CN111394293A - Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain, and construction method and application thereof - Google Patents

Abstract

The invention discloses a Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain, which is a Brucella Swine S2 Omp16 delta Omp16 and is preserved in China center for type culture Collection in 2019, 12 and 2 months, and the preservation number is CCTCC NO: and M2019991. The strain is a Brucella S2 vaccine strain which is deleted of endogenous Omp16 gene on the basis of conditionally inducing exogenous Omp16 expression, and can be used for preparing Brucella attenuated vaccines. The conditional induction deletion strain of the Omp16 gene of the Brucella S2 vaccine strain lays a foundation for researching the pathogenic mechanism of Omp16 on Brucella and distinguishing the characteristics of natural infection and artificial immunity, and has important significance for preventing and controlling brucellosis.

Description

Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain, and construction method and application thereof

Technical Field

The invention relates to the field of biology, in particular to a Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain, a construction method and application thereof.

Background

Brucella, also known as brucella or brucella, belongs to gram-negative intracellular parasitic bacteria and can cause brucellosis, referred to as brucellosis for short. Brucella infects primarily ruminants such as cattle, sheep and pigs, but can still infect wild and marine animals, and even humans. Brucella infection of livestock is mainly manifested by late pregnancy abortion of pregnant female animals and orchitis of male animals. The main symptoms of human brucella infection are different from that of livestock, and the clinical manifestations are repeated fever, weakness, arthritis and orchitis. Brucella is abused worldwide, causing serious economic losses. Each year, about more than 50 million people worldwide are infected with brucellosis. Furthermore, the actual number of new infections per year may be higher due to the lack of typical clinical symptoms in humans. Human infection with brucellosis is mainly through direct contact with sick animals or eating contaminated dairy products, and human infection with brucella has occupational tendencies, as herdsmen and veterinarians are high-risk infected people.

The brucella outer membrane protein has important immunoinflammatory and protective properties, and related tests show that the brucella outer membrane protein is closely related to the virulence thereof. Omp22, Omp25 and Omp31 are important cell wall components and major virulence factors of brucella and are favorable for intracellular survival and establishment of chronic infection of brucella, and the mutant strains have an attenuating effect in natural hosts. Relevant experiments revealed that Brucella Omp25 inhibits the secretion of TNF-a by modulating the modulation of different MicroRNAs. However, the outer membrane protein mutants of brucella Omp10, Omp19, SP41 and BepC did not affect the virulence of brucella in macrophage cells. Brucella Omp16 is a homologue of peptidoglycan-related lipoprotein, and can activate dendritic cells and mediate Th1 immune response as a pathogen-related molecular pattern of Brucella. Furthermore, brucella Omp16 is highly conserved, suggesting that it plays an important role in the intracellular survival and persistent infection process of brucella.

To date, veterinary brucella vaccines still suffer from a number of drawbacks, such as interference with diagnostic tests, being pathogenic to humans, causing miscarriage in pregnant animals, etc., and no brucella vaccine is available to humans. The Brucella Omp16 gene is still not successfully deleted as an important virulence factor, and has certain limitation on the research on the function of Omp 16. The reason why the Brucella Omp16 could not be successfully deleted is probably because it is an essential gene for the survival of Brucella and is crucial for the growth of Brucella and establishment of infection.

Disclosure of Invention

The invention aims to provide a Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain, a construction method and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

a Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain is Brucella (Brucella suis bv.1.str.) S2 Omp16 △ Omp16, which is preserved in China center for type culture collection (CCTCC NO: M2019991) at 12, 12 and 2 days in 2019, with the address of China, Wuhan university and the preservation number of the CCTCC NO: M2019991.

The strain is a Brucella S2 vaccine strain with Omp16 gene knockout, and is constructed by the following steps:

s1 primer design

The method comprises the following steps of designing an Omp16 gene amplification primer, an Omp16 upstream and downstream amplification primer, a skeleton vector amplification primer, a tetracycline-induced promoter amplification primer, an ampicillin resistance gene amplification primer, a screening deletion Omp16 gene identification primer and a quantitative primer by using Primier Primier 5, wherein the sequences of the primers are as follows:

pBBR1MCS5 backbone vector amplification primers:

F1(5’-TTGACATAAGCCTGTTCGGTTCGTA-3’)

R1(5’-CCTCCCAGAGCCTGATAAAAACG-3’)

tetracycline-induced promoter amplification primers:

F2(5’-GCTCTGGGAGGCTGCAGCGGCCGTTTCCATTTAGGTGGGTAC-3’)

R2

(5’-CTTATGTCAACTCGAGTTTTAAGCTTGCATGCGGATCCCCGGGTACCGAGCTCTTTCTCCTCTTTAATGAATTC-3’)

brucella Omp16 gene amplification primers:

F3(5’-GGTACCATGCGCCGTATCCAGTCGATTGCAC-3’)

R3(5’-

AAGCTTTTACTTATCGTCGTCATCCTTGTAATCCCGTCCGGCCCCGTTGAGAA-3’)

omp16 upstream homology arm

F4(5’-CTGCAGTTCGCAGATTGTCTTCACATC-3’)

R4(5’-TCTAGATCATATTGAGGTTAAAACAGGCT-3’)

Omp16 downstream homology arm

F5(5’-GGTACCATGCGCCGTATCCAGTCGATTG-3’)

R5(5’-GAATTCTACCCGATAGCCGACCGACCCT-3’)

Ampicillin resistance gene identification primer:

F6(5’-TCTAGACGCGGAACCCCTATTTGTTTATTTT-3’)

R6(5’-GTCACCTTACCAATGCTTAATCAGTGAGGC-3’)

mutant identification primer:

F7(5’-TGCTGCAACTTGAAACCGG-3’)

R7(5’-CTGGGTTTTTTGCAACTGGTT-3’)

omp16qRT-PCR primers:

F8(5’-TCGATCTCGATTCGTCGCTG-3’)

R8(5’-CAAGGGCGAGGTTGTACTCA-3’)

s2 PCR amplification and gel recovery of target gene

Using brucella S2 vaccine strain genome, PBBR1MCS5 skeleton vector and pG-KJE8 vector as templates, respectively carrying out PCR reaction by using corresponding primers, amplifying Omp16 gene, skeleton vector and tetracycline-induced promoter:

the reaction system comprises 5 × PS Buffer5 μ L, dNTP mix 2 μ L, F0.5 μ L, R0.5 μ L, template 1 μ L, Prime star DNA polymerase 0.5 μ L, ddH₂O 15.5μL；

The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 50 s; extension at 72 ℃ for 1min for 30 cycles; extending for 10min at 72 ℃;

subjecting the PCR product to 1% agarose gel electrophoresis, cutting target size bands, bands of 543bp Omp16 gene, 3563bp skeletal vector and 1082bp tetracycline induction promoter, and recovering PGR product with DNA purification recovery kit produced by Tiangen Biochemical technology company;

s3 recombinant vector PZT-G⁺Vector construction

Connecting the recovered skeleton vector and tetracycline-induced promoter in a PGR instrument at 37 deg.C for 30 min; the linking system is as follows:

transforming the connected product into Escherichia coli competent cell DH5a, placing the solid plate in a 37 deg.C constant temperature incubator for 12h, taking out the solid plate, picking out the colony with good growth condition with a tip, beating the tip into a 50m L centrifuge tube containing 20m L L B liquid culture medium, placing in a 37 deg.C constant temperature shaking table for 12h, and culturing with plasmid produced by Tiangen Biochemical technology companyPZT-G extraction by small and medium extraction kit⁺A recombinant vector;

extracting recombinant vector PZT-G⁺Performing double enzyme digestion by using Hind III and BamH I, and recovering the enzyme digestion product by using a DNA purification recovery kit produced by Tiangen Biotechnology company;

obtaining of cohesive Ends of S4 and Omp16 genes

The Omp16 gene recovered from the gel is connected with a 19T (simple) vector, and the connection system is as follows:

target genes are 1 mu L, 19T vector 4 mu L, solvent 5 mu L;

the reaction conditions are as follows: connecting for 2h at 16 ℃;

the ligation product was transformed into E.coli competent cell DH5a, and after 1 hour of recovery, 100. mu. L of E.coli competent cell DH5a was pipetted into G which had been brought to 37 ℃ in a super clean bench⁺L A plate, coating evenly, culturing for 12 hours at 37 ℃, selecting single colony with good growth state by a white gun head, beating the single colony into a 50m L sterilized centrifuge tube filled with 20m L L B liquid culture medium, culturing for 12 hours by shaking, extracting recombinant vector by using a plasmid small-extraction medium-volume kit produced by Tiangen Biochemical technology company according to the instruction requirements;

the recombinant vector is subjected to double digestion by 19T (simple) -Omp16 with HindIII and BamH I, and is identified by 1% agarose gel electrophoresis, and the Omp16 gene is recovered by gel;

s5 conditional induction carrier PZT-G⁺Construction of Omp16

The double enzyme digested pZT-G is subjected to⁺The recombinant vector and the Omp16 gene are connected under the following reaction conditions and reaction systems;

reaction system:

PZT-G recombinant vector 1 u L;

omp16 gene 4 μ L;

Solution 15μL；

reaction conditions are as follows: connecting for 4h at 16 ℃;

transforming the ligation product into Escherichia coli competent cell DH5a, recovering for 1h, taking recovered bacteria liquid of 100 mu L, and coating G preheated to 37 ℃ in a super clean bench⁺L A flat plate, thenCulturing for 12h in a constant-temperature incubator at 37 ℃, selecting single clones with good growth state on a flat plate, performing shake culture for 12h in L B culture medium, and extracting a PZT-G-Omp16 recombinant vector by using a plasmid small-extraction medium-volume kit produced by Tiangen Biochemical technology company according to the requirements of the specification;

extracting PZT-G⁺Carrying out double enzyme digestion on Hind III and BamH I by the Omp16 recombinant vector, and carrying out electrophoresis identification by using 1% agarose gel;

s6 suicide vector PUC19-A⁺Construction of Omp16

Respectively connecting an Omp16 upstream homology arm (654bp), an Omp16 downstream homology arm (651bp) and an ampicillin resistance gene (973bp) which are recovered from glue with a 19T (simple) carrier, wherein the connection system comprises a target gene 1 mu L, a 19T (simple) vector 4 mu L and a Soluton 15 mu L, and the connection condition is that the connection is carried out for 2h at the temperature of 16 ℃;

transforming the ligation product into escherichia coli competent cell DH5a, and after the transformation and recovery steps, coating 100 mu L bacterial liquid on A⁺L A plate, culturing for 12h at 37 ℃, selecting single clone with good growth condition on the plate, inoculating the single clone in L B liquid culture medium, performing shake culture for 12h at 37 ℃, and extracting recombinant vector by using a plasmid small-extraction medium-volume kit produced by Tiangen Biochemical technology company according to the instruction requirements;

subjecting the extracted recombinant vector to double enzyme digestion, wherein Pst 1 and Xba 1 are used as upstream homology arms of 19T (simple) -Omp16, and Kpn 1 and EcoR 1, 19T (simple) -A are used as downstream homology arms of 19T (simple) -Omp16⁺The double digestion is carried out by using Xba 1 and Kpn 1, and the digestion system is as follows:

19T (simple) -Omp16 upstream homology arm enzyme digestion system, Pst I1.5 mu L, Xba I1.5 mu L, 10 × MBuffer 5 mu L, plasmid 30 mu L, TB 12 mu L;

19T (simple) -Omp16 downstream homology arm enzyme digestion system, Kpn I1.5 mu L, EcoR I1.5 mu L, 10 × MBuffer 5 mu L, plasmid 30 mu L, TB 12 mu L;

19T(simple)-A⁺an enzyme digestion system with Kpn I1.5 mu L, Xba I1.5 mu L, 10 × M Buffer5 mu L, plasmid 30 mu L and TB 12 mu L;

carrying out electrophoresis identification on the product after enzyme digestion by using 1% agarose gel, and carrying out gel recovery on an Omp16 upstream homology arm gene, an Omp16 downstream homology arm gene and an ampicillin resistance gene;

the PUC19 vector is double-digested by EcoR I and Pst I, and the PUC19 digestion system is as follows:

pst I1.5. mu. L, EcoR I1.5. mu. L, 10 × M Buffer 5. mu. L, plasmid 30. mu. L, TB 12. mu. L;

carrying out electrophoresis identification on the product subjected to enzyme digestion by using 1% agarose gel, and recovering the PUC19 vector subjected to enzyme digestion by using the agarose gel;

the Omp16 upstream homology arm gene, Omp16 downstream homology arm gene, ampicillin resistance gene and PUC19 vector recovered from the gel were ligated as follows:

the ligation product was transformed into E.coli competent cell DH5a, recovered and applied to preheated A⁺L A plate, culturing at 37 deg.C for 12 hr, selecting single clone with good growth state on the plate, inoculating to L B liquid culture medium, shake culturing at 37 deg.C for 12 hr, and extracting PUC19-A with plasmid small-extract medium-amount kit produced by Tiangen Biochemical technology corporation⁺-Omp16 recombinant vector;

extracting PUC19-A⁺Carrying out double enzyme digestion on Pst I and EcoR I by the Omp16 recombinant vector, and identifying the enzyme digestion product by 1% agarose gel electrophoresis;

s7, screening brucella strain with exogenous Omp16 expression induced by tetracycline (S2< Omp16>)

S7.1 preparation of Brucella competence

(1) Coating the activated brucella on a TSA (TSA) plate, placing the TSA plate in a constant-temperature incubator, and culturing for 72 hours at 37 ℃;

(2) taking out the plate from the constant temperature incubator, selecting a single clone with good growth condition on the plate, inoculating the single clone into a 50m L centrifugal tube filled with 10m L, and performing shake culture at 37 ℃ for 24 hours;

(3) performing shake culture on the obtained bacterial liquid and a TSB culture medium according to the volume ratio of 1: 100 in a 50m L centrifuge tube at 37 ℃ until the OD600 is 0.6 once;

(4) centrifuging the obtained bacterial liquid in a centrifuge at 4 ℃ at the rotating speed of 5000r/min for 10min, discarding the liquid and leaving the precipitate;

(5) adding precooled sterile water 10m L into the obtained precipitate, resuspending the precipitate, centrifuging in a centrifuge at 4 ℃ at the rotating speed of 5000r/min for 10min, discarding the liquid, and leaving the precipitate;

(6) repeating the step (4) and the step (5) once;

(7) adding 10m of precooled 10% glycerol L, resuspending the precipitate, centrifuging at 4 ℃ in a centrifuge at the rotating speed of 5000r/min for 10min, discarding the liquid, and leaving the precipitate;

(8) repeating the step (7) once;

(9) adding 10% glycerol 1m L pre-cooled at 4 deg.C for 1h, re-suspending the precipitate, packaging in centrifuge tubes 1.5m L with each tube of 100 μ L, and storing in refrigerator at-80 deg.C;

s7.2, electrotransformation

Taking 10 mu of PZT-G of L⁺Adding Omp16 plasmid into brucella competence of 100 mu L, uniformly mixing, adding into an electric shock cup, paying attention to that the electric shock cup is placed in a refrigerator for precooling for 1h at 4 ℃, the electric shock cup is placed on ice for 10min and then transferred into an electric rotating instrument, the set voltage is 1.8KV, the electric shock time is 6ms, the electric shock cup is immediately added into TSB culture solution preheated at 37 ℃, the electric shock cup is transferred into a centrifugal tube of 1.5m L and placed into a shaking table at 37 ℃, the rotating speed is set to be 180rpm/min, after shaking culture is carried out for 24h, centrifuging, removing supernatant, resuspending the precipitate with 200 mu L TSB, coating on a TSA plate with gentamycin resistance, and culturing for 72h at 37 ℃;

s7.3 screening of S2< Omp16> Strain

Taking out the TSA solid plate from a 37 ℃ constant temperature incubator, picking out a bacterial colony with good growth condition by using a gun head, inoculating the bacterial colony into a 10m L centrifuge tube, adding 5m L TSB gentamicin and tetracycline resistant liquid culture medium, placing the bacterial colony in a 37 ℃ constant temperature shaking table for culturing for about 48 hours, and then detecting the expression of Omp16 by Western Blotting;

s8, selection of endogenous Omp16 deletion strain based on the resulting S2< Omp16> strain (Omp16< Omp16>)

Taking pUC19-A⁺Omp16 plasmid 10. mu. L, with S2 at 100. mu. L<Omp16>The Brucella is transferred to an electric shock cup after being mixed evenly, the Brucella is placed on ice for 10min, the electric shock cup is placed in an electric rotating instrument, the voltage is set to be 1.8KV, the electric shock time is 6ms, after electric shock, TSB culture solution which is preheated to 37 ℃ is added immediately, shaking culture is carried out on a shaking table at 37 ℃ for 24h, the bacterial solution is centrifuged, supernatant is discarded, precipitate is resuspended by 200 mu L TSB, the precipitate is coated on a TSA plate with gentamycin resistance, culture is carried out for 72h at 37 ℃, single clone with good growth condition on the plate is selected to be inoculated on TSB liquid culture medium with ampicillin and tetracycline resistance, shaking culture is carried out for 48h at 37 ℃, and then Western Blotting is carried out to detect the expression of Omp 16.

Further, the ligated product was transformed into E.coli competent cell DH5a by the following steps:

(1) taking out Escherichia coli competent cell DH5a from-80 deg.C refrigerator, and placing on ice until it is completely melted, wherein the process is about 5 min;

(2) adding 20 mu L thawed escherichia coli competent cell DH5a into a 1.5m L centrifuge tube, adding all the ligation products, and fully mixing, wherein the 1.5m L centrifuge tube needs to be precooled in advance and does not leave ice when being operated;

(3) after mixing uniformly, placing a centrifugal tube of 1.5m L on ice for 30min, thermally shocking the centrifugal tube in a constant-temperature water bath kettle at 42 ℃ for 1min, and then placing the centrifugal tube on the ice for 2min again;

(4) taking out the centrifuge tube from ice, adding 500 mu L of nonreactive L B culture solution into an ultra-clean workbench, setting the temperature of a shaking table to be 37 ℃, setting the rotating speed to be 180r/min, and recovering for 1 h;

(5) during resuscitation G⁺L A plates were pre-heated in a 37 deg.C incubator for half an hour, 100. mu. L of the resuscitated product was removed by a 100. mu. L gun, and applied to a place G by a spreader⁺L A plates were spread evenly.

The Brucella S2 vaccine strain Omp16 gene deletion strain can be used for preparing Brucella attenuated vaccines.

The invention provides a Brucella S2 vaccine strain Omp16 gene deletion strain, lays a foundation for researching pathogenic mechanism of the Brucella Omp16 and distinguishing natural infection and artificial immunity characteristics, and has important significance for preventing and controlling brucellosis.

Drawings

FIG. 1 is a schematic diagram of the construction of a condition-induced vector PBB-PZT1-Omp 16;

FIG. 2 tetracycline induces the expression of exogenous Flag-Omp16 in Brucella.

In the figure: a: detecting the expression of Flag-Omp16 by using western blot; b qRT-PCR detects the expression of Flag-Omp 16; c: IF detects the expression of Flag-Omp 16.

FIG. 3 identification of endogenous Omp16 deletion strains;

in the figure: a: omp16 deletion strain construction scheme; b: suicide vector pUG19-A⁺-Omp16 construction scheme; c: PGR selection of endogenous Omp 16-deleted strains.

FIG. 4 is tetracycline-induced expression of Omp16 in S2< Omp16> and Omp16< Omp16> strains;

in the figure: a, detecting the expression of Omp16 by Western Blot; b qRT-PCR examined expression of Omp 16.

FIG. 5 is a bacterial growth curve.

FIG. 6 shows in vitro stress survival of bacteria.

FIG. 7 bacterial morphology changes.

FIG. 8 intracellular proliferation in RAW 264.7.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention. All falling within the scope of the present invention.

The embodiment of the invention provides a Brucella S2 vaccine strain Omp16 gene deletion strain, which is a Brucella S2 vaccine strain with Omp16 gene knockout, and is constructed by the following steps:

s1 primer design

The method comprises the following steps of designing an Omp16 gene amplification primer, an Omp16 upstream and downstream amplification primer, a skeleton vector amplification primer, a tetracycline-induced promoter amplification primer, an ampicillin resistance gene, and screening and deleting an Omp16 gene identification primer and a quantitative primer by using Primier Primier 5, wherein the sequences of the primers are as follows:

pBBR1MCS5 backbone vector amplification primers:

F1(5’-TTGACATAAGCCTGTTCGGTTCGTA-3’)

R1(5’-CCTCCCAGAGCCTGATAAAAACG-3’)

tetracycline-induced promoter amplification primers:

F2(5’-GCTCTGGGAGGCTGCAGCGGCCGTTTCCATTTAGGTGGGTAC-3’)

R2

(5’-CTTATGTCAACTCGAGTTTTAAGCTTGCATGCGGATCCCCGGGTACCGAGCTCTTTCTCCTCTTTAATGAATTC-3’)

brucella Omp16 gene amplification primers:

F3(5’-GGTACCATGCGCCGTATCCAGTCGATTGCAC-3’)

R3(5’-

AAGCTTTTACTTATCGTCGTCATCCTTGTAATCCCGTCCGGCCCCGTTGAGAA-3’)

omp16 upstream homology arm

F4(5’-CTGCAGTTCGCAGATTGTCTTCACATC-3’)

R4(5’-TCTAGATCATATTGAGGTTAAAACAGGCT-3’)

Omp16 downstream homology arm

F5(5’-GGTACCATGCGCCGTATCCAGTCGATTG-3’)

R5(5’-GAATTCTACCCGATAGCCGACCGACCCT-3’)

Ampicillin resistance gene identification primer:

F6(5’-TCTAGACGCGGAACCCCTATTTGTTTATTTT-3’)

R6(5’-GTCACCTTACCAATGCTTAATCAGTGAGGC-3’)

mutant identification primer:

F7(5’-TGCTGCAACTTGAAACCGG-3’)

R7(5’-CTGGGTTTTTTGCAACTGGTT-3’)

omp16qRT-PCR primers:

F8(5’-TCGATCTCGATTCGTCGCTG-3’)

R8(5’-CAAGGGCGAGGTTGTACTCA-3’)

s2 PCR amplification and gel recovery of target gene

Using brucella S2 vaccine strain genome, PBBR1MCS5 skeleton vector and pG-KJE8 vector as templates, respectively carrying out PCR reaction by using corresponding primers, amplifying Omp16 gene, skeleton vector and tetracycline-induced promoter:

the reaction system comprises 5 × PS Buffer5 μ L, dNTP mix 2 μ L, F0.5 μ L, R0.5 μ L, template 1 μ L, Prime star DNA polymerase 0.5 μ L, ddH₂O 15.5μL；

The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 50 s; extension at 72 ℃ for 1min for 30 cycles; extension at 72 ℃ for 10 min.

Subjecting the PCR product to 1% agarose gel electrophoresis, cutting target size bands, bands of 543bp Omp16 gene, 3563bp skeleton vector and 1082bp tetracycline induction promoter under a gel cutting instrument, and recovering the PCR product by using a DNA purification recovery kit produced by Tiangen Biotechnology corporation;

s3 recombinant vector pZT-G⁺Vector construction

Connecting the recovered skeleton vector and tetracycline-induced promoter in a PGR instrument at 37 deg.C for 30 min; the linking system is as follows:

the ligated product was transformed into E.coli competent cells DH5a, specifically:

(1) coli competent cells DH5a were removed from the freezer at-80 ℃ and placed on ice until they were completely thawed, approximately 5 min.

(2) Add 20. mu. L of thawed E.coli competent cells DH5a to the 1.5m L tube and add all ligation product, mix well, take care that the 1.5m L tube is pre-cooled and does not leave the ice surface during the procedure.

(3) After mixing, the centrifuge tube of 1.5m L was placed on ice for 30min, heat-shocked in a water bath at a constant temperature of 42 ℃ for 1min, and then placed on ice for 2min again.

(4) Taking out the centrifuge tube from ice, adding 500 mu L of nonreactive L B culture solution into an ultra-clean workbench, setting the temperature of a shaking table at 37 ℃ and the rotating speed at 180r/min, and recovering for 1 h.

(5) During resuscitation G⁺L A plates were pre-heated in a 37 deg.C incubator for half an hour, 100. mu. L of the resuscitated product was removed by a 100. mu. L gun, and applied to a place G by a spreader⁺L A plates were spread evenly.

After the transformation is finished, the solid plate is placed in a constant temperature incubator at 37 ℃ for 12 hours, then the solid plate is taken out, a lance head is used for picking out bacterial colonies with good growth conditions, the lance head is beaten into a 50m L centrifugal tube added with 20m L L B liquid culture medium and is placed in a constant temperature shaking table at 37 ℃ for culturing for 12 hours, and then plasmid miniprep and miniprep kit produced by Tiangen Biotechnology company is used for extracting pZT-G⁺A recombinant vector;

extracting recombinant vector PZT-G⁺Performing double enzyme digestion by using Hind III and BamH I, and recovering the enzyme digestion product by using a DNA purification recovery kit produced by Tiangen Biotechnology company;

obtaining of cohesive Ends of S4 and Omp16 genes

The Omp16 gene recovered from the gel is connected with a 19T (simple) vector, and the connection system is as follows:

target gene 1 mu L, 19T vector 4 mu L, Solution 15 mu L;

the reaction conditions are as follows: connecting for 2h at 16 ℃;

the ligation product was transformed into E.coli competent cell DH5a (same as the above transformation procedure), and after 1 hour of recovery, 100. mu. L of E.coli competent cell DH5a was pipetted into G preheated at 37 ℃ in a super clean bench⁺L A plate, coating evenly, culturing for 12 hours at 37 ℃, selecting single colony with good growth state by a white gun head, beating the single colony into a 50m L sterilizing centrifuge tube filled with 20m L L B liquid culture medium, culturing for 12 hours by shaking, and extracting recombinant vector by using a plasmid small-extract medium-volume reagent kit produced by Tiangen Biochemical technology company according to the specification requirement;

the recombinant vector is subjected to double digestion by 19T (simple) -Omp16, Hind III and BamH I, and is identified by 1% agarose gel electrophoresis, and the Omp16 gene is recovered by gel;

s5 conditional induction carrier PZT-G⁺Construction of Omp16

The PZT-G after double enzyme digestion⁺The recombinant vector and the Omp16 gene are connected under the following reaction conditions and reaction systems;

reaction system:

PZT-G⁺recombinant vector 1 μ L;

omp16 gene 4 μ L;

Solution 15μL；

reaction conditions are as follows: connecting for 4h at 16 ℃;

the ligation product was transformed into E.coli competent cell DH5a (same as above transformation procedure), recovered for 1h, 100. mu. L of recovered broth was applied to G preheated to 37 ℃ in a clean bench⁺L A plate, culturing in 37 deg.C incubator for 12h, selecting single clone with good growth state, shake culturing in L B culture medium for 12h, and extracting PZT-G with plasmid small-volume and medium-volume reagent kit produced by Tiangen Biochemical technology company according to specification⁺-Omp16 recombinant vector;

extracting PZT-G⁺Carrying out double enzyme digestion on Hind III and BamH I by the Omp16 recombinant vector, and carrying out electrophoresis identification by using 1% agarose gel;

s6 suicide vector PUC19-A⁺Construction of Omp16

Respectively connecting an Omp16 upstream homology arm (654bp), an Omp16 downstream homology arm (651bp) and an ampicillin resistance gene (973bp) which are recovered from glue with a 19T (simple) carrier, wherein the connection system comprises a target gene 1 mu L, a 19T (simple) vector 4 mu L and a Soluton 15 mu L, and the connection condition is that the connection is carried out for 2h at the temperature of 16 ℃;

transforming the ligation product into escherichia coli competent cell DH5a, and after the transformation and recovery steps, coating 100 mu L bacterial liquid on A⁺L A plate, culturing at 37 deg.C for 12h, selecting single clone with good growth condition on the plate, inoculating to L B liquid culture medium, shake culturing at 37 deg.C for 12h, and culturing with small plasmid produced by Tiangen Biochemical technology corporationExtracting the recombinant vector by the medium-amount extraction kit according to the instruction requirements;

subjecting the extracted recombinant vector to double enzyme digestion, wherein Pst 1 and Xba 1 are used as upstream homology arms of 19T (simple) -Omp16, and Kpn 1 and EcoR 1, 19T (simple) -A are used as downstream homology arms of 19T (simple) -Omp16⁺The double digestion is carried out by using Xba 1 and Kpn 1, and the digestion system is as follows:

19T (simple) -Omp16 upstream homology arm digestion system, Pst l 1.5 mu L, Xba l 1.5 mu L, 10 × MBuffer 5 mu L, plasmid 30 mu L, TB 12 mu L;

19T (simple) -Omp16 downstream homology arm enzyme digestion system, Kpn I1.5 mu L, EcoR I1.5 mu L, 10 × MBuffer 5 mu L, plasmid 30 mu L, TB 12 mu L;

19T(simple)-A⁺an enzyme digestion system with Kpn I1.5 mu L, Xba I1.5 mu L, 10 × M Buffer5 mu L, plasmid 30 mu L and TB 12 mu L;

carrying out electrophoresis identification on the product after enzyme digestion by using 1% agarose gel, and carrying out gel recovery on an Omp16 upstream homology arm gene, an Omp16 downstream homology arm gene and an ampicillin resistance gene;

the PUC19 vector is double-digested by EcoR I and Pst I, and the PUC19 digestion system is as follows:

pst I1.5. mu. L, EcoR I1.5. mu. L, 10 × M Buffer 5. mu. L, plasmid 30. mu. L, TB 12. mu. L;

carrying out electrophoresis identification on the product subjected to enzyme digestion by using 1% agarose gel, and recovering the PUC19 vector subjected to enzyme digestion by using the agarose gel;

the Omp16 upstream homology arm gene, Omp16 downstream homology arm gene, ampicillin resistance gene and PUC19 vector recovered from the gel were ligated as follows:

the ligation product was transformed into E.coli competent cell DH5a, recovered and applied to pre-warmed G⁺L A plate, culturing at 37 deg.C for 12 hr, selecting single clone with good growth state on the plate, inoculating to L B liquid culture medium, shake culturing at 37 deg.C for 12 hr, and culturing with Tiangen Biochemical technology companyExtraction of PUC19-A by plasmid small-extraction medium-amount kit⁺-Omp16 recombinant vector;

extracting PUC19-A⁺Carrying out double enzyme digestion on Pst I and EcoR I by the Omp16 recombinant vector, and identifying the enzyme digestion product by 1% agarose gel electrophoresis;

s7, screening brucella strain with exogenous Omp16 expression induced by tetracycline (S2< Omp16>)

S7.1 preparation of Brucella competence

(1) Coating the activated brucella on a TSA (TSA) plate, placing the TSA plate in a constant-temperature incubator, and culturing for 72 hours at 37 ℃;

(2) taking out the plate from the constant temperature incubator, selecting a single clone with good growth condition on the plate, inoculating the single clone into a 50m L centrifugal tube filled with 10m L, and performing shake culture at 37 ℃ for 24 hours;

(3) the obtained bacterial liquid and TSB culture medium are shake-cultured to OD at 37 ℃ in a 50m L centrifuge tube according to the volume ratio of 1: 100₆₀₀About 0.6;

(4) centrifuging the obtained bacterial liquid in a centrifuge at 4 ℃ at the rotating speed of 5000r/min for 10min, discarding the liquid and leaving the precipitate;

(5) adding precooled sterile water 10m L into the obtained precipitate, resuspending the precipitate, centrifuging in a centrifuge at 4 ℃ at the rotating speed of 5000r/min for 10min, discarding the liquid, and leaving the precipitate;

(6) repeating the step (4) and the step (5) once;

(7) adding 10m of precooled 10% glycerol L, resuspending the precipitate, centrifuging at 4 ℃ in a centrifuge at the rotating speed of 5000r/min for 10min, discarding the liquid, and leaving the precipitate;

(8) repeating the step (7) once;

(9) adding 10% glycerol 1m L pre-cooled in a refrigerator at 4 deg.C for 1h, re-suspending the precipitate, subpackaging in centrifuge tubes of 1.5m L, each tube having a diameter of 100 μ L, and storing in a refrigerator at-80 deg.C for use;

s7.2, electrotransformation

Taking 10 mu of PZT-G of L⁺Adding Omp16 plasmid into Brucella competence of 100 mu L, mixing uniformly, adding into electric shock cup, and paying attention to the fact that the electric shock cup is put in advancePrecooling for 1h in a refrigerator at 4 ℃, placing an electric shock cup on ice for 10min, transferring the electric shock cup into an electric rotating instrument, setting the voltage to be 1.8KV, setting the electric shock time to be 6ms, immediately adding the electric shock cup into TSB culture solution preheated at 37 ℃, transferring the electric shock cup into a centrifugal tube with the thickness of 1.5m L, putting the centrifugal tube into a shaking table at 37 ℃, setting the rotating speed to be 180rpm/min, shaking and culturing for 24h, centrifuging, removing supernatant, re-suspending the precipitate by using 200 mu L TSB, coating the precipitate on a TSA flat plate with gentamicin resistance, and culturing for 72h at 37 ℃;

s7.3 screening of S2< Omp16> Strain

Taking out the TSA solid plate from a 37 ℃ constant temperature incubator, picking out a bacterial colony with good growth condition by using a tip, inoculating the bacterial colony into a 10m L centrifuge tube, adding 5m L TSB gentamicin and tetracycline resistant liquid culture medium, placing the bacterial colony in a 37 ℃ constant temperature shaking table for culturing for about 48h, and detecting the expression of Omp16 by Western Blotting.

Bacterial extracellular growth curve detection

B.suis S2, S2< Omp16> and Omp16< Omp16> monoclonals with good growth states are respectively selected from corresponding plates, inoculated in a TSB liquid culture medium, shake-cultured in a shaker at 37 ℃ until OD600 is approximately equal to 1.0, and then inoculated in a fresh TSB liquid culture medium for shake-culture according to the volume ratio of 1: 100, each bacterium is divided into two experimental groups, namely a tetracycline group and a non-tetracycline group, the bacterium liquid is taken every 4h, the bacterium liquid is sampled 500 mu L every time, after inactivation in boiling water for 10min, the absorbance value is measured by an enzyme linked immunosorbent assay detector until 72h, and the result shows that the delta Omp16 strain and the wild type strain have the same in vitro proliferation activity through growth curve detection.

In vitro stress experiment for detecting bacterial survival rate

Diluting the bacterial liquid cultured to OD600 about 1.0 by multiple times, coating the diluted bacterial liquid on a TSA plate, culturing for a certain time at 37 ℃, counting bacterial colonies, selecting the bacterial liquid with proper dilution times, absorbing 1M L, centrifuging and discarding the supernatant, and respectively using 0.5M D (-) -Sorbitol solution and 50 mu g/M L TSB culture solution containing 0.5mM H₂O₂The TSB culture solution (2) of (4), the TSB culture solution of pH5.0 and the TSB culture solution of 42 ℃ were resuspended, and after gradient dilution, they were spread on a TSA plate at 37 ℃And (5) culturing for a certain time, and counting colonies. The experiment was repeated three times with three untreated strains as controls. As a result: the sensitivity of the Δ Omp16 strain to osmotic pressure and polymyxin B was shown to increase by in vitro stress testing.

Scanning electron microscope for observing bacterial morphology

1. Sampling: after the bacteria were cultured to a suspended state, the suspension was centrifuged, and the supernatant was discarded.

2. Rinsing the pellet with 2M L pH6.8 0.1M PBS buffer for 10min each time, and this step was repeated 4 times.

3. Post-fixing: only animal tissue requires post-fixation: immobilization was performed with about 0.7ml of 1% osmic acid at 4 ℃ for 1-2 hours.

4. And (3) dehydrating: sequentially dehydrating with 10%, 30%, 50%, 70%, 80%, 90% ethanol solution for 15-20min each time; and finally dehydrating with 100% ethanol for 30min for 3 times.

5. Intermediate substitution: the sample can be stored in acetone for a long time at 4 ℃ after being replaced by acetone once for 10-20 min.

6.CO₂And (5) drying.

7. Adhering the table: after the sample is dried, the front and back sides are distinguished and the sample is stuck on a conductive adhesive

8. Spraying gold and observing the sample.

As a result: by scanning electron microscopy, Omp16< Omp16> strain showed vacuoles in the outer bacterial membrane, compared to the wild-type strain, but was able to recover to a level similar to the wild-type after tetracycline addition.

Changes in proliferation within RAW 264.7 macrophages

Pressing RAW 264.7 macrophage to 2 × 10⁵Inoculating cells/well into 24-well plate, culturing in cell culture box for 12h, B, suis, S2 strain and delta Omp16 strain at a multiplicity of infection (MOI) of 100: 1, adding into 24-well plate paved with RAW 264.7 macrophage, culturing in cell culture box for 4h, discarding culture solution, washing with PBS for 3 times, adding culture solution containing 50 μ g/m L ampicillin, culturing for 1h, discarding culture solution, washing with PBS for 3 times, adding 25 μ g/m L ampicillinA culture solution of elements. At this time, samples were collected at 0 hour, 6 hours, 12 hours, 24 hours, and 48 hours, respectively, and the cells were lysed with PBS containing 0.5% Triton X-100, and then placed in a constant temperature incubator for 10 min. The lysed cells were diluted in multiple ratios, plated on TSA plates, and colony counts were performed. Note that three replicates were set up for each time point and the experiment was repeated three times.

As a result: during infection of RAW 264.7 by Omp16< Omp16> strain, intracellular proliferation of Omp16< Omp16> strain was significantly reduced at 24 and 48h post infection, but was able to recover to levels similar to wild type after tetracycline addition.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention. The embodiments and features of the embodiments of the present application may be combined with each other arbitrarily without conflict.

Sequence listing

<110> northwest agriculture and forestry science and technology university

<120> Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain, construction method and application thereof

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213> Artificial sequence ()

<400>1

<210>2

<211>23

<212>DNA

<213> Artificial sequence ()

<400>2

<210>3

<211>42

<212>DNA

<213> Artificial sequence ()

<400>3

<210>4

<211>74

<212>DNA

<213> Artificial sequence ()

<400>4

<210>5

<211>31

<212>DNA

<213> Artificial sequence ()

<400>5

<210>6

<211>53

<212>DNA

<213> Artificial sequence ()

<400>6

<210>7

<211>27

<212>DNA

<213> Artificial sequence ()

<400>7

<210>8

<211>29

<212>DNA

<213> Artificial sequence ()

<400>8

<210>9

<211>28

<212>DNA

<213> Artificial sequence ()

<400>9

<210>10

<211>28

<212>DNA

<213> Artificial sequence ()

<400>10

<210>11

<211>31

<212>DNA

<213> Artificial sequence ()

<400>11

<210>12

<211>30

<212>DNA

<213> Artificial sequence ()

<400>12

<210>13

<211>19

<212>DNA

<213> Artificial sequence ()

<400>13

<210>14

<211>21

<212>DNA

<213> Artificial sequence ()

<400>14

<210>15

<211>20

<212>DNA

<213> Artificial sequence ()

<400>15

<210>16

<211>20

<212>DNA

<213> Artificial sequence ()

<400>16

Claims (4)

1. A Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain is characterized in that: the strain is Brucella strain S2 Omp16 delta Omp16, is preserved in China center for type culture Collection in 2019, 12 months and 2 days, and has the preservation number of CCTCC NO: and M2019991.

2. The method for constructing the Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain as claimed in claim 1, which is characterized in that: the method comprises the following steps:

s1 primer design

The method comprises the following steps of designing an Omp16 gene amplification primer, an Omp16 gene upstream and downstream amplification primer, a skeleton vector amplification primer, a tetracycline-induced promoter amplification primer, an ampicillin resistance gene amplification primer, a screening deletion Omp16 gene identification primer and a quantitative primer by using Primier Primier 5, wherein the sequences of the primers are as follows:

pBBR1MCS5 backbone vector amplification primers:

F1(5’-TTGACATAAGCCTGTTCGGTTCGTA-3’)

R1(5’-CCTCCCAGAGCCTGATAAAAACG-3’)

tetracycline-induced promoter amplification primers:

F2(5’-GCTCTGGGAGGCTGCAGCGGCCGTTTCCATTTAGGTGGGTAC-3’)

R2(5’-CTTATGTCAACTCGAGTTTTAAGCTTGCATGCGGATCCCCGGGTACCGAGCTCTTTCTCCTCTTTAATGAATTC-3’)

brucella Omp16 gene amplification primers:

F3(5’-GGTACCATGCGCCGTATCCAGTCGATTGCAC-3’)

R3(5’-AAGCTTTTACTTATCGTCGTCATCCTTGTAATCCCGTCCGGCCCCGTTGAGAA-3’)

omp16 upstream homology arm

F4(5’-CTGCAGTTCGCAGATTGTCTTCACATC-3’)

R4(5’-TCTAGATCATATTGAGGTTAAAACAGGCT-3’)

Omp16 downstream homology arm

F5(5’-GGTACCATGCGCCGTATCCAGTCGATTG-3’)

R5(5’-GAATTCTACCCGATAGCCGACCGACCCT-3’)

Ampicillin resistance gene identification primer:

F6(5’-TCTAGACGCGGAACCCCTATTTGTTTATTTT-3’)

R6(5’-GGTACCTTACCAATGCTTAATCAGTGAGGC-3’)

mutant identification primer:

F7(5’-TGCTGCAACTTGAAACCGG-3’)

R7(5’-CTGGGTTTTTTGCAACTGGTT-3’)

omp16qRT-PCR primers:

F8(5’-TCGATCTCGATTCGTCGCTG-3’)

R8(5’-CAAGGGCGAGGTTGTACTCA-3’)

s2 PCR amplification and gel recovery of target gene

Respectively taking brucella S2 vaccine strain genome, PBBR1MCS5 skeleton vector and pG-KJE8 vector as templates, carrying out PCR reaction by using corresponding primers, and amplifying Omp16 gene, skeleton vector and tetracycline-induced promoter:

the reaction system comprises 5 × PS Buffer5 μ L, dNTP mix 2 μ L, F0.5 μ L, R0.5 μ L, template 1 μ L, Prime star DNA polymerase 0.5 μ L, ddH₂O 15.5μL；

The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 50 s; extension at 72 ℃ for 1min for 30 cycles; extending for 10min at 72 ℃;

subjecting the PCR product to 1% agarose gel electrophoresis, cutting target band gel blocks of 543bp Omp16 gene, 3563bp skeleton vector and 1082bp tetracycline-induced promoter under a gel cutting instrument, and recovering the PCR product by using a DNA purification recovery kit produced by Tiangen Biotechnology corporation;

s3 recombinant vector PZT-G⁺Vector construction

Connecting the recovered skeleton vector and tetracycline-induced promoter in a PCR instrument at 37 ℃ for 30 min; the linking system is as follows:

3 mu L of a skeleton carrier;

tetracycline-inducible promoter 4. mu. L;

5×CE II Buffer 2μL；

II 1μL；

transforming the connected product into escherichia coli competent cell DH5 α, uniformly coating L A solid plate in a superclean bench, placing the solid plate in a 37 ℃ constant temperature incubator for 12h, taking out the solid plate, picking out a colony with good growth condition by using a gun head, beating the gun head into a 50m L centrifuge tube added with 20m L L B liquid culture medium, placing the centrifuge tube in a 37 ℃ constant temperature shaking table for 12h, and extracting pZT-G by using a plasmid small-extract medium-dose kit produced by Tiangen Biochemical technology company⁺A recombinant vector;

extracting recombinant vector PZT-G⁺With Hind IICarrying out double enzyme digestion on the I and the BamH I, and recovering an enzyme digestion product by using a DNA purification recovery kit produced by Tiangen Biochemical technology company;

obtaining of cohesive Ends of S4 and Omp16 genes

The Omp16 gene recovered from the gel is connected with a 19T (simple) vector, and the connection system is as follows:

target gene 1 mu L, 19T vector 4 mu L, Solution 15 mu L;

the reaction conditions are as follows: connecting for 2h at 16 ℃;

the ligation product was transformed into E.coli competent cell DH5 α, and after resuscitating in a 37 ℃ constant temperature shaker for 1 hour, 100. mu. L of E.coli competent cell DH5 α was pipetted into G preheated to 37 ℃ in a super clean bench⁺L A plate, coating evenly, culturing for 12 hours at 37 ℃, selecting single colony with good growth state by a white gun head, beating the single colony into a 50m L sterilized centrifuge tube filled with 20m L L B liquid culture medium, placing the sterilized centrifuge tube in a constant temperature shaking table at 37 ℃, and performing shake culture for 12 hours, and extracting recombinant vector by using a plasmid miniprep medium kit produced by Tiangen Biochemical technology company according to the specification requirement;

the recombinant vector is subjected to double digestion by 19T (simple) -Omp16, Hind III and BamH I, and is identified by 1% agarose gel electrophoresis, and the Omp16 gene is recovered by gel;

s5, conditional Induction vector pZT-G⁺Construction of Omp16

The double enzyme digested pZT-G is subjected to⁺The recombinant vector and the Omp16 gene are connected under the following reaction conditions and reaction systems;

reaction system:

pZT-G⁺recombinant vector 1 μ L;

omp16 gene 4 μ L;

Solution 15μL；

reaction conditions are as follows: connecting for 4h at 16 ℃;

transforming the ligation product into Escherichia coli competent cell DH5 α, resuscitating for 1h, taking resuscitated bacterial liquid of 100 mu L, coating G preheated to 37 ℃ in a super clean bench⁺L A plate, culturing in 37 deg.C incubator for 12h, picking single clone with good growth state, and shake culturing in L B mediumAfter 12h, using a plasmid small-extraction medium-amount kit produced by Tiangen Biochemical technology company to extract PZT-G according to the requirements of the specification⁺-Omp16 recombinant vector;

extracting PZT-G⁺Carrying out double enzyme digestion on Hind III and BamH I by the Omp16 recombinant vector, and carrying out electrophoresis identification by using 1% agarose gel;

s6 suicide vector PUC19-A⁺Construction of Omp16

Respectively connecting an Omp16 upstream homology arm (654bp), an Omp16 downstream homology arm (651bp) and an ampicillin resistance gene (973bp) which are recovered from glue with a 19T (simple) carrier, wherein the connection system comprises a target gene 1 mu L, a 19T (simple) vector 4 mu L and a Soluton 15 mu L, and the connection condition is that the connection is carried out for 2h at the temperature of 16 ℃;

transforming the ligation product into Escherichia coli competent cell DH5 α, and after transformation and recovery, spreading 100 mu L bacterial liquid on A⁺L A plate, culturing for 12h at 37 ℃, selecting single clone with good growth condition on the plate, inoculating the single clone in L B liquid culture medium, performing shake culture for 12h at 37 ℃, and extracting recombinant vector by using a plasmid small-extraction medium-amount kit produced by Tiangen Biochemical technology company according to the instruction requirements;

subjecting the extracted recombinant vector to double enzyme digestion, wherein Pst 1 is used as an upstream homology arm of 19T (simple) -Omp16, and Kpn 1 and EcoR 1, 19T (simple) -Omp16 is used as a downstream homology arm of 19T (simple) -Omp16, and Kpn 1 and EcoR 1, 19T (simple) -G are used as downstream homology arms of 19T (simple) -Omp16⁺The double digestion is carried out by using Xba 1 and Kpn 1, and the digestion system is as follows:

19T (simple) -Omp16 upstream homology arm digestion system, Pst I1.5 mu L, Xba I1.5 mu L, 10 × M Buffer5 mu L, plasmid 30 mu L, TB 12 mu L;

19T (simple) -Omp16 downstream homology arm digestion system, Kpn I1.5 mu L, EcoR I1.5 mu L, 10 × M Buffer5 mu L, plasmid 30 mu L, TB 12 mu L;

19T(simple)-A⁺an enzyme digestion system with Kpn I1.5 mu L, Xba I1.5 mu L, 10 × M Buffer5 mu L, plasmid 30 mu L and TB 12 mu L;

carrying out electrophoresis identification on the product after enzyme digestion by using 1% agarose gel, and carrying out gel recovery on an Omp16 upstream homology arm gene, an Omp16 downstream homology arm gene and an ampicillin resistance gene;

the pUC19 vector was double digested with EcoR I and Pst I, and the pUC19 digestion system was as follows:

pst I1.5. mu. L, EcoR I1.5. mu. L, 10 × M Buffer 5. mu. L, plasmid 30. mu. L, TB 12. mu. L;

carrying out electrophoresis identification on the product subjected to enzyme digestion by using 1% agarose gel, and recovering the PUC19 vector subjected to enzyme digestion by using the agarose gel;

the Omp16 upstream homology arm gene, Omp16 downstream homology arm gene, ampicillin resistance gene and PUC19 vector recovered from the gel were ligated as follows:

omp16 upstream homology arm 3 μ L;

omp16 downstream homology arm 3 μ L;

ampicillin resistance gene 3 μ L;

PUC19 1μL；

Solution 1 10μL；

the connection condition is 16 ℃ for 4 h;

the ligation product was transformed into E.coli competent cell DH5 α, recovered and applied to preheated A⁺L A plate, culturing at 37 deg.C for 12 hr, selecting single clone with good growth state on the plate, inoculating to L B liquid culture medium, shake culturing at 37 deg.C for 12 hr, and extracting PUC19-A with plasmid small-extract medium-amount kit produced by Tiangen Biochemical technology corporation⁺-Omp16 recombinant vector;

extracting PUC19-A⁺Carrying out double enzyme digestion on Pst I and EcoR I by the Omp16 recombinant vector, and identifying the enzyme digestion product by 1% agarose gel electrophoresis;

s7, screening brucella strain with exogenous Omp16 expression induced by tetracycline (S2< Omp16>)

S7.1 preparation of Brucella competence

(1) Coating the activated brucella on a TSA (TSA) plate, placing the TSA plate in a constant-temperature incubator, and culturing for 72 hours at 37 ℃;

(2) taking out the plate from the constant temperature incubator, selecting a single clone with good growth condition on the plate, inoculating the single clone into a 50m L centrifugal tube filled with 10m L, and performing shake culture at 37 ℃ for 24 hours;

(3) shake culturing the obtained bacterial liquid and TSB culture medium at a volume ratio of 1: 100 in a 50m L centrifugal tube at 37 deg.C until OD600 is 0.6 once;

(4) centrifuging the obtained bacterial liquid in a centrifuge at 4 ℃ at the rotating speed of 5000r/min for 10min, discarding the liquid and leaving the precipitate;

(5) adding precooled sterile water 10m L into the obtained precipitate, resuspending the precipitate, centrifuging in a centrifuge at 4 ℃ at the rotating speed of 5000r/min for 10min, discarding the liquid, and leaving the precipitate;

(6) repeating the step (4) and the step (5) once;

(7) adding 10m of precooled 10% glycerol L, resuspending the precipitate, centrifuging at 4 ℃ in a centrifuge at the rotating speed of 5000r/min for 10min, discarding the liquid, and leaving the precipitate;

(8) repeating the step (7) once;

(9) adding 10% glycerol 1m L pre-cooled at 4 deg.C for 1h, re-suspending the precipitate, packaging in centrifuge tubes 1.5m L with each tube of 100 μ L, and storing in refrigerator at-80 deg.C;

s7.2, electrotransformation

Taking 10 mu of PZT-G of L⁺Adding Omp16 plasmid into Brucella competence of 100 mu L, uniformly mixing, adding into an electric shock cup, paying attention to that the electric shock cup is placed in a refrigerator at 4 ℃ for precooling for 1h in advance, placing the electric shock cup on ice for 10min, then transferring into an electric rotating instrument, setting the voltage to be 1.8KV, setting the electric shock time to be 6ms, immediately adding into TSB culture solution preheated to 37 ℃ after electric shock, transferring into a centrifugal tube of 1.5m L, placing into a shaking table at 37 ℃, setting the rotating speed to be 180rpm/min, performing shake culture for 24h, centrifuging, removing supernatant, coating precipitates with 200 mu L TSB, coating on a TSA plate with gentamycin resistance, and culturing for 72h at 37 ℃;

s7.3 screening of S2< Omp16> Strain

Taking out the TSA solid plate from a 37 ℃ constant temperature incubator, picking out a colony with good growth condition by using a gun head, inoculating the colony in a 10m L centrifuge tube, adding 5m L TSB gentamicin and tetracycline resistant liquid culture medium, and placing the colony in a 37 ℃ constant temperature shaking table for culturing for about 48 hours;

s8, selection of endogenous Omp16 deletion strain based on the resulting S2< Omp16> strain (Omp16< Omp16>)

Taking pUC19-A⁺Omp16 plasmid 10. mu. L, with S2 at 100. mu. L<Omp16>The Brucella is transferred to an electric shock cup after being mixed evenly, the Brucella is placed on ice for 10min, the electric shock cup is placed in an electric rotating instrument, the voltage is set to be 1.8KV, the electric shock time is 6ms, after electric shock, TSB culture solution which is preheated to 37 ℃ is added immediately, shaking culture is carried out on a shaking table at 37 ℃ for 24h, the bacterial solution is centrifuged, supernatant is discarded, precipitate is resuspended by 200 mu L TSB, the precipitate is coated on a TSA plate with gentamycin resistance, culture is carried out for 72h at 37 ℃, single clone with good growth condition on the plate is selected to be inoculated on TSB liquid culture medium with ampicillin and tetracycline resistance, shaking culture is carried out for 48h at 37 ℃, and then Western Blotting is carried out to detect the expression of Omp 16.

3. The method for constructing the Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain as claimed in claim 2, which is characterized in that the ligated product is transformed into Escherichia coli competent cell DH5 α by the following steps:

(1) taking out Escherichia coli competent cell DH5 α from-80 deg.C refrigerator, and placing on ice until it is completely melted, wherein the process is about 5 min;

(2) adding 20 mu L thawed escherichia coli competent cell DH5 α into a 1.5m L centrifuge tube, adding all the ligation products, and mixing uniformly, wherein the 1.5m L centrifuge tube is placed in an ice box for precooling in advance and is not separated from the ice surface during operation;

(3) after mixing uniformly, placing a centrifugal tube of 1.5m L on ice for 30min, thermally shocking the centrifugal tube in a constant-temperature water bath kettle at 42 ℃ for 1min, and then placing the centrifugal tube on the ice for 2min again;

(4) taking out the centrifuge tube from ice, adding 500 mu L of nonreactive L B culture solution into an ultra-clean workbench, setting the temperature of a shaking table to be 37 ℃, setting the rotating speed to be 180r/min, and recovering for 1 h;

(5) during resuscitation G⁺L A plates were pre-heated in a 37 deg.C incubator for half an hour, 100. mu. L of the resuscitated product was removed by a 100. mu. L gun, and applied to a place G by a spreader⁺L A plates were spread evenly.

4. The application of the Brucella S2 vaccine strain Omp16 gene conditional induction deletion strain as claimed in claim 1, which is characterized in that: it can be used for preparing attenuated Brucella vaccine.

Images