CN111424034A

CN111424034A - Nucleic acid probe, biochip, kit and method for sorting target cells

Info

Publication number: CN111424034A
Application number: CN202010327189.0A
Authority: CN
Inventors: 张鸿敏
Original assignee: BOE Technology Group Co Ltd
Current assignee: BOE Technology Group Co Ltd
Priority date: 2020-04-23
Filing date: 2020-04-23
Publication date: 2020-07-17
Anticipated expiration: 2040-04-23
Also published as: CN111424034B

Abstract

The invention discloses a nucleic acid probe, a biochip, a kit and a method for sorting target cells, wherein the nucleic acid probe comprises a cell binding unit and a shearing unit, the cell binding unit is a nucleic acid aptamer containing a specific binding sequence of a target cell surface marker and can be specifically bound with the target cells, and the shearing unit contains a specific recognition sequence of a gene editing complex and can be specifically cut by the gene editing complex. The disclosed nucleic acid probes can specifically capture and release target cells, particularly CTC cells, in a biological sample, while achieving non-destructive release and typing of the cells.

Description

Nucleic acid probe, biochip, kit and method for sorting target cells

Technical Field

The invention relates to the technical field of molecular biology, in particular to a nucleic acid probe, a biochip, a kit and a method for sorting target cells.

Background

The traditional CTC capture technology can capture trace CTC in patient blood, compared with ordinary cells, the physical characteristics (size, density, mechanical characteristics and the like) and biochemical characteristics (surface marker protein) of tumor cells have larger difference, so that the capture of CTC in blood by using the difference is a common method.

Existing CTC release methods include enzyme response, ligand hybridization, chemical reduction reactions, and thermally responsive release, among others. Because the CTCs carry comprehensive information such as DNA, RNA, protein, lipid and the like, the process of releasing the CTCs from the chip should ensure the integrity and activity of the CTCs as much as possible so as to carry out operations such as downstream cell culture, genetic material detection, protein analysis and the like.

The traditional CTC cell typing technology, including multiple fluorescent antibody immunostaining, cell staining, flow cytometry analysis and the like, has the problems of high cost, poor cell activity, large sample consumption and incapability of directly performing cell typing analysis.

The micro-fluidic-based CTC detection method can integrate the capture and release of cells on one chip, thereby realizing the capture and release of CTC on the premise of low cost and low sample consumption. However, in the existing CTC detection microfluidic chip, the release and typing of CTCs are carried out separately, and the release agent is single and has poor flexibility, so that the random combined release of multi-type CTCs cannot be realized. Chinese patent (CN107488576A) and US patent (US20150260710a1) disclose non-destructive release methods after CTC capture based on chemical reduction reaction and thermal response techniques, respectively, but because the number of CTCs released is very small, subsequent typing analysis and other operations cannot be directly performed. At present, methods for capturing and separating CTC based on multiple fluorescent antibody immunodetection and restriction endonuclease exist, but in the methods, the CTC needs to be typed and counted by a fluorescent microscope when the CTC is released, the released cells cannot be directly used for operations such as downstream cell culture, genetic material detection, protein analysis and the like, and a single releasing agent causes mixed release of different types of CTC, so that the typed cells cannot be respectively released, and the CTC cannot be used for downstream research.

Disclosure of Invention

In view of the above-mentioned drawbacks or deficiencies in the prior art, it is desirable to provide a nucleic acid probe, a biochip, a kit and a method for sorting target cells, in order to achieve integration of lossless release and typing of target cells and combined release and combined typing of multiple types of target cells.

As a first aspect of the present invention, the present invention provides a nucleic acid probe for sorting target cells, the nucleic acid probe comprising a cell binding unit and a cleavage unit, wherein the cell binding unit is a nucleic acid aptamer comprising a target cell surface marker-specific binding sequence, and the nucleic acid aptamer can specifically bind to a target cell to capture the target cell; the cleavage unit contains a recognition sequence specific for the gene-editing complex, which can be specifically cleaved by the gene-editing complex, thereby releasing the target cell captured by the cell binding unit.

Preferably, the gene editing complex is selected from the group consisting of sgRNA/Cas complexes, Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases; more preferably, the gene editing complex is a sgRNA/Cas9 complex, wherein the sgRNA comprises a sequence complementary to a recognition sequence specific for the gene editing complex that can direct targeted cleavage of the sequence by Cas 9.

Preferably, the nucleic acid probe further comprises a modifying group capable of linking the nucleic acid probe to the biochip, and the nucleic acid probe can be immobilized on the biochip by binding of the modifying group to a binding molecule on the biochip.

Preferably, the nucleic acid probe further comprises a first connecting sequence and a second connecting sequence, wherein the first connecting sequence is positioned between the cell binding unit and the shearing unit and is used for separating the cell binding unit and the shearing unit and avoiding steric hindrance between proteins in a binding process; the second linking sequence is located between the cleavage unit and the modifying group.

As a second aspect of the present invention, the present invention provides a biochip for target cell sorting, comprising: a solid support, and a nucleic acid probe of the invention disposed on the solid support.

Preferably, the solid support is provided with more than two nucleic acid probes capable of being specifically cut by different gene editing complexes, different nucleic acid probes can be specific to different target cells and have different target cell surface marker specific binding sequences and gene editing complex specific recognition sequences, and different target cells can be sequentially released by sequentially introducing different gene editing complexes into the biochip.

Preferably, the solid support comprises a binding molecule capable of binding to a modifying group on the nucleic acid probe, and the nucleic acid probe is immobilized on the solid support by binding of the modifying group to the binding molecule.

As a third aspect of the present invention, the present invention provides a kit for target cell sorting comprising the nucleic acid probe of the present invention.

Preferably, the kit further comprises a releasing agent and a biochip capable of binding the nucleic acid probe, wherein the releasing agent comprises a gene editing complex capable of specifically cutting the nucleic acid probe.

As a fourth aspect of the present invention, the present invention provides a method for target cell sorting, the method comprising:

(a) contacting a biological sample with a biochip containing the nucleic acid probe of the invention to capture target cells;

(b) and introducing a releasing agent into the biochip, and collecting released target cells.

The releasing agent contains a gene editing complex capable of specifically cutting the nucleic acid probe, and can specifically cut the nucleic acid probe and release the captured target cell.

Preferably, the biochip comprises two or more different nucleic acid probes, and the releasing agents comprising different gene-editing complexes are added sequentially in step (b) of the method, and the released target cells are collected separately.

The invention has the beneficial effects that:

the existing target cell release method comprises enzyme response, ligand hybridization, chemical reduction reaction, thermal response release and the like, the action sites of the release agents of the methods are single, and when the gene editing complex, particularly the sgRNA/CAS complex, is used for cutting the nucleic acid probe to release the target cell, a large number of different specific recognition and cutting sites can be flexibly designed according to actual needs, so that the nucleic acid probe with different specific recognition sequences of the gene editing complex can be designed aiming at different target cells. Releasing agents containing different gene editing complexes are respectively introduced into a biochip containing multiple nucleic acid probes, so that the corresponding nucleic acid probes can be specifically cut, and typing can be carried out while target cells are released. Different kinds of gene editing compounds are randomly used, so that the combination lossless release and the combination typing of various target cells can be realized. Meanwhile, the invention carries out targeted cutting on the nucleic acid probe through the gene editing compound, the integrity and the activity of the target cell are hardly influenced in the process, and the released target cell can be directly used for various downstream researches.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments made with reference to the following drawings:

FIG. 1 is a schematic structural diagram of a nucleic acid probe according to an embodiment of the present invention;

FIG. 2 is a schematic structural view of a nucleic acid probe according to another embodiment of the present invention;

FIG. 3 is a partial cross-sectional view of a biochip according to an embodiment of the present invention;

FIG. 4 is a top view of a biochip according to an embodiment of the present invention;

FIG. 5 is a diagram showing the sequences of a recognition sequence specific to a gene editing complex, a cleavage site and a PAM sequence of a first nucleic acid probe according to the present invention;

FIG. 6 is a diagram showing the sequences of a recognition sequence specific to a gene editing complex, a cleavage site and a PAM sequence of a second nucleic acid probe according to the present invention;

FIG. 7 is a schematic diagram of the capture of HMC-1 cells and HepG2 cells by a first nucleic acid probe and a second nucleic acid probe according to one embodiment of the invention;

FIG. 8 is a schematic diagram of the sequential non-destructive release and typing of HMC-1 cells and HepG2 cells in accordance with one embodiment of the present invention;

FIG. 9 is a schematic diagram of the combined release and combined typing of HMC-1 cells and HepG2 cells according to one embodiment of the present invention.

Reference numerals: a first nucleic acid probe 100, a second nucleic acid probe 200, a cell binding unit 2, a cleavage unit 3, a modifying group 4, a first linker sequence 51, a second linker sequence 52, a solid support 6, a binding molecule 7, a sample inlet 81, a sample outlet 82, a target cell capture zone 83, a cover slip 9.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. It is to be understood that the specific embodiments described herein are merely illustrative of the relevant invention and not restrictive of the invention. It should be noted that, for convenience of description, only the portions related to the present invention are shown in the drawings.

It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict. The present invention will be described in detail below with reference to the embodiments with reference to the attached drawings.

It should be noted that the terms "central," "longitudinal," "lateral," "length," "width," "thickness," "upper," "lower," "left," "right," "front," "rear," "vertical," "horizontal," "top," "bottom," "inner," "outer," "clockwise," "counterclockwise," "axial," "radial," "circumferential," and the like are used in an orientation or positional relationship indicated in the drawings for convenience and simplicity of description only, and do not indicate or imply that the device or element so referred to must have a particular orientation, be constructed and operated in a particular orientation, and thus should not be construed as limiting the invention.

It should be noted that the terms "first", "second", etc. in the description of the present invention are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature.

It should be noted that unless expressly stated or limited otherwise, the terms "mounted," "connected," and "connected" are to be construed broadly and include, for example, fixed or removable connections or integral connections; can be mechanically or electrically connected; either directly or indirectly through intervening media, either internally or in any other relationship. The specific meanings of the above terms in the present invention can be understood by those skilled in the art according to specific situations.

As used herein, a "target cell" can be any cell, including but not limited to microbial, bacterial, and animal cells, exemplary target cells include but are not limited to Circulating Tumor Cells (CTCs), leukocytes and leukocyte subpopulations, maternal peripheral blood fetal nucleated red blood cells, circulating endothelial cells, stem cells, and the like; preferably, the "target cell" of the present invention is a CTC cell.

In the present invention, CTC cells are tumor cells that are shed from a primary or metastatic focus of a solid tumor, spread into peripheral blood and circulate with the blood, wherein the tumor cells involved include, but are not limited to, lung cancer, liver cancer, pancreatic cancer, thyroid cancer, oral cancer, laryngeal cancer, esophageal cancer, stomach cancer, colorectal cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, uterine tumor, brain cancer, melanoma, and skin cancer.

As used herein, a "biological sample" can be any biological fluid, including but not limited to blood samples, plasma samples, cerebrospinal fluid samples, sputum samples, urine samples, stool samples, and the like. The biological sample of the present invention may be a concentrated or diluted biological fluid, or a fraction removed, and may have additives or stabilizers. In the present invention, it is preferable that the "biological sample" is a blood sample.

As used herein, "target cell sorting" refers to a process of capturing specific target cells that may be contained in a biological sample by a certain cell sorting medium or method, and releasing and typing the captured target cells from the cell sorting medium, including capturing, releasing and typing the target cells.

According to a first aspect of the invention, there is provided a nucleic acid probe for use in sorting target cells. Referring to fig. 1 and 2, the nucleic acid probe includes: cell binding unit 2, cleavage unit 3, first linker sequence 51, second linker sequence 52 and modifying group 4.

In one embodiment, the cell binding member 2 is an aptamer that specifically binds to a target cell present in a biological sample. When a biological sample containing target cells is contacted with the nucleic acid probe, the cell-binding unit 2 specifically binds to the target cells, so that the target cells are adsorbed or immobilized on the nucleic acid probe, thereby separating the target cells from the biological sample or other components of the biological sample.

In the invention, the aptamer is a single-stranded DNA or RNA fragment, which can be folded to form a specific spatial structure so as to be combined with a target cell with high affinity and specificity, and compared with the traditional antibody, the aptamer has the advantages of easy acquisition, low cost, high purity, difficult inactivation, high stability, non-immunogenicity, no toxicity, adjustable structure and the like.

Further, in some preferred embodiments of the invention, the cell binding unit 2 is an oligonucleotide fragment containing a target cell surface marker-specific binding sequence, which is capable of specifically binding to a target cell surface marker. Wherein, the oligonucleotide refers to any natural or synthetic nucleotide, including deoxyribonucleotides and ribonucleotides.

In some preferred embodiments, the cell binding unit 2 is a deoxyribonucleotide fragment having a stem-loop structure, and comprises a single-stranded circular region and a double-stranded region, wherein the single-stranded circular region contains a target cell surface marker specific binding sequence and is capable of specifically binding to a target cell surface marker, and the double-stranded region is linked to the cleavage unit 3 via the first linking sequence 51, i.e., the cleavage unit 3 is located at the stem of the stem-loop structure. When facing complex clinical samples such as human blood and the like, the aptamer with the stem-loop structure has the advantages of high stability, high specificity, high affinity and high selectivity, and can remarkably improve the capture efficiency of target cells.

Exemplary CTC cell surface markers include the surface marker epithelial cell adhesion molecule (EpCAM) of human hepatoma cell HepG2, the surface marker transmembrane molecule MUC1 of human mast cell HMC-1, and the like, and other exemplary markers include CD133, CD90, CD47, CD44, CD24, CK19, P L S3, and the like.

In one embodiment, the nucleic acid probe is used for the recognition sorting of human mast cell HMC-1 cells, wherein the cell binding unit comprises a specific binding sequence for MUC1, preferably the specific binding sequence is as shown in SEQ ID No. 2.

In one embodiment, the nucleic acid probe is used for recognition sorting of human liver tumor cells HepG2, wherein the cell binding unit comprises a specific binding sequence for EpCAM, preferably the specific binding sequence is shown in SEQ ID No. 5.

Cleavage of the cleavage unit 3 by the gene editing complex, which may result in cleavage of the cleavage unit 3, thereby separating the cleavage unit 3, or at least a portion of the cleavage unit 3, from the cell binding unit 2, leaving the cell binding unit 2 and the target cells bound thereto free from other portions of the nucleic acid probe, results in release of the target cells by cleavage of the cleavage unit 3, in which process the cleavage agent or tool or release method employed does not directly contact the target cells, such that the cellular integrity and activity of the target cells is not affected, resulting in non-destructive release of the target cells.

In one embodiment, the cleavage unit 3 is a dsDNA fragment comprising a specific recognition sequence for a sgRNA/Cas complex, a Zinc Finger Nuclease (ZFN), a transcription activator-like effector nuclease (TA L EN), capable of being cleaved specifically by the sgRNA/Cas complex, the ZFN, or TA L EN with complete cleavage.

The sgRNA/Cas complex consists of single guide RNA (sgRNA) and CRISPR-associated protein (Cas), can identify a target sequence to complete fixed-point cutting of a DNA double strand, and has the advantages of strong specificity, high efficiency and the like; for example, three types of Type I, Type II and Type III can be used.

A Zinc Finger Nuclease (ZFN) gene editing system and a transcription activator effector nuclease-like (TA L EN) gene editing system are two other commonly used gene editing systems, wherein the ZFN gene editing system is a fusion protein consisting of a DNA recognition domain formed by connecting a plurality of zinc finger motifs in series and a carboxyl terminal functional domain of a non-specific endonuclease Fok I, when two ZFNs are respectively combined to target sequences with 5-7 bases on two strands of DNA, the cleavage structural domain of the Fok I endonuclease is further activated to enable the DNA to generate double-strand breaks at specific sites, and the TA L EN gene editing system is formed by fusing a Tale protein and the Fok I endonuclease which are specifically recognized and combined with the DNA.

Further, it is preferred that the cleavage unit 3 comprises a specific recognition sequence for the sgRNA/Cas9 complex, capable of being cleaved specifically by the sgRNA/Cas9 complex and being completely cleaved. In a preferred embodiment, the specific recognition sequence in cleavage unit 3 comprises about 20nt of the recognition region of sgRNA/Cas9 and a PAM sequence (protospacer adjacent motif) which is a 3nt NGG sequence for recognition by Cas9 protein, the cleavable site in cleavage unit 3 being located between the 3 rd and 4 th nucleotides upstream of the PAM sequence. In this embodiment, the sgRNA/Cas9 complex includes sgRNA and Cas9 protein, the sgRNA complementarily pairs with the specific recognition sequence in cleavage unit 3 to form a hybrid double strand, and guides Cas9 to recognize and cleave the DNA double strand of cleavage unit 3, resulting in a DNA double strand break at the cleavable site.

In some more preferred embodiments, the specific recognition sequence of the cleavage unit 3 comprises a recognition region of sgRNA/Cas9 of about 20 bases and a PAM sequence of 3 bases, wherein the cleavable site is located between the 3 rd and 4 th nucleotides upstream of the PAM sequence and is capable of being specifically cleaved by the sgRNA/Cas9 complex to form a DNA double strand break. Preferably, the cleavage unit 3 comprises a sequence as shown in SEQ ID NO.3 or SEQ ID NO. 6.

In the present invention, a nucleic acid probe has a specific cell binding unit 2 and a specific cleavage unit 3, wherein the specific cell binding unit 2 is used for capturing a specific target cell, and the specific cleavage unit 3 can be cleaved by a specific gene editing complex corresponding thereto, for example, a sgRNA/Cas9 complex having a specific sgRNA sequence, thereby achieving selective release of the target cell. Because the cell binding unit 2 and the shearing unit 3 of the nucleic acid probe correspond to specific target cells one by one, when the nucleic acid probe is used for capturing cells and specifically cutting the nucleic acid probe, the released target cells are the specific target cells to be sorted, further distinguishing or identifying is not needed, and the capturing, the releasing and the sorting of the target cells are integrated.

Further, in some preferred embodiments of the present invention, the nucleic acid probe further comprises a modifying group 4 for attaching the nucleic acid probe to a biochip, and the nucleic acid probe can be immobilized on the biochip by binding of the modifying group to a binding molecule on the biochip. Wherein the modification comprises a biological modification or a chemical modification. In some preferred embodiments, the modifying group is a biotin or thiol group and the binding molecule is streptavidin or gold nanoparticles.

Further, in some preferred embodiments of the present invention, the nucleic acid probe further comprises a first linker sequence 51, wherein the first linker sequence 51 is located between the cell binding unit 2 and the cleavage unit 3, and is used for separating the cell binding unit 2 and the cleavage unit 3, so as to avoid steric hindrance between the proteins when the target cell surface marker is bound to the cell binding unit 2 and when the gene editing complex is bound to the cleavage unit 3. Optionally, the first connecting sequence 51 is a dsDNA fragment, and the length of the dsDNA fragment is 20-30 bp, preferably 20-25 bp.

Further, in some preferred embodiments of the invention, the nucleic acid probe further comprises a second linker sequence 52, which is located between the cleavage unit 3 and the modifying group 4. Optionally, the second connecting sequence 52 is a dsDNA fragment, and the length of the dsDNA fragment is 20-30 bp, preferably 20-25 bp.

In one embodiment, the nucleic acid probe forms a stem-loop structure, wherein the target cell surface marker specific binding sequence of cell binding unit 2 is located in a single stranded loop region of the stem-loop structure and the first linker sequence 51, the second linker sequence 52 and the cleavage unit 3 are located in the stem of the stem-loop structure.

In some embodiments, the nucleic acid probe of FIG. 1 is used to sort tumor cells HMC-1 in a biological sample. In this embodiment, optionally, the base sequence of the nucleic acid probe is shown as SEQ ID No.1, wherein the target cell surface marker specific binding sequence in the cell binding unit 2 is shown as SEQ ID No.2, and the cleavage unit 3 comprises a sequence shown as SEQ ID No.3, as shown in fig. 5, wherein the cleavage unit 3 comprises a recognition region (20-nt target) of sgRNA/Cas9 of 20 bases and a PAM sequence of 3 bases, wherein the cleavable site is located between the 3 rd and 4 th nucleotides upstream of the PAM sequence.

Correspondingly, the sgRNA/Cas9 complex for cutting the nucleic acid probe to release the HMC-1 of the tumor cell is composed of two parts of sgRNA and Cas9 protein, wherein the base sequence of a transcription template of the sgRNA is shown as SEQ ID No.7, and the RNA sequence of the sgRNA is shown as SEQ ID No. 9.

In other embodiments, the nucleic acid probe of FIG. 2 is used to sort tumor cells HepG2 from a biological sample. In this embodiment, optionally, the base sequence of the nucleic acid probe is shown as SEQ ID No.4, wherein the target cell surface marker specific binding sequence in the cell binding unit 2 is shown as SEQ ID No.5, and the cleavage unit 3 comprises a sequence shown as SEQ ID No.6, as shown in fig. 6, wherein the cleavage unit 3 comprises a recognition region (20-nt target) of sgRNA/Cas9 of 20 bases and a PAM sequence of 3 bases, wherein the cleavable site is located between the 3 rd and 4 th nucleotides upstream of the PAM sequence.

Correspondingly, the sgRNA/Cas9 complex for cutting the nucleic acid probe to release the tumor cell HepG2 is composed of two parts of sgRNA and Cas9 protein, wherein the base sequence of a transcription template of the sgRNA is shown as SEQ ID No.8, and the RNA sequence of the sgRNA is shown as SEQ ID No. 10.

As a second aspect of the present invention, the present invention provides a biochip for sorting target cells, which comprises a solid support 6, and the nucleic acid probe as described above disposed on the solid support 6. In one embodiment, the biochip is a microfluidic chip.

In this embodiment, the nucleic acid probe can be immobilized on the solid support 6, and the target cell bound to the nucleic acid probe can be immobilized on the solid support 6, thereby capturing the target cell. The solid support 6 includes, but is not limited to, a chip substrate, magnetic beads, etc.

In some preferred embodiments, as shown in fig. 3, the biochip is a microfluidic chip, and the solid support 6 is preferably a chip substrate.

In this embodiment, the material of the substrate may be organic (e.g., polymer), inorganic (e.g., silica, glass, quartz, silica, etc.), or a composite thereof. Wherein the polymer may be one or more of polymethyl methacrylate, polycarbonate, polystyrene, polyethylene, silicone, polyvinyl acetate, polypropylene, polyvinyl chloride, polyether ether ketone, polyethylene terephthalate cyclic olefin polymer and cyclic olefin copolymer.

Further, in some preferred embodiments of the present invention, as shown in FIG. 3, two or more different nucleic acid probes are disposed on the solid support 6. In this embodiment, each nucleic acid probe is configured to capture a specific certain target cell and is capable of being cleaved by a specific gene editing complex, such that release and typing of the target cell is integrated. Wherein, the modifying group 4, the first linker sequence 51 and the second linker sequence 52 of different types of nucleic acid probes may be the same or different, as long as the cell binding unit 2 and the cleavage unit 3, or at least the target cell surface marker-specific binding sequence comprised by the cell binding unit 2 and the recognition sequence specific to the gene editing complex comprised by the cleavage unit 3, are different.

Further, in some preferred embodiments of the present invention, as shown in fig. 3, the solid support 6 comprises a binding molecule 7 for forming a coupling effect with the modification group 4 of the nucleic acid probe, the nucleic acid probe is immobilized on the solid support 6 through the coupling effect of the modification group 4 and the binding molecule 7, preferably, the modification group is biotin or thiol group, and the binding molecule 7 is streptavidin or gold nanoparticle.

That is, the solid support 6 is modified with a binding molecule 7 capable of performing an affinity interaction or a chemical interaction with the modifying group 4 of the nucleic acid probe, and the nucleic acid probe is adsorbed and immobilized on the solid support 6 based on the coupling action of the modifying group 4 and the binding molecule 7. In some embodiments, the nucleic acid probe is modified with biotin, the solid support 6 is modified with streptavidin, and the nucleic acid probe is attached to the solid support 6 by the affinity of biotin and streptavidin. In other embodiments, the nucleic acid probe is modified with thiol groups, the solid support 6 is modified with gold nanoparticles, and the nucleic acid probe is attached to the solid support 6 by Au-S bonding.

Further, in some preferred embodiments of the present invention, as shown in fig. 4, the microfluidic chip includes a sample inlet 81, a sample outlet 82, and a target cell capture zone 83 located between the sample inlet 81 and the sample outlet 82, wherein the target cell capture zone 83 is provided with the nucleic acid probes, and the nucleic acid probes are arrayed or staggered in the direction of the sample flow.

In this embodiment, several nucleic acid probes may be of the same kind or different kinds, wherein the same kind means that the cell binding unit 2 and the cleavage unit 3 of the nucleic acid probe or at least the specific binding sequence for the target cell surface marker included in the cell binding unit 2 and the specific recognition sequence for the gene editing complex included in the cleavage unit 3 are the same, are used for capturing the target cell of the same kind, and can be cleaved by the same gene editing complex, for example, by the same sgRNA/Cas9 complex; the different species refer to the cell binding units 2 of the plurality of nucleic acid probes, and the cleavage units 3, or at least the target cell surface marker specific binding sequences comprised by the cell binding units 2, and the specific recognition sequences of the gene editing complexes comprised by the cleavage units 3 are different for capturing different species of target cells and need to be cleaved with different gene editing complexes, e.g. with sgRNA/Cas9 complexes having different sgRNA sequences.

In some preferred embodiments, as shown in FIG. 3, the target cell capture zone 83 of the device is distributed with a plurality of nucleic acid probes, wherein the plurality of nucleic acid probes comprises at least two types for capturing at least two target cells.

In this embodiment, for example, two different nucleic acid probes are distributed in the target cell capturing region 83, including a first nucleic acid probe and a second nucleic acid probe, and after the biological sample enters the biochip, two different types of target cells existing in the biological sample are captured by the first nucleic acid probe or the second nucleic acid probe, respectively, at this time, a first sgRNA/Cas9 complex corresponding to the first type of nucleic acid probe and a second sgRNA/Cas9 complex corresponding to the second type of nucleic acid probe may be sequentially added to the device, so as to sequentially release the two different types of target cells. Or simultaneously adding a mixture of a first sgRNA/Cas9 complex corresponding to the first nucleic acid probe and a second sgRNA/Cas9 complex corresponding to the second nucleic acid probe into the device to realize the combined release of two different types of target cells.

Further, in some preferred embodiments of the present invention, the biochip has a microfluidic channel, and the nucleic acid probe is disposed in the microfluidic channel.

Further, in some preferred embodiments of the present invention, as shown in FIG. 3, the biochip further comprises a cover 9, the cover 9 is located above the solid support 6, and the nucleic acid probe for capturing the target cell is located at a lower portion of the cover 9. In this embodiment, the material of the cover sheet 9 is the same as that of the chip base.

According to a third aspect of the present invention, there is provided a kit comprising a nucleic acid probe of the present invention. In one embodiment, the kit further comprises a releasing agent comprising a gene-editing complex that specifically cleaves the nucleic acid probe, and a biochip that binds the nucleic acid probe. Wherein, the biochip can be used to specifically capture the target cells in the biological sample after the nucleic acid probe is combined with the biochip, and the releasing agent is used to release the target cells combined with the biochip to obtain the target cell sample.

In some preferred embodiments, the release agent is selected from the group consisting of a sgRNA/Cas complex, a zinc finger nuclease, a transcription activator-like effector nuclease. In some more preferred embodiments, the releasing agent is a sgRNA/Cas9 complex.

It will be appreciated that other components may also be included in the kit, such as buffer solutions for washing the biochip, etc.

According to a fourth aspect of the invention, there is provided a method of sorting target cells, the method comprising:

(b) and introducing a releasing agent containing a gene editing complex capable of specifically cutting the nucleic acid probe into the biochip, and collecting released target cells.

In some preferred embodiments, the release agent comprises a sgRNA/Cas complex, a zinc finger nuclease, or a transcription activator-like effector nuclease; preferably, the release agent contains the sgRNA/Cas9 complex.

In some preferred embodiments, the biochip comprises a plurality of nucleic acid probes for simultaneously capturing a plurality of target cells in a biological sample, wherein the plurality of nucleic acid probes are capable of being cleaved by different release agents in a one-to-one correspondence to the plurality of nucleic acid probes, thereby allowing the captured plurality of target cells to be released sequentially or in combination.

In the method, different releasing agents correspond to different nucleic acid probes, so that different types of target cells are released respectively, and the release and typing of the target cells are realized simultaneously. And the plurality of releasing agents can be randomly combined for use, so that the combined release and the combined typing of the target cells of various types are realized, and the flexible selection according to different experimental purposes is facilitated.

The technical content of the invention will be further explained with reference to specific examples.

Example 1

Preparation and sorting methods of a nucleic acid probe and a microfluidic chip for sorting tumor cells HMC-1 and HepG 2.

Preparing a microfluidic chip

Mixing PDMS basic components and a curing agent according to the weight ratio of 10: 1, fully and uniformly stirring, and removing bubbles by vacuum pumping. Pouring the mixture on a mold with a micro-flow channel pattern, and treating in an oven at 80 ℃ for 30 min. The cooled mixture was cut along the template with a scalpel into the solid support 6 (i.e. the PDMS chip substrate) and holes were punched at the inlet and outlet of the flow channel.

The cover plate 9 is cut according to the size of the base, holes are punched on the cover plate according to the inlet and outlet pore paths of the base, and a sample inlet 81 and a sample outlet 82 are formed together with the inlet and outlet on the base. The solid support 6 and the coverslip 9 are brought into apposition and baked at 90 ℃ to permanently bond the coverslip 9 and the solid support 6.

(II) preparation of first nucleic acid probe 100 for capturing tumor cell HMC-1 and second nucleic acid probe 200 for capturing tumor cell HepG2

TABLE 1 sequence information of the first nucleic acid probe and the second nucleic acid probe

The first nucleic acid probe 100 and the second nucleic acid probe 200 are prepared by a sequence synthesis method known in the art, and the sequences thereof are shown in the above table.

(III) immobilization of the first nucleic acid Probe and the second nucleic acid Probe

Streptavidin is used for coating a micro-fluidic chip channel, and the 5' ends of a first nucleic acid probe 100 for capturing the tumor cell HMC-1 and a second nucleic acid probe for capturing the tumor cell HepG2 are respectively modified by biotin.

Flowing a buffer solution of 100 mu L biotin-modified first nucleic acid probe 100 and second nucleic acid probe 200 (the molar mass ratio of the first nucleic acid probe 100 to the second nucleic acid probe 200 is 1:1, i.e., the buffer solution comprises 5 mu mol of the first nucleic acid probe 100 of 50 mu L and 5 mu mol of the second nucleic acid probe 200 of 50 mu L) into the microfluidic channel through the chip sample inlet, incubating at 37 ℃ for 2h, introducing a washing solution without nucleic acid probes into the chip sample inlet to remove the free first nucleic acid probe 100 and second nucleic acid probe 200, continuing adding a BSA solution for reaction for 1h to block the site on the surface of the microfluidic channel, which is not bound with the nucleic acid probes, and finally washing the microfluidic channel three times with a washing solution to remove the free BSA.

Wherein the used washing solution or cleaning solution is purified water or buffer solution, such as PBS buffer solution, which does not affect the biological characteristics and activity of tumor cells.

Preparation of (tetra) sgRNA/Cas9 complexes

In this example, the sgRNA/Cas9 complex is composed of two parts: sgRNA and Cas9 protein. And fully and uniformly mixing the artificially expressed Cas9 protein and the in vitro transcribed sgRNA in a PBS solution according to a molar ratio of 1:1 to complete the preparation of the sgRNA/Cas9 compound solution.

Wherein, the transcription template sequences of the sgRNA1 for specifically cutting the first nucleic acid probe 100 and the sgRNA2 of the second nucleic acid probe 200 are respectively shown as SEQ ID No.7 and SEQ ID No. 8.

SEQ ID No. 7: transcription template of sgRNA1

TAATACGACTCACTATAGGGGAACACAAAGCATAGACTGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT

The specific recognition sequence of sgRNA1 is underlined, the T7 promoter sequence is underlined, and the sgRNA1 hairpin sequence is underlined.

SEQ ID No. 8: transcription template of sgRNA2

TAATACGACTCACTATAGGGGGCCCAGACTGAGCACGTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT

The specific recognition sequence of sgRNA2 is underlined, the T7 promoter sequence is underlined, and the sgRNA2 hairpin sequence is underlined.

In this example, GeneArt was first used^TMA Precision gRNA Synthesis Kit amplifies a transcription template of the sgRNA1 and a transcription template of the sgRNA2, and the Kit contains a Tracr Fragment + T7 Primer Mix and a constant crRNA/tracrRNA sequence of 80 nt.

Next, TranscriptAId was used^TMThe Enzyme Mix transcription kit performs in vitro transcription on the template DNA to obtain sgRNA1 and sgRNA2, and the RNA sequences of the sgRNA1 and the sgRNA2 are shown as follows:

GAACACAAAGCAUAGACUGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID No.9)；

GGCCCAGACUGAGCACGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU(SEQ ID No.10)。

(V) Capture and separate Release of tumor cells HMC-1 and HepG2

Pancreatin digests human mast cell leukemia HMC-1 cells (surface marker expression: MUC-1 positive, EpCAM negative) and liver cancer cells HepG2 (surface marker expression: MUC-1 negative, EpCAM positive) respectively, and 1 × 10³Tumor cells HMC-1 and 1 × 10³The tumor cells HepG2 were mixed well, centrifuged and the supernatant removed, and then resuspended in 100. mu. L blood to complete the preparation of the blood sample to be tested.

Referring to fig. 7, a schematic diagram of specific capture of HMC-1 and HepG2 by the first nucleic acid probe 100 and the second nucleic acid probe 200 in the microfluidic channel of the microfluidic chip is shown, wherein a cell binding unit of the first nucleic acid probe 100 can specifically bind to a surface marker MUC1 of HMC-1 cells to capture HMC-1 cells in a blood sample, and a cell binding unit of the second nucleic acid probe 200 can specifically bind to a surface marker EpCAM of HepG2 cells to capture HepG2 cells in a blood sample.

Further, 100 mu L sgRNA1/Cas9 compound solution is introduced into a microfluidic channel of the microfluidic chip and reacts for 30min at 37 ℃, then PBS solution is used for washing the microfluidic channel of the microfluidic chip for 5min, and the effluent solution is collected at a sample outlet of the chip, so that the HMC-1 tumor cells are obtained.

Counting the cells in the collected solution, repeating the experiment for three times, taking an average value, and determining that HMC-1 tumor cells in the collected solution after the sgRNA1/Cas9 compound solution is introduced into the solution, wherein the HMC-1 tumor cells are 2.41 × 10²In addition, the solution collected after the sgRNA2/Cas9 compound solution is introduced contains HepG2 tumor cells 2.32 × 10²The capture efficiency of the HMC-1 tumor cells and the HepG2 tumor cells is over 20 percent. The flow chart of the above-mentioned release process is shown in FIG. 8, and the non-destructive release and typing of HMC-1 tumor cells and HepG2 tumor cells in the biological sample are realized through the above steps.

The capture efficiency is related to the number of the first nucleic acid probe 100 and the second nucleic acid probe 200 loaded in the microfluidic channel of the microfluidic chip, the sample flow rate, and the like.

(VI) Capture and Combined Release of tumor cells HMC-1 and HepG2

Referring to fig. 9, a flow chart for achieving the combined release of tumor cells is shown.

In this example, after the tumor cell HMC-1 and the tumor cell HepG2 in the biological sample are adsorbed and immobilized on the first nucleic acid probe 100 and the second nucleic acid probe 200, a mixed solution of sgRNA1/Cas9 complex and sgRNA2/Cas9 complex of 100 μ L is introduced into the microfluidic channel of the microfluidic chip, reacted at 37 ℃ for 30min, then the microfluidic channel of the microfluidic chip is washed with PBS solution for 5min, and the effluent solution is collected at the sample outlet of the chip, and it is determined that the collected solution contains both HMC-1 tumor cell and HepG2 tumor cell, thereby realizing the combined lossless release and combined typing of the tumor cell HMC-1 and HepG 2.

In this embodiment, multiple modified nucleic acid probes on the microfluidic chip can respectively recognize different types of CTC surface markers, and the sgRNA/Cas9 complex as the releasing agent can specifically recognize the corresponding nucleic acid probe, and the nondestructive release and typing of specific CTC cells can be simultaneously realized by sequentially adding different single releasing agents. When a plurality of release agents which are randomly combined are added, the combined lossless release and the combined typing of the multi-type CTC cells can be simultaneously realized.

The foregoing description is only exemplary of the preferred embodiments of the invention and is illustrative of the principles of the technology employed. It will be appreciated by those skilled in the art that the scope of the invention herein disclosed is not limited to the particular combination of features described above, but also encompasses other arrangements formed by any combination of the above features or their equivalents without departing from the spirit of the invention. For example, the above features and (but not limited to) features having similar functions disclosed in the present invention are mutually replaced to form the technical solution.

SEQUENCE LISTING

<110> Jing east science and technology group Ltd

<120> nucleic acid probe, biochip, kit and method for sorting target cells

<130>0000-00-000

<160>10

<170>PatentIn version 3.3

<210>1

<211>159

<212>DNA

<213> Artificial sequence

<400>1

ctatggcgtg caacgcactt ctgaacacaa agcatagact gcgggttcct tagaggacat 60

tgctgctgca gttgatcctt tggataccct ggagcagcaa tgtcctctaa ggaacccgca 120

gtctatgctt tgtgttcaga agtgcgttgc acgccatag 159

<210>2

<211>25

<212>DNA

<213> Artificial sequence

<400>2

gcagttgatc ctttggatac cctgg 25

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<400>3

gaacacaaag catagactgc ggg 23

<210>4

<211>174

<212>DNA

<213> Artificial sequence

<400>4

ataggggtac aatcggaact atggcccaga ctgagcacgt gatggtgcgc tactactgat 60

gcatgcgaac agagggacaa acgggggaag atttgacgtc gacgacacgc atgcatcagt 120

agtagcgcac catcacgtgc tcagtctggg ccatagttcc gattgtaccc ctat 174

<210>5

<211>40

<212>DNA

<213> Artificial sequence

<400>5

aacagaggga caaacggggg aagatttgac gtcgacgaca 40

<210>6

<211>23

<212>DNA

<213> Artificial sequence

<400>6

ggcccagact gagcacgtga tgg 23

<210>7

<211>117

<212>DNA

<213> Artificial sequence

<400>7

taatacgact cactataggg gaacacaaag catagactgc gttttagagc tagaaatagc 60

aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgct 117

<210>8

<211>117

<212>DNA

<213> Artificial sequence

<400>8

taatacgact cactataggg ggcccagact gagcacgtga gttttagagc tagaaatagc 60

aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgct 117

<210>9

<211>97

<212>RNA

<213> Artificial sequence

<400>9

gaacacaaag cauagacugc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97

<210>10

<211>97

<212>RNA

<213> Artificial sequence

<400>10

ggcccagacu gagcacguga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcu 97

Claims

1. A nucleic acid probe for sorting target cells, comprising a cell binding unit and a cleavage unit,

the cell binding unit is an aptamer containing a specific binding sequence of a target cell surface marker, and can be specifically bound with the target cell;

the cleavage unit contains a recognition sequence specific for a gene editing complex and is specifically cleavable by the gene editing complex.

2. The nucleic acid probe of claim 1, wherein the gene editing complex is selected from the group consisting of a sgRNA/Cas complex, a zinc finger nuclease, a transcription activator-like effector nuclease; preferably, the gene editing complex is a sgRNA/Cas9 complex.

3. The nucleic acid probe of claim 1, further comprising a modifying group that can attach the nucleic acid probe to a biochip.

4. The nucleic acid probe of claim 1, further comprising a first linker sequence between the cell binding unit and the cleavage unit.

5. The nucleic acid probe of claim 1, wherein the target cell is a circulating tumor cell.

6. A biochip for sorting target cells, comprising:

a solid support, and the nucleic acid probe according to any one of claims 1 to 5 disposed on the solid support.

7. The biochip according to claim 6, wherein two or more nucleic acid probes specifically cleavable by different gene-editing complexes are disposed on the solid support.

8. A kit for sorting target cells, comprising the nucleic acid probe according to any one of claims 1 to 5; wherein the kit also comprises a releasing agent and a biochip which can be combined with the nucleic acid probe, and the releasing agent comprises a gene editing complex which can specifically cut the nucleic acid probe.

9. A method of sorting target cells, the method comprising:

(a) contacting a biological sample with a biochip comprising a nucleic acid probe according to any one of claims 1 to 5;

10. The method for sorting target cells according to claim 9, wherein the biochip comprises two or more nucleic acid probes, and the releasing agents comprising different gene-editing complexes are sequentially added in step (b) of the method, and the released target cells are collected separately.