preferably, the magnetic rack is used for magnetic adsorption washing for three times, and each adsorption time is 2 min; more preferably, the amount of the nucleic acid probe 1 (biotinylated nucleic acid probe) added is 1 to 2 times the amount of magnetic beads, and the magnetic beads are saturated.
The most preferred detailed process for preparing the magnetic bead-nucleic acid probe 1 is as follows:
the method specifically comprises the following steps of placing a magnetic bead bottle on a vortex oscillator for 20s, oscillating and resuspending magnetic beads, moving 100L magnetic beads into a new centrifuge tube by using a pipette, placing the centrifuge tube on a magnetic separator, standing for 1min (the operation is subsequently referred to as magnetic separation), sucking supernatant by using the pipette, taking the centrifuge tube from the magnetic separator, adding 1m L Buffer I (the Buffer 1 solution is 0.01MPBST solution, the pH of the Buffer 1 solution is 7.2, and the Buffer 1 solution contains 0.2% Tween-20) into the centrifuge tube, covering a centrifuge tube cover, fully oscillating and resuspending magnetic beads, carrying out magnetic separation, removing the supernatant, and repeating for 1 time.
After obtaining the activated magnetic beads, connecting the obtained activated magnetic beads with a nucleic acid probe 1, wherein the connection preferably comprises the following steps of adding 500 mu L of biotinylated nucleic acid probe diluted by Buffer I (the concentration of the magnetic beads is enabled to be 2mg/m L), fully oscillating the resuspended magnetic beads, placing the centrifuge tube on a rotary mixer, rotating at room temperature (the rotating speed is 20-30 r/min), mixing for 30 min, carrying out magnetic separation, transferring the supernatant to a new centrifuge tube, carrying out magnetic adsorption on the washed magnetic beads three times by a magnetic frame, carrying out magnetic adsorption for 2min each time, adding a proper low-salt Buffer solution, and resuspending the magnetic beads.
In the present invention, the nucleic acid probe 1 having magnetic beads attached thereto is obtained and then stored for later use. In the present invention, the magnetic bead-linked nucleic acid probe 1 is preferably stored in a 0.01M PBST solution containing 1% BSA (g/100 ml). The volume ratio of the PBST solution to the nucleic acid probe 1 connected with the magnetic beads is preferably 2-4: 1, and the preservation temperature is preferably 0-4 ℃.
The specific steps of connecting Biotin and a nucleic acid probe in the invention comprise mixing the nucleic acid probe and the freshly prepared Biotin solution, mixing and incubating to obtain a Biotin-modified nucleic acid probe, wherein the concentration of the nucleic acid probe is preferably 0.8-1.2 mg/ml, more preferably 1mg/ml, the volume of the nucleic acid probe is preferably 0.5-1 ml, the concentration of the Biotin solution is preferably 8-12 mM, more preferably 10mM, the volume ratio of the Biotin solution to the nucleic acid probe solution is preferably 1: 50-150, more preferably 1: 90, in the invention, the incubation is preferably carried out on ice or at room temperature, the incubation time is preferably 1-3 h, more preferably 2h, the incubation temperature is preferably 30-30 min, the incubation time is preferably 30-30 min, the incubation reaction is preferably carried out at room temperature after the incubation is finished, and the mixed solution is preferably subjected to ultrafiltration reaction at room temperature after the incubation is carried out for 30-30 min.
As a preferred technical scheme, the process for preparing the sucrase-nucleic acid probe 2 in the step (1) is as follows:
(a) mixing and connecting sucrase and coupling agent under the condition that the pH value is 6-9, and reacting for 30-60 min to obtain a coupling agent-sucrase compound;
(b) mixing a nucleic acid probe 2 (a sulfhydryl-modified nucleic acid probe), a PB buffer solution and tris (2-carboxyethyl) phosphine, and standing for 30-60 min to obtain an activated nucleic acid probe 2;
(c) and mixing the coupling agent-sucrase compound with the activated nucleic acid probe 2, and standing for 24-48 h to obtain the nucleic acid probe 2 (sucrase-nucleic acid probe 2) connected with sucrase.
Preferably, in the step (a), the reaction temperature for uniformly mixing and connecting the sucrase and the coupling agent is 20-30 ℃, the pH value is 6.5-7.5, and the uniformly mixing and connecting are carried out at the rotating speed of 20-30 r/min.
The nucleic acid probe 2 is a chemical group modified nucleic acid probe, preferably a sulfhydryl group modified nucleic acid probe; the active sucrase is sucrase with naked amino modification (manufacturer: Sigma); the coupling agent is sulfo-SMCC.
As a preferred technical scheme, the process of capturing the target nucleic acid sequence in the sample to be detected in the step (2) is as follows: and mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected at 20-30 ℃ for 30-60 min (preferably 40-50 min), and combining to form a magnetic bead-nucleic acid probe 1+ target nucleic acid sequence + nucleic acid probe 2-sucrase compound.
As a preferred embodiment, the process of converting the signal of the captured target nucleic acid sequence into a glucose signal in step (3) is: and (3) mixing the mixture obtained in the step (2) with a sucrose solution at the temperature of 20-30 ℃ for 0.5-3 h to obtain a to-be-detected mixed solution for converting the signal of the biological marker into a glucose signal. The mixing time is most preferably 0.5-2 h; the concentration of the sucrose solution is preferably 0.2-1M, and more preferably 0.5M; preferably, the volume ratio of the sucrose solution to the mixed solution to be detected is 1: 1, and the sucrose solution is prepared by dissolving sucrose in Buffer A.
After the mixed liquid to be detected is obtained, the glucose signal in the mixed liquid to be detected is detected by using the glucometer, and the amount of the virus is calculated according to the amount of the glucose detected by the glucometer.
The invention also provides a kit for detecting the novel coronavirus by using the glucometer, which comprises a reagent for capturing a virus target nucleic acid sequence, a virus signal conversion reagent and an auxiliary reagent, wherein the reagent for capturing the virus target nucleic acid sequence comprises a nucleic acid probe 1 connected with a magnetic bead and a nucleic acid probe 2 connected with a sucrase, the virus signal conversion reagent is a sucrose solution, the auxiliary reagent is a reagent used in the virus detection process, the auxiliary reagent comprises Buffer A and a morpholine ethanesulfonic acid-Tween 20 solution, the Buffer A solution is a PBST solution with the pH of 7.2 and containing 0.5% Tween-20 and 1 g/L BSA, and the formula of the morpholine ethanesulfonic acid-20 solution is 100mM morpholine ethanesulfonic acid, 0.05% Tween 20 and the pH of 5.0.
The solvent of the Buffer solution for preparing the sample to be detected is preferably Buffer A solution, the Buffer A solution is preferably PBST solution, the pH value is 7.2, and the Buffer solution contains 0.5% (v/v) Tween-20 and 1 g/L BSA.
After the magnetic bead-nucleic acid probe 1+ target nucleic acid sequence + nucleic acid probe 2-sucrase compound is obtained through mixing and connection, magnetic separation is preferably performed, and the compound is washed for 2-5 times by using Buffer A solution, wherein the Buffer A solution is preferably PBST solution, pH7.2, and contains 0.5% Tween-20 and 1 g/L BSA.
The method and the kit provided by the invention convert the signal of the biomarker into the glucose signal, use the glucometer as a detection instrument, detect the amount of glucose through the glucometer to obtain the amount of the biomarker, can realize the aim of simple and quick detection, can obtain a quantitative detection result, can output the result in a digital manner through the glucometer, have short time consumption and low cost, and can be used for a large number of clinical sample operations.
The method for detecting a novel coronavirus using a blood glucose meter according to the present invention will be described in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1. The magnetic beads of 60. mu. L streptavidin-magnetic beads were connected to the nucleic acid probe 1 to obtain streptavidin-magnetic beads connected to the nucleic acid probe 1, and then magnetic separation was performed, and the magnetic beads were washed 3 times with Buffer A solution (magnetic rack magnetic adsorption washing, 2min for each adsorption) to obtain the magnetic beads-nucleic acid probe 1.
2. Adding 400 mu L2 mg/m L sucrase (dissolved in buffer A solution) into 1mg of sulfo-SMCC coupling agent, uniformly mixing at room temperature (under the condition that the rotating speed is 20-30 r/min), adjusting the pH value to 6.5-7.5, shaking for 1h, centrifuging to remove insoluble sulfo-SMCC, and then carrying out ultrafiltration for 8 times by using buffer A solution to obtain the coupling agent-sucrase compound.
3. Mu. L100. mu.M of thiol-modified nucleic acid probe 2 (dissolved in ultrapure water) was taken, 10. mu. L0.2.2M PB (pH5.5) buffer and 2. mu. L50 mM TCEP (dissolved in ultrapure water) were added thereto, and the mixture was mixed, left to stand at room temperature for 1 hour, and subjected to ultrafiltration with BufferA solution 8 times to obtain activated nucleic acid probe 2.
4. And (3) uniformly mixing the coupling agent-sucrase compound with the activated nucleic acid probe 2, standing at room temperature for 48h, and performing ultrafiltration for 8 times by using a buffer A solution to obtain the nucleic acid probe 2-sucrase compound.
5. Mixing the magnetic bead-nucleic acid probe 1 (dissolved in Buffer A solution) and an equivalent amount of nucleic acid probe 2-sucrase compound in 100 mu L Buffer A solution containing a target nucleic acid sequence to be detected, mixing for 1h at 28 ℃ and 24r/min by a rotary mixer, then carrying out magnetic separation on streptavidin-magnetic beads, and collecting supernatant.
6. 100 mu L0.5M sucrose solution (dissolved in Buffer A) was added to the supernatant and after 0.5h, 5 mu L solution was checked with a glucometer.
The target nucleic acid sequence ORF1ab to be detected is (89 bp):
GTGAATTTTTGTGTCAGACATGGCAGACCCCATACACCTTTCCAATACCGACATCAACACTAGTTGAGG CGC TTGGGTACGAA GTCAGT
the sequence of the nucleic acid probe 1 is (50 bp): (5 '-3') biotin-
AAAAACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTT
The sequence of the nucleic acid probe 2 is (44 bp): (5'-3')
ATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCA-SH
The system verification is carried out through in vitro synthesis of the target, and the successful establishment of the method is proved.
Example 2
A kit for detecting a novel coronavirus by using a glucometer is used for detecting a nucleic acid sequence of an ORF1ab region of the novel coronavirus, and comprises a reagent for capturing a target nucleic acid sequence of the virus, a signal conversion reagent and an auxiliary reagent of the virus, wherein the reagent for capturing the target nucleic acid sequence of the virus comprises a magnetic bead-nucleic acid probe 1 and a nucleic acid probe 2 connected with a sucrase, the signal conversion reagent of the virus comprises a sucrose solution, the auxiliary reagent is a reagent used in the virus detection process and comprises Buffer A and a morpholine ethanesulfonic acid-Tween 20 solution, the Buffer A solution is a PBST solution with the pH of 7.2 and containing 0.5% of Tween-20 and 1 g/L of BSA, and the formula of the morpholine ethanesulfonic acid-Tween 20 solution is 100mM of morpholine ethanesulfonic acid, 0.05% of Tween 20, the pH of 5.0, the concentration of the sucrose solution is 0.2-1M, and the most preferably the sucrose solution is prepared by dissolving sucrose in Buffer A.
The embodiment shows that the method for detecting the virus is simple and rapid, the quantity of the virus in the sample is obtained by detecting the quantity of the glucose through the glucometer, the target biomarker can be quantitatively detected, the result can be digitally output through the glucometer, the time consumption is short, and the cost is low.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Nanjing university of agriculture
<120> a method for detecting novel coronavirus by using glucometer
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>89
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gtgaattttt gtgtcagaca tggcagaccc catacacctt tccaataccg acatcaacac 60
tagttgaggc gcttgggtac gaagtcagt 89
<210>2
<211>50
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aaaaacactt aaaaacacag tctgtaccgt ctgcggtatg tggaaaggtt 50
<210>3
<211>44
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atggctgtag ttgtgatcaa ctccgcgaac ccatgcttca gtca 44
Claims (10)
1. A method for detecting novel coronavirus by using a glucometer for non-diagnosis and treatment purposes is characterized by comprising the following steps of:
(1) designing a nucleic acid probe 1 and a nucleic acid probe 2 according to a target nucleic acid sequence of the novel coronavirus, connecting the nucleic acid probe 1 with magnetic beads to prepare a magnetic bead-nucleic acid probe 1, and connecting the nucleic acid probe 2 with sucrase to prepare a sucrase-nucleic acid probe 2;
(2) mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected to obtain a mixture for capturing a target nucleic acid sequence in the sample to be detected;
(3) converting the signal of the target nucleic acid sequence captured in the step (2) into a glucose signal to obtain a mixed solution to be detected;
(4) and detecting the converted glucose signal in the mixed solution to be detected by using a glucometer, and detecting the amount of glucose by using the glucometer so as to obtain the amount of the novel coronavirus in the sample to be detected.
2. The method of claim 1, wherein the target nucleic acid sequence includes but is not limited to conserved gene sequences of Open reading frame 1ab (ORF 1ab), nucleocapsid protein (N) and envelope protein (Envelop, E) of SARS-CoV-2.
3. The method of claim 1, wherein the step (1) of preparing the magnetic bead-nucleic acid probe 1 comprises: and (3) incubating the magnetic beads and the nucleic acid probes 1 under the stirring condition, and performing magnetic adsorption and washing through a magnetic rack to obtain the magnetic beads-nucleic acid probes 1.
4. The method according to claim 1, wherein the preparation of the sucrase-nucleic acid probe 2 in step (1) comprises:
(a) mixing and connecting sucrase and coupling agent under the condition that the pH value is 6-9, and reacting for 30-60 min to obtain a coupling agent-sucrase compound;
(b) mixing the nucleic acid probe 2, a PB buffer solution and tris (2-carboxyethyl) phosphine, and standing for 30-60 min to obtain an activated nucleic acid probe 2;
(c) and mixing the coupling agent-sucrase compound with the activated nucleic acid probe 2, standing for 24-48 h, and performing ultrafiltration to obtain the nucleic acid probe 2 connected with sucrase.
5. The method of claim 1, 3 or 4, wherein the magnetic beads are streptavidin-magnetic beads; the nucleic acid probe 1 is a biotinylated nucleic acid probe; the nucleic acid probe 2 is a chemical group modified nucleic acid probe, preferably a sulfhydryl modified nucleic acid probe, and the coupling agent is Sulfo-SMCC.
6. The method of claim 1, wherein the step (2) of capturing the target nucleic acid sequence in the sample to be detected comprises: and mixing the magnetic bead-nucleic acid probe 1 and the sucrase-nucleic acid probe 2 with a sample to be detected for 30-60 min, and combining to form a magnetic bead-nucleic acid probe 1+ target nucleic acid sequence + nucleic acid probe 2-sucrase compound.
7. The method of claim 1, wherein the step (3) of converting the signal of the captured target nucleic acid sequence into a glucose signal comprises: and (3) mixing the mixture obtained in the step (2) with a sucrose solution for 0.5-3 h, and converting a signal of a target nucleic acid sequence to be detected into a glucose signal.
8. A kit for detecting novel coronavirus by using a glucometer is characterized by comprising a reagent for capturing a target nucleic acid sequence of the virus, a signal conversion reagent of the virus and an auxiliary reagent; the reagent for capturing the virus target nucleic acid sequence comprises a nucleic acid probe 1 connected with a magnetic bead and a nucleic acid probe 2 connected with sucrase; the virus signal conversion reagent comprises a sucrose solution; the auxiliary reagent is used in the virus detection process.
9. The kit according to claim 8, wherein the nucleotide sequence of the target nucleic acid sequence of the novel coronavirus is the nucleotide sequence of ORF1ab region of the novel coronavirus, and the nucleotide sequences of the nucleic acid probe 1 and the nucleic acid probe 2 designed according to the target nucleic acid sequence are as follows:
the sequence of the nucleic acid probe 1 is (50 bp): (5 '-3') biotin-AAAAACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTT
The sequence of the nucleic acid probe 2 is (44 bp): (5'-3')
ATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCA-SH。
10. The kit according to claim 8, wherein the auxiliary reagents comprise Buffer A and morpholine ethanesulfonic acid-Tween 20 solution;
the Buffer A solution is a PBST solution with the pH of 7.2 and containing 0.5 percent of Tween-20 and 1 g/L BSA;
the formula of the morpholine ethanesulfonic acid-Tween 20 solution is as follows: 100mM morpholine ethanesulfonic acid, 0.05% Tween 20, pH5.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010177163.2A CN111424115A (en) | 2020-03-13 | 2020-03-13 | Method for detecting novel coronavirus by using glucometer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010177163.2A CN111424115A (en) | 2020-03-13 | 2020-03-13 | Method for detecting novel coronavirus by using glucometer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111424115A true CN111424115A (en) | 2020-07-17 |
Family
ID=71547914
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010177163.2A Pending CN111424115A (en) | 2020-03-13 | 2020-03-13 | Method for detecting novel coronavirus by using glucometer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111424115A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113943776A (en) * | 2021-09-24 | 2022-01-18 | 西安交通大学 | Nucleic acid instant detection method based on personal blood glucose meter reading and kit thereof |
| WO2022016163A3 (en) * | 2020-07-17 | 2022-02-24 | The Regents Of The University Of California | Aptamer-based point-of-care assay devices an methods |
| CN114813871A (en) * | 2021-10-15 | 2022-07-29 | 黄埔海关技术中心 | Port pig epidemic diarrhea virus electrochemical detection method based on silver deposition signal amplification |
| WO2023082544A1 (en) * | 2021-11-12 | 2023-05-19 | 福州大学 | Blood glucose biosensor for detecting covid-19 antibody |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106153876A (en) * | 2016-09-06 | 2016-11-23 | 南京农业大学 | A kind of method utilizing blood glucose meter detection by quantitative biological marker |
| WO2018001258A1 (en) * | 2016-06-30 | 2018-01-04 | 厦门艾德生物医药科技股份有限公司 | Probe for nucleic acid enrichment and capture, and design method thereof |
-
2020
- 2020-03-13 CN CN202010177163.2A patent/CN111424115A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018001258A1 (en) * | 2016-06-30 | 2018-01-04 | 厦门艾德生物医药科技股份有限公司 | Probe for nucleic acid enrichment and capture, and design method thereof |
| CN106153876A (en) * | 2016-09-06 | 2016-11-23 | 南京农业大学 | A kind of method utilizing blood glucose meter detection by quantitative biological marker |
Non-Patent Citations (1)
| Title |
|---|
| YU JIN JUNG ET AL.: "Comparative analysis of primer-probe sets for the laboratory confirmation of SARS-CoV-2" * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022016163A3 (en) * | 2020-07-17 | 2022-02-24 | The Regents Of The University Of California | Aptamer-based point-of-care assay devices an methods |
| CN113943776A (en) * | 2021-09-24 | 2022-01-18 | 西安交通大学 | Nucleic acid instant detection method based on personal blood glucose meter reading and kit thereof |
| CN114813871A (en) * | 2021-10-15 | 2022-07-29 | 黄埔海关技术中心 | Port pig epidemic diarrhea virus electrochemical detection method based on silver deposition signal amplification |
| CN114813871B (en) * | 2021-10-15 | 2023-06-02 | 南京农业大学 | Port porcine epidemic diarrhea virus electrochemical detection method based on silver deposition signal amplification |
| WO2023082544A1 (en) * | 2021-11-12 | 2023-05-19 | 福州大学 | Blood glucose biosensor for detecting covid-19 antibody |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111424115A (en) | Method for detecting novel coronavirus by using glucometer | |
| CN108913812B (en) | Multiple liquid-phase chip detection method for porcine viral diarrhea pathogen and construction thereof | |
| CN110484655B (en) | Detection method for parainfluenza virus whole genome second-generation sequencing | |
| CN108342463B (en) | Gene detection kit free from nucleic acid purification | |
| CN110951916A (en) | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology | |
| CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
| CN111500780A (en) | Kit for detecting novel coronavirus and preparation method thereof | |
| CN105671207B (en) | Liquid-phase chip detection method for four pathogens of porcine viral diarrhea | |
| CN111118219A (en) | RDA method and kit for rapidly detecting influenza A virus | |
| CN108342510B (en) | Multiple RT-PCR kit for BTV-11 type, 17 type, 20 type, 23 type and 24 type genotype typing identification and detection method thereof | |
| CN111676218B (en) | Full-length amplification sequencing method for SARS-CoV-2 virus spike gene and primer thereof | |
| CN108611438A (en) | Differentiate H9 and H10 subtype avian influenza virus duplex RT-PCR detection primers group, kit and its application simultaneously | |
| CN107586861A (en) | For detecting suspension chip and the application of serotype clostridium perfringen parting | |
| CN102220435A (en) | Method for detecting American-type porcine reproductive and respiratory syndrome virus (PRRSV) and mutant strains thereof by realtime fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) | |
| CN104561375A (en) | Isothermal amplification detection kit and detection method of new bunyavirus | |
| CN112301157A (en) | RDA method and kit for rapidly detecting Feline Parvovirus (FPV) | |
| CN108034770B (en) | Method for detecting influenza A virus H7N9 multiple PCR product by mass spectrometry and product thereof | |
| CN110669872A (en) | Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses | |
| CN107058630B (en) | Multiple RT-PCR detection method for 3 genotypes of bovine parainfluenza 3 virus | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN104313179A (en) | Isothermal amplification detection kit and detection method for Zaire type Ebola virus | |
| CN111440902A (en) | Porcine epidemic diarrhea virus detection primer, kit and application thereof | |
| CN113174426A (en) | RCA-nano magnetic bead compound and preparation and application thereof | |
| CN105039347A (en) | Aptamer specifically bound with glyphosate and application | |
| CN105177009A (en) | Nucleic acid aptamer specifically combined with alpha-amatoxin and application of nucleic acid aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |