CN111411064B - Method for in-situ fluorescence labeling of geobacillus - Google Patents
Method for in-situ fluorescence labeling of geobacillus Download PDFInfo
- Publication number
- CN111411064B CN111411064B CN202010164077.8A CN202010164077A CN111411064B CN 111411064 B CN111411064 B CN 111411064B CN 202010164077 A CN202010164077 A CN 202010164077A CN 111411064 B CN111411064 B CN 111411064B
- Authority
- CN
- China
- Prior art keywords
- ppfbfp
- plasmid
- geobacillus
- gene
- geobacter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Toxicology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for in-situ fluorescence labeling of geobacillus, which is characterized in that a PpFbFP fluorescent protein gene is transferred into the geobacillus, the PpFbFP fluorescent protein label is not influenced by oxygen, a labeled geobacillus strain can fluoresce under an anaerobic condition, the half-life period is long, and the motion trail, the film forming process and the group behavior of the geobacillus can be observed in real time for a long time.
Description
Technical Field
The invention relates to a method for in-situ fluorescence labeling of geobacillus, belonging to the technical field of microorganisms.
Background
Geobacter (Geobacter) is the most abundant and widely distributed electroactive bacteria in the natural environment, is also the electroactive mode strain which is most widely researched and has the strongest electron transfer activity, is widely distributed in anaerobic environments such as freshwater sediments, organic matters and underground water sedimentary layers polluted by heavy metals and the like, and has three functions of iron reduction, humus reduction and electricity generation. The electroactive biomembrane formed by the geobacillus has important application value in the aspects of environmental remediation and bioengineering, can realize the production of electric energy or other chemicals while treating pollutants, and is beneficial to the transformation of pollution remediation technology to the direction of low investment, low energy consumption and low pollution. By utilizing an in-situ fluorescent protein labeling technology, the dynamic process of the formation of the geobacillus biofilm and the group behaviors among bacteria are explored in real time, and the method has important significance for promoting the formation of the geobacillus electroactive biofilm and improving the environmental and economic benefits of the geobacillus electroactive biofilm.
At present, the method of in situ fluorescent protein labeling has been widely applied in the aspects of researching regulation of genes, synthesis, folding, positioning, movement, interaction and the like of proteins. Among them, a aequorea victoria multiphoton luminescent jellyfish Green Fluorescent Protein (GFP) is most widely used. However, the synthesis of chromophoric chromophores requires oxygen molecules as an essential cofactor and cannot be used in the anaerobic bacteria Bacillus. Furthermore, the short half-life of GFP also limits its use in long-term in situ biofilm formation. Therefore, the effective strategy for solving the problem that the existing bacillus cannot carry out in-situ fluorescence labeling is to find a fluorescent probe which can emit light under the anaerobic condition and has a long half-life period and a labeling method thereof.
Disclosure of Invention
The invention provides a method for in-situ fluorescence labeling of geobacillus, which can effectively solve the problems.
The invention is realized by the following steps:
a method for in situ fluorescence labeling of Geobacillus, which is to transfer PpFbFP fluorescent protein gene into Geobacillus.
As a further improvement, the nucleotide sequence of the PpFbFP fluorescent protein gene is shown as SEQ ID NO: 01, shown in the figure.
As a further improvement, the geobacillus is Geobacter sulfuriduccus.
As a further improvement, the method comprises the following steps:
s1, constructing a plasmid pUC-PpFbFP containing the PpFbFP fluorescent protein gene by adopting a plasmid pUC 19;
s2, transferring the plasmid pUC-PpFbFP constructed in the step S1 into Geobacter sulfuriduens.
As a further improvement, the plasmid pUC-PpFbFP was inserted into the strong promoter of ompJ at the time of construction.
As a further improvement, the plasmid pUC-PpFbFP is also inserted with a gentamicin resistance gene during construction.
As a further improvement, the PpFbFP fluorescent protein gene is inserted between the GSU0808 and GSU0807 sites of the plasmid pUC 19.
As a further improvement, step S2 is specifically:
a, singly digesting a plasmid pUC-PpFbFP by using a restriction enzyme ScaI to linearize the plasmid, and concentrating the linearized plasmid;
b, precooling the PCA of the Geobacter sulfurducens cultured to the logarithmic phase at 4 ℃ under an anaerobic condition, centrifuging and collecting thalli, washing the thalli twice by using an electrotransfer Buffer precooled at 4 ℃ to prepare the PCA competence of the Geobacter sulfurducens;
c, adding the concentrated linearized plasmid pUC-PpFbFP into the Geobacter sulfurducens PCA competent cell suspension, uniformly mixing, transferring into the bottom of a precooled electric shock cup, and performing instantaneous electric shock to promote the plasmid to be transferred into the competent cell;
and D, performing electrocompetent cell culture on the Geobacter sulfurducens PCA subjected to suspension transformation by using an NBAF culture medium, coating bacterial liquids with different concentrations on NBAF agar plates containing gentamicin, culturing the NBAF agar plates in an anaerobic incubator, selecting a single colony on each plate, inoculating the single colony to the NBAF culture medium, and performing PCR amplification verification after the bacterial strains grow.
As a further improvement, the parameter of the instantaneous shock is 1.47Kv/cm, and the time is 5 ms.
As a further improvement, the content of the gentamicin is 10-30 mug/mL.
The invention also provides a construction method of the plasmid pUC-PpFbFP, which comprises the following steps:
(1) extracting Geobacter sulfureated PCA genome DNA, taking the Geobacter sulfureated PCA genome DNA as a template, and respectively amplifying nucleotide sequences of GSU0808, PompJ and GSU0807 by using a PCR amplification technology and a primer pair GSU 0808/GSU 0808R, PompJF/PompJR and GSU 0807/GSU 0807R; amplifying a gentamycin resistance gene Gent by adopting a plasmid pCM351 and a primer pair GentFor/GentRev and utilizing a PCR (polymerase chain reaction) technology;
(2) purifying the nucleotide sequences of the amplified GSU0808, PompJ and GSU0807 and the gene Gent;
(3) carrying out Infusion on the purified nucleotide sequences and gene Gent of GSU0808, PompJ and GSU0807 and a linearized pUC19 plasmid vector to construct a plasmid pUC-PpFbFP;
(4) transferring the recombinant plasmid pUC-PpFbFP into E.coli DH 5 alpha competent cells for culture, picking out a single colony and carrying out sequencing verification.
The invention also provides a plasmid pUC-PpFbFP constructed by the method.
The invention has the beneficial effects that:
the PpFbFP fluorescent protein marker disclosed by the invention is not influenced by oxygen, can enable the marked geobacillus to fluoresce under an anaerobic condition, has a long half-life period (>40h), and can realize long-term real-time observation of the movement locus, the film forming process and the group behavior of the strict anaerobic microbe geobacillus.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a gene arrangement diagram of a plasmid pUC-PpFbFP according to an embodiment of the present invention.
FIG. 2 is a fluorescent detection image of Geobacter sulfureatedrens PpFbFP according to an embodiment of the present invention.
FIG. 3 is a PCR identification chart of PpFbFP fluorescent protein-labeled Geobacter sulfuriducens PpFbFP according to an embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be described clearly and completely with reference to the accompanying drawings of the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention. Thus, the following detailed description of the embodiments of the present invention, presented in the figures, is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention.
In the description of the present invention, the terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.
Examples
Strains referred to in the examples: (1) escherichia coli strain DH 5 alpha chemical competent cells (purchased from Beijing Quanjin Biotechnology Co., Ltd.) were used for gene cloning and plasmid amplification. (2) Geobacter sulfuriduens PCA (purchased from American type culture Collection, Strain No. ATCC-51573) was used to construct fluorescent protein-tagged strains.
The NBAF medium formulation involved in the culture of the strains in this example was as follows:
42g KH per liter of 100 XNB salt solution2PO4，22g K2HPO4，20g NH4Cl， 38g KCl，36g NaCl。
NB mineral solution containing 2.14g NTA per liter; 0.1g MnCl2*4H2O；0.3g FeSO4*7H2O；0.17g CoCl2*6H2O；0.2g ZnSO4*7H2O；0.03g CuCl2*2 H2O；0.005g AlK(SO4)2*12H2O；0.005g H3BO3；0.09g Na2MnO4*2H2O； 0.11g NiSO4*6H2O；0.02g Na2WO4*2H2O。
0.002g biotin per liter of DL vitamin solution; 0.005g vitamin B5; 0.0001 g vitamin B12; 0.005g of p-aminobenzoic acid; 0.005g a-lipoic acid; 0.005g nicotinic acid; 0.005g vitamin B1; 0.005g riboflavin; 0.01g vitamin B6; 0.002g folic acid.
The LB medium formula is as follows: 5g yeast extract; 10g of NaCl; 10g tryptone.
Solid LB and NBAF plates contained 1.5% agar. The gentamicin content in the antibiotic selection plates was 20. mu.g/mL.
Plasmids referred to in the examples: (1) the linear plasmid pUC19 (purchased from Baori physician's technology (Beijing) Co., Ltd.) was a cloning vector for PCR products and was directly used as a homologous recombination vector for constructing PpFbFP fluorescent protein-labeled mutant strains. The plasmid pUC-PpFbFP originates from the plasmid pUC19, contains the gentamicin resistance gene and carries the PpFbFP coding gene sequence.
In this example, gene manipulation and plasmid construction:
construction of pUC-PpFbFP plasmid
(1) Geobacter sulfurfuglucens PCA was cultured in NBAF medium. Using DNA kit (PureLink)TMGenomic DNA Mini Kit, U.S. Thermo Fisher Scientific company, No. K182001) and primer pairs GSU0808F/GSU0808R, PompJF/PompJR and GSU0807F/GSU0807R, and PCR amplification technology is used for amplifying the gene sequences of GSU0808, PompJ and GSU0807 respectively. The PCR reaction system is as follows: 1. mu.L of DNA template, 1. mu.L of 10. mu.M of each of the upper and lower primers, 25. mu.L of PrimeSTAR Max DNA Polymerase (TaKaRa Co., Code No. R045A, Japan) and 22. mu.L of ddH2And O. The PCR reaction program is: 30s at 95 ℃ and then 30 cycles (15 s at 95 ℃, 30s at 55 ℃, 1min at 68 ℃) and 10min at 72 ℃. The gentamicin resistance gene Gent was amplified from plasmid pCM351 (purchased from Addgene plasmid Collection, USA, Cat. No.: 46013) using the primer pair GentFor/GentREv. The sequence of the PpFbFP fluorescent protein coding gene (PpFbFP) is directly obtained by a DNA synthesis technology. Nucleus of PpFbFPThe nucleotide sequence is as follows:
ATGATAAATGCAAAACTTCTTCAGCTTATGGTAGAACATTCAAATG ATGGTATAGTAGTAGCAGAACAGGAAGGTAATGAATCAATACTTATATA TGTAAATCCTGCATTTGAAAGACTTACAGGTTATTGTGCAGATGATATA CTTTATCAGGATGCAAGATTTCTTCAGGGTGAAGATCATGATCAGCCT GGTATAGCAATAATAAGAGAAGCAATAAGAGAAGGTAGACCTTGTTGT CAGGTACTTAGAAATTATAGAAAAGATGGTTCACTTTTTTGGAATGAA CTTTCAATAACACCTGTACATAATGAAGCAGATCAGCTTACATATTATAT AGGTATACAGAGAGATGTAACAGCACAGGTATTTGCAGAAGAAAGAG TAAGAGAACTTGAAGCAGAAGTAGCAGAACTTAGAAGACAGCAGGG TCAGGCAAAACATTAACCATGGGGATCCGTCGACCCCGGGGAATTCTA ATAAAAATAACTCTGTAGAATTATAAATTAGTTCTACAGAGTTATTTTTG GCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACAC CGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAA GCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCT TGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGG AGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAG ACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATA ATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGC GGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCT CATGAGACAATAACCCTGATAAATG(SEQ ID NO：01)。
GSU0808 and GSU0807 are insertion sites of PpFbFP genes, and researches show that the insertion sites can not influence the growth and the electrogenesis of Geobacter sulfuriduens PCA after gene fragments are inserted into the insertion sites.
The primer sequences are as follows:
GSU0808F：
CGGTACCCGGGGATCGTGGTGGACCCCCTTACCGGT(SEQ ID NO：02)。
GSU0808R：
CGGCCGTTACTAGTGTGTGACCGCTGCCGGCTCCGGTCA(SEQ ID NO： 03)。
GSU0807F：
CTCATGAGACAATAACCCTGATAAATGAGGGCAGACATTGCGGAACGT GCCA(SEQ ID NO：04)。
GSU0807R：CGACTCTAGAGGATCGGGTTCCGCTGCCGTCGTAC (SEQ ID NO：05)。
the nucleotide sequence of PompJF is as follows:
ATCACACTGGCGGCCGCCGCTGGAAGGTCTGTCGATGCA(SEQ ID NO： 06)。
the nucleotide sequence of PompJR is as follows:
CTTGGCGTTGATcatCGTTGCCTCCTTCATTGGTGATAAAACAGC(SEQ ID NO：07)。
the nucleotide sequence of GentFor is as follows: CACTAGTAACGGCCGCCAG (SEQ ID NO: 08).
The nucleotide sequence of GentRev is as follows: GGCCGCCAGTGTGATGGAT (SEQ ID NO: 09).
The genes of GSU0808, PompJ, GSU0807 and Gent were purified using a PCR product purification kit (Mini BEST, TaKaRa, Japan).
(2) Placing the purified PCR product of (1) with a linearized pUC19 plasmid vector and 5 XIn-Fusion HD Enzyme Premix (TaKaRa Co., Japan, Code No.638909) In a PCR instrument at 50 ℃ for 15min to construct a plasmid pUC-PpFbFP;
(3) the recombinant plasmid pUC-PpFbFP was transferred into E.coli DH 5. alpha. competent cells (grown on LB plates), and a single colony was picked up and verified by Sanger sequencing (Shanghai Bioengineering Co., Ltd.) to obtain the plasmid pUC-PpFbFP. The gene arrangement of the plasmid pUC-PpFbFP is shown in FIG. 1.
2. Construction of PpFbFP fluorescent protein-labeled Geobacter sulfurreducens PpFbFP bacteria
(1) The plasmid pUC-PpFbFP was digested singly with the restriction enzyme ScaI to linearize it to a total amount of not less than 10. mu.g, and the linearized plasmid was concentrated. The concentration steps are as follows: 1) 100 μ L of the plasmid was put into a 1.5mL centrifuge tube, and 10 μ L of 3M sodium acetate solution (pH 5.2) was added and mixed; 2) Adding 250 μ L of glacial ethanol (precooling at 4 deg.C), mixing, standing at-20 deg.C (>20min), centrifuging at 4 deg.C >12000g for 30 min; 3) discarding the supernatant, adding 1mL 70% glacial ethanol (precooling at 4 ℃), centrifuging at 4 ℃ for 30min at 12000 g; 4) discarding the supernatant, adding 500 μ L of glacial ethanol (precooling at 4 ℃), centrifuging at 4 ℃ for 30min at 12000 g; 5) discard the supernatant, add 10. mu.L sterile water after the ethanol has evaporated, redissolve the plasmid and determine the concentration.
(2) Preparation of Geobacter sulfureatencA competence. Geobacter sulfurducens cultured in an NBAF culture medium until the logarithmic phase are pre-cooled at 4 ℃ (4500 Xg 12min), and then centrifuged to collect thalli, and the thalli are washed twice by an electrotransfer Buffer pre-cooled at 4 ℃ (4500 Xg 12min), wherein the operations are carried out under the anaerobic condition.
(3) mu.L of the concentrated linearized plasmid pUC-PpFbFP was added to 1. mu.L of Geobacter sulfurducens PCA competent cell suspension, gently mixed and transferred to the bottom of a pre-cooled electric cuvette. The cuvette was subjected to a transient shock to facilitate plasmid transfer into competent cells (1.47Kv/cm,5 ms. Bio-Rad MicroPulser).
(4) 0.2mL of the reduced NBAF culture medium is taken to suspend the transformed Geobacter sulfuriducens PCA electrocompetent cells, and the cells are transferred into the NBAF culture medium to be cultured for 18h at 30 ℃.
(5) After 18h, bacterial liquids of different concentrations (original bacterial liquid and bacterial liquid concentrated by 10 times) were taken out from the anaerobic incubator, coated on NBAF agar plates containing gentamicin, and placed in the anaerobic incubator for culture.
(6) A single colony on the plate is picked and inoculated into a reduced NBAF culture medium, after the strain grows, PCR amplification verification is carried out on the verPpFbFP-F/verPpFbFP-R and the seqGentFor/seqPpFbFPr by using verification primer pairs, and the verification result is shown in the following figure 3. The sequences of the primers are as follows:
verPpFbFP-F CGGACCCACCATTGCGGATAA(SEQ ID NO：10)
verPpFbFP-R GACTAGGCCGACAACTCGATGT(SEQ ID NO：11)
seqGentFor ACGAACCGAACAGGCTTATGTC(SEQ ID NO：12)
seqPpFbFPr AGATGAGGATGGACTCGTTGC(SEQ ID NO：13)
after the Geobacter sulfurducens PCA is successfully marked by the PpFbFP fluorescent protein, the fluorescence state of the Geobacter sulfurducens PpFbFP is detected by utilizing laser confocal microscopy under the conditions that the emission wavelength and the excitation wavelength are 495nm and 452nm respectively, and the result is shown in FIG. 2. The half-life of the fluorescent label of the embodiment reaches 41 h. After the anaerobic strain Geobacter sulfuridunens PCA is marked by the fluorescent protein, the movement locus, the film forming process and other group behaviors among microorganisms of the strain can be observed in real time under the anaerobic condition by combining with a fluorescence microscope.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
<120> method for in situ fluorescence labeling of geobacillus
<130> 2020
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 941
<212> DNA
<213> Artificial sequence
<400> 1
atgataaatg caaaacttct tcagcttatg gtagaacatt caaatgatgg tatagtagta 60
gcagaacagg aaggtaatga atcaatactt atatatgtaa atcctgcatt tgaaagactt 120
acaggttatt gtgcagatga tatactttat caggatgcaa gatttcttca gggtgaagat 180
catgatcagc ctggtatagc aataataaga gaagcaataa gagaaggtag accttgttgt 240
caggtactta gaaattatag aaaagatggt tcactttttt ggaatgaact ttcaataaca 300
cctgtacata atgaagcaga tcagcttaca tattatatag gtatacagag agatgtaaca 360
gcacaggtat ttgcagaaga aagagtaaga gaacttgaag cagaagtagc agaacttaga 420
agacagcagg gtcaggcaaa acattaacca tggggatccg tcgaccccgg ggaattctaa 480
taaaaataac tctgtagaat tataaattag ttctacagag ttatttttgg cgcctgatgc 540
ggtattttct ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta 600
caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg 660
cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg 720
ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc 780
tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct tagacgtcag 840
gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 900
caaatatgta tccgctcatg agacaataac cctgataaat g 941
<210> 2
<211> 36
<212> DNA
<213> Artificial sequence
<400> 2
cggtacccgg ggatcgtggt ggaccccctt accggt 36
<210> 3
<211> 39
<212> DNA
<213> Artificial sequence
<400> 3
cggccgttac tagtgtgtga ccgctgccgg ctccggtca 39
<210> 4
<211> 52
<212> DNA
<213> Artificial sequence
<400> 4
ctcatgagac aataaccctg ataaatgagg gcagacattg cggaacgtgc ca 52
<210> 5
<211> 35
<212> DNA
<213> Artificial sequence
<400> 5
cgactctaga ggatcgggtt ccgctgccgt cgtac 35
<210> 6
<211> 39
<212> DNA
<213> Artificial sequence
<400> 6
atcacactgg cggccgccgc tggaaggtct gtcgatgca 39
<210> 7
<211> 45
<212> DNA
<213> Artificial sequence
<400> 7
cttggcgttg atcatcgttg cctccttcat tggtgataaa acagc 45
<210> 8
<211> 19
<212> DNA
<213> Artificial sequence
<400> 8
cactagtaac ggccgccag 19
<210> 9
<211> 19
<212> DNA
<213> Artificial sequence
<400> 9
ggccgccagt gtgatggat 19
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence
<400> 10
cggacccacc attgcggata a 21
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence
<400> 11
gactaggccg acaactcgat gt 22
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence
<400> 12
acgaaccgaa caggcttatg tc 22
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
agatgaggat ggactcgttg c 21
Claims (6)
1. A method for in situ fluorescence labeling of Geobacillus, characterized by: transferring PpFbFP fluorescent protein gene into Geobacillus (Geobacter) The nucleotide sequence of the PpFbFP fluorescent protein gene is shown as SEQ ID NO: 1 is shown.
2. The method for fluorescence labeling of Geobacillus in situ according to claim 1, wherein: the geobacter isGeobacter sulfurreducensAnd (5) bacteria.
3. The method for fluorescence labeling of Geobacillus in situ according to claim 2, wherein: the method comprises the following steps:
s1, constructing a plasmid pUC-PpFbFP containing the PpFbFP fluorescent protein gene by adopting a plasmid pUC 19; the structure of the plasmid pUC-PpFbFP is that a site GSU0808 of the plasmid pUC19, a gentamicin resistance gene Gent, a PompJ strong promoter, a PpFbFP fluorescent protein gene and a site GSU0807 of the plasmid pUC19 are connected in series in sequence;
s2, the plasmid pUC-PpFbFP constructed in the step S1 was transferredGeobacter sulfurreducensAnd (5) bacteria.
4. The method for fluorescence labeling of Geobacillus in situ according to claim 3, wherein: step S2 specifically includes:
a, singly digesting a plasmid pUC-PpFbFPFP by using a restriction enzyme ScaI to linearize the plasmid, and concentrating the linearized plasmid;
b, culturing the strain to logarithmic phase under anaerobic conditionGeobacter sulfurreducensPrecooling at 4 ℃ by PCA, centrifuging and collecting thalli, washing the thalli twice by using an electrotransfer Buffer precooled at 4 ℃ to prepareGeobacter sulfurreducensPCA competence;
c, adding the concentrated linearized plasmid pUC-PpFbFPGeobacter sulfurreducensUniformly mixing PCA competent cell suspension, transferring into the bottom of a precooled electric shock cup, and performing instantaneous electric shock to promote plasmid to be transferred into competent cells;
d, suspension transformation with NBAF MediumGeobacter sulfurreducensPCA electrocompetent cells for cultureAnd (3) culturing, namely coating the bacterial liquids with different concentrations on NBAF agar plates containing gentamicin, culturing the NBAF agar plates in an anaerobic incubator, selecting a single colony on the plates, inoculating the single colony to an NBAF culture medium, and performing PCR amplification verification after the bacterial strains proliferate and grow.
5. A method for constructing a plasmid pUC-PpFbFP is characterized in that: the method comprises the following steps:
(1) extraction ofGeobacter sulfurreducensGenomic DNA of PCA andGeobacter sulfurreducensPCA genome DNA is taken as a template, and the nucleotide sequences of GSU0808, PompJ and GSU0807 are respectively amplified by using a PCR amplification technology and a primer pair GSU0808F/GSU0808R, PompJF/PompJR and GSU0807F/GSU 0807R; the plasmid pCM351 and a primer pair GentFor/GentRev are adopted to amplify the gentamycin resistance gene G by utilizing a PCR technologyent(ii) a The nucleotide sequences of the primers GSU0808F, GSU0808R, GSU0807F, GSU0807R, PompJF, PompJR, GentFor and GentRev are shown as SEQ ID NO: 2 to SEQ ID NO: 9 is shown in the figure;
(2) purifying the nucleotide sequences of the amplified GSU0808, PompJ and GSU0807 and the gene Gent;
(3) carrying out Infusion on the purified nucleotide sequences of GSU0808, PompJ and GSU0807, gene PpFbFP and gene Gent and a linearized pUC19 plasmid vector to construct a plasmid pUC-PpFbFP; the structure of the plasmid pUC-PpFbFP is that GSU0808, Gent, PompJ, PpFbFP and GSU0807 are connected in series in sequence; the nucleotide sequence of the gene PpFbFP is shown as SEQ ID NO: 1 is shown in the specification;
(4) transfer of recombinant plasmid pUC-PpFbFPE. coliDH 5 alpha competent cells were cultured, single colonies were picked and sequence verified.
6. A plasmid pUC-PpFbFP constructed according to the method of claim 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010164077.8A CN111411064B (en) | 2020-03-11 | 2020-03-11 | Method for in-situ fluorescence labeling of geobacillus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010164077.8A CN111411064B (en) | 2020-03-11 | 2020-03-11 | Method for in-situ fluorescence labeling of geobacillus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111411064A CN111411064A (en) | 2020-07-14 |
| CN111411064B true CN111411064B (en) | 2021-06-04 |
Family
ID=71489180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010164077.8A Active CN111411064B (en) | 2020-03-11 | 2020-03-11 | Method for in-situ fluorescence labeling of geobacillus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111411064B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112683904B (en) * | 2020-12-21 | 2022-04-26 | 中国科学院长春应用化学研究所 | In-situ characterization device and characterization method for interaction between microorganisms and solid surface |
| CN114410559B (en) * | 2022-01-25 | 2023-07-25 | 福建农林大学 | Heavy metal-passivated geobacillus engineering strain and construction method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011005554A3 (en) * | 2009-06-23 | 2011-07-28 | Verenium Corporation | Recombinant ethanologenic bacteria |
| CN103103282A (en) * | 2013-01-27 | 2013-05-15 | 盐城师范学院 | Primer and probe for detecting abundance of geobacter microorganism in anaerobic environment by real-time fluorescence quantification |
| CN105566440A (en) * | 2016-01-22 | 2016-05-11 | 深圳市贝沃德克生物技术研究院有限公司 | Fixed point fluorescent labeling method based on NBDK (7-nitrobenzo-2-oxa-1,3-diazole- lysine) |
-
2020
- 2020-03-11 CN CN202010164077.8A patent/CN111411064B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011005554A3 (en) * | 2009-06-23 | 2011-07-28 | Verenium Corporation | Recombinant ethanologenic bacteria |
| CN103103282A (en) * | 2013-01-27 | 2013-05-15 | 盐城师范学院 | Primer and probe for detecting abundance of geobacter microorganism in anaerobic environment by real-time fluorescence quantification |
| CN105566440A (en) * | 2016-01-22 | 2016-05-11 | 深圳市贝沃德克生物技术研究院有限公司 | Fixed point fluorescent labeling method based on NBDK (7-nitrobenzo-2-oxa-1,3-diazole- lysine) |
Non-Patent Citations (2)
| Title |
|---|
| Molecular Analysis of the In Situ Growth Rates of Subsurface Geobacter Species;Holmes, DE等;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;20130331;第79卷(第5期);第1646-1653页 * |
| 荧光蛋白标记研究进展;杨晓玫等;《草业学报》;20191231(第10期);第32-38,43页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111411064A (en) | 2020-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | Isolation and characterization of methylotrophic methanogens from anoxic marine sediments in Skan Bay, Alaska: description of Methanococcoides alaskense sp. nov., and emended description of Methanosarcina baltica | |
| Hallberg et al. | Acidiferrobacter thiooxydans, gen. nov. sp. nov.; an acidophilic, thermo-tolerant, facultatively anaerobic iron-and sulfur-oxidizer of the family Ectothiorhodospiraceae | |
| Shigematsu et al. | Effect of dilution rate on structure of a mesophilic acetate-degrading methanogenic community during continuous cultivation | |
| Flies et al. | Combined approach for characterization of uncultivated magnetotactic bacteria from various aquatic environments | |
| CN111411064B (en) | Method for in-situ fluorescence labeling of geobacillus | |
| Sun et al. | Perspectives on cultivation strategies of archaea | |
| Tani et al. | Practical application of methanol-mediated mutualistic symbiosis between Methylobacterium species and a roof greening moss, Racomitrium japonicum | |
| Rago et al. | Bioelectrochemical nitrogen fixation (e-BNF): electro-stimulation of enriched biofilm communities drives autotrophic nitrogen and carbon fixation | |
| Ganzert et al. | Methanosarcina spelaei sp. nov., a methanogenic archaeon isolated from a floating biofilm of a subsurface sulphurous lake | |
| Madigan et al. | Taxonomy, physiology and ecology of heliobacteria | |
| Slobodkina et al. | Geoglobus acetivorans sp. nov., an iron (III)-reducing archaeon from a deep-sea hydrothermal vent | |
| Liu et al. | Description of two new thermophilic Desulfotomaculum spp., Desulfotomaculum putei sp. nov., from a deep terrestrial subsurface, and Desulfotomaculum luciae sp. nov., from a hot spring | |
| Allahverdiyeva et al. | Screening for biohydrogen production by cyanobacteria isolated from the Baltic Sea and Finnish lakes | |
| Arulmani et al. | Sustainable bioelectricity production from Amaranthus viridis and Triticum aestivum mediated plant microbial fuel cells with efficient electrogenic bacteria selections | |
| Müller et al. | Close interspecies interactions between prokaryotes from sulfureous environments | |
| Beleneva et al. | Characterization of Vibrio gigantis and Vibrio pomeroyi isolated from invertebrates of Peter the Great Bay, Sea of Japan | |
| Balakrishna et al. | Isolation of phosphate solubilizing actinomycetes from forest soils of Mahabubnagar district | |
| WO2023050513A1 (en) | Fungus ljd-6 capable of efficiently degrading benzo[a]pyrene and application thereof | |
| Deng et al. | A Geobacter strain isolated from rice paddy soil with higher bioelectricity generation capability in comparison to Geobacter sulfurreducens PCA | |
| CN106011021A (en) | Method for separating, purifying and identifying bacteria with super selenium endurance | |
| CN114686404B (en) | Strain with iron reduction capability and power generation capability and application thereof | |
| CN109486871A (en) | A method of utilizing bacillus licheniformis engineered strain fermenting and producing 3-hydroxy-2-butanone | |
| JP6893820B2 (en) | Methods to improve resistance of nitric acid to substrate analogs in microalgae | |
| Kulichevskaya et al. | A novel filamentous planctomycete of the Isosphaera-Singulisphaera group isolated from a Sphagnum peat bog | |
| Jacob et al. | Diversity of Magnetospirillum sp. from the southern coast of India |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |