CN111393511A - Application of lettuce as host in expressing human papilloma virus protein or preparing human cervical cancer vaccine - Google Patents

Abstract

The invention relates to the technical field of biology, in particular to a method for expressing a Human cervical cancer vaccine (namely Human cervical cancer virus (HPV) protein) by using plants such as lettuce as an effective expression platform for recombinant protein production, and the Human cervical cancer vaccine is expressed by using a simple and effective agrobacterium-mediated vacuum infiltration method.

Description

Application of lettuce as host in expressing human papilloma virus protein or preparing human cervical cancer vaccine

Technical Field

The invention relates to the technical field of biology, in particular to application of lettuce as a host in expressing human papilloma virus protein or preparing human cervical cancer vaccine.

Background

The cervical cancer vaccine is also called HPV vaccine, and is a vaccine for preventing the onset of cervical cancer. The cervical cancer is mainly caused by infection of Human Papilloma Virus (HPV), and the vaccine effectively prevents the onset of the cervical cancer by preventing HPV infection and can prevent the subtype variation of the human papilloma virus covered by the human infection vaccine. It has been found that 99.7% of cervical cancers are caused by HPV infection, and HPV can also cause other relatively rare cancers, such as penile cancer, laryngeal cancer, lung cancer, anal cancer, etc. The major pathways for HPV are sexual or skin-to-skin contact transmission.

Human papillomaviruses are one of the papillomavirus family, abbreviated as HPV. Over 100 different types of HPV are currently known, most of which are considered "low risk" and not associated with cervical cancer. However, 14 HPV types are listed as "high risk" because they have been shown to cause almost all cervical cancers. Among these, the two most risky strains, HPV-16 and HPV-18, cause about 70% of cervical cancer cases. HPV infection is now recognized internationally, both in epidemiological and clinical data, as a prerequisite for the development of cervical cancer. The first german scientist that elucidated HPV as a key factor causing cervical cancer was also awarded the nobel medical physiology prize in 2008. Based on their research, scientists developed HPV prophylactic vaccines to prevent the development of cervical cancer.

Three HPV vaccines currently on the market globally default to Gardasil (both tetravalent and nine valent) from sardong and Cervarix from glactin smith, respectively. Both of these vaccines have been marketed in more than 100 countries and regions, with tens of millions of cases being used globally. In 2006, the first HPV tetravalent vaccine "jiadaxie" (Gardasil) worldwide was developed by the msandong company, which could be used to prevent a variety of diseases caused by four HPV viral subtypes, 6, 11, 16, 18, and was marketed in the united states by priority approval.

Subsequently, the Puerarin Schker company also produced the bivalent vaccine "Huayankang" (Cervarix) (i.e., Shirui's in China), which can prevent both 16 and 18 HPV viruses, and the cervical cancer caused by both viruses accounted for 70% of the total. In 2014, the default Saudidong introduced a new generation of Jiadadakui 9-valent (also called Gawei vaccine 9), five HPV virus subtypes of 31, 33, 45, 52 and 58 are newly added on the basis of the original four valences in the contained HPV types, and the prevention rate of the HPV types on cervical cancer can reach 90 percent, namely the so-called nine-valent vaccine. By 6 months of 2016, the jiadaxiu has been approved for marketing in 130 countries and regions.

Plants have been studied for nearly thirty years as a system for the expression and production of pharmaceutical proteins. In addition to the advantages of low cost and high yield, plant-based expression systems reduce the risk of transmission of human and animal pathogens to humans from the process of protein production. In addition, plant eukaryotic protein inner membrane expression systems and secretory pathways are similar to those of mammalian cells. The plant expression system can produce large amount of high molecular weight and subunit medicine protein and is superior to prokaryotic expression system, such as colibacillus expression system. Proteins that are glycosylated, and other pharmaceutical proteins that require assembly, which cannot be achieved with prokaryotic systems, if post-translational modification is desired. Pharmaceutical proteins produced using plants have been commercialized as biological agents. Elelyso approved in 2012 was the first drug to market in the us and was the only one transgenic plant produced to date. The main component is glucocerebrosidase used for treating gaucher type 1 disease, and the protein is produced from carrot. Over the past decade, the demand for pharmaceutical proteins has increased dramatically, so the number of plant pharmaceutical proteins approved by the FDA for clinical trials has increased.

The plant transient expression system can produce recombinant proteins in large quantities for clinical studies or to cope with paroxysmal diseases. In 2014, the only antibody therapeutic drug used to effectively resist ebola virus outbreaks, ZMappTM, was produced in tobacco leaves by the agrobacterium infiltration method. The efficacy and safety of ZMapp opens the way for the industry to advance the plant pharmaceutical industry. Currently, tobacco is the most popular and mature host plant for transient expression of proteins, and various vectors and agroinfiltration methods have been developed for large-scale production in a short time. However, tobacco has a high fiber content and potentially toxic compounds, such as the alkaloid nicotine, significantly increasing the cost of downstream purification processes, greatly impeding the further development of plant foreign protein pharmaceuticals. Compared with a tobacco leaf system, the lettuce contains less phenols and toxic compounds, so that the lettuce has important practical significance in expressing human HPV vaccine as a host.

Disclosure of Invention

In view of the above, the present invention provides the use of lettuce as a host for the expression of human HPV vaccines. The invention utilizes lettuce as an effective platform for recombinant protein production, eliminates the growth cycle of plants and greatly saves the time for cultivating plants in the early stage. The invention uses lettuce system to express human HPV vaccine protein, and successfully separates active foreign protein under mild condition, which proves that lettuce expression platform can be used to produce recombinant human HPV vaccine active protein.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an application of a plant as a host in expressing human papilloma virus protein; the plant is selected from lettuce, spinach, tomato, radish, Chinese cabbage, corn, soybean, wheat or tobacco; the organ of the plant is selected from seeds, leaves, rhizomes or the whole plant;

the human papillomavirus protein comprises one or more of HPV 16L 1, HPV 17L 2, HPV 1L 1, HPV 4L 2 or HPV 18L 1.

The invention also provides the application of the plant as a host in the preparation of the vaccine for human cervical cancer; the plant is selected from lettuce, spinach, tomato, radish, Chinese cabbage, corn, soybean, wheat or tobacco; the organ of the plant is selected from seeds, leaves, rhizomes or the whole plant;

the human cervical cancer vaccine comprises human papilloma virus proteins, wherein the human papilloma virus proteins comprise one or more of HPV 16L 1, HPV 17L 2, HPV 1L 1, HPV 4L 2 or HPV 18L 1.

On the basis of the research, the invention also provides an expression vector, which comprises a nucleotide sequence of the human papilloma virus protein and a binary plant expression vector;

the human papillomavirus protein comprises one or more of HPV 16L 1, HPV 17L 2, HPV 1L 1, HPV 4L 2 or HPV 18L 1.

In some embodiments of the invention, the human papillomavirus protein is HPV 16L 1, the cDNA sequence of which is shown in SEQ ID No.3, and the amino acid sequence of which is shown in SEQ ID No. 2.

In some embodiments of the invention, the human papillomavirus protein is HPV 17L 2, the cDNA sequence of which is shown in SEQ ID No.6, and the amino acid sequence of which is shown in SEQ ID No. 5.

In some embodiments of the invention, the human papillomavirus protein is HPV 1L 1, the cDNA sequence of which is shown in SEQ ID No.9, and the amino acid sequence of which is shown in SEQ ID No. 8.

In some embodiments of the invention, the human papillomavirus protein is HPV 4L 2, the cDNA sequence of which is shown in SEQ ID No.12 and the amino acid sequence of which is shown in SEQ ID No. 11.

In some embodiments of the invention, the human papillomavirus protein is HPV 18L 1, the cDNA sequence of which is shown in SEQ ID No.15, and the amino acid sequence of which is shown in SEQ ID No. 14.

In some embodiments of the present invention, the method of construction comprises the steps of:

step 1: adding an Xbal restriction site at the 5 'end and a Sacl restriction site at the 3' end of a nucleotide sequence of Human Papilloma Virus (HPV);

step 2: cloning the nucleotide sequence of the modified human papilloma virus obtained in the step 1 into a vector pUC57 to obtain a cloning vector pUC-HPVs;

and step 3: obtaining gene fragments HPV from the cloning vector pUC-HPVs obtained in the step 2 through Xbal/Sacl respectively, cloning to a binary plant vector pCam35S, and obtaining an expression vector p 35S-HPVs.

Specifically, the construction method of the expression vector provided by the invention comprises the step of optimizing codons of human papilloma disease (HPV 16L 1(HPV 16L 1 variant 114K; EU118173), HPV 17L 2(X74469), HPV 1L 1 (NC-001356) and HPV 4L 2 (NC-001457), HPV 18L 1(AY262282) GenBank entries) into plant-preferred codons, wherein the plant-preferred codons are selected from GeneArt^TMGeneOptimizer^TM(ThermoFisher) was designed and synthesized by Kinsley. XbaI restriction sites were added at the 5 'end of the optimized HPV sequence and at the 3' endHuman Papillomavirus (HPV) gene fragments were isolated from pUC57-HPVs by Xbal/Sacl and cloned into the binary plant expression vector pCam35S, yielding the transient expression vector p35S-HPVs, respectively the plant expression constructs were transformed into Agrobacterium tumefaciens EHA105 by electroporation with a Multiporator (Eppendorf, Hamburg, Germany), the resulting strains were spread evenly over selective YEPs (yeast extract broth, 5 g/L sucrose, 5 g/L tryptone, 6 g/L yeast extract, 0.24 g/L MgSO 105) containing kanamycin antibiotic (50 mg/L), respectively₄15 g/L agar, pH7.2) plates after incubation for 48 hours at 28 ℃ in the dark, single colonies were picked and inoculated into 200m L YEB (not containing agar) supplemented with antibiotic liquid medium (50 mg/L kanamycin). the inoculated culture was incubated at 25-28 ℃ in a shaker (220rpm) for more than 48 hours until the OD600 value reached 1.5. the culture was then collected, centrifuged (5000rpm) for 10 min. Agrobacterium cells were resuspended in osmotic medium (10mM MES, 10mM MgSO 10. sup. mg/ml MgSO 10. sup. th. medium₄) Medium to OD600 was 0.2.

The cloning of the HPV gene fragment (FIG. 1) and the construction of two binary plant-based expression vectors, p35S-HPVs (FIG. 2).

In the invention, the HPV 16L 1 cDNA sequence (GenBank: EU118173) is shown as SEQ ID No.1, the HPV amino acid sequence is shown as SEQ ID No.2, and the HPV cDNA sequence after codon optimization is shown as SEQ ID No. 3.

In the invention, the HPV 17L 2 cDNA sequence (GenBank: gi |396932) is shown as SEQ ID No.4, the amino acid sequence is shown as SEQ ID No.5, and the codon optimized cDNA sequence is shown as SEQ ID No. 6.

In the invention, the HPV 1L 1 cDNA sequence (GenBank: NC-001356) is shown as SEQ ID No.7, the amino acid sequence is shown as SEQ ID No.8, and the cDNA sequence after codon optimization is shown as SEQ ID No. 9.

In the invention, the HPV 4L 2 cDNA sequence (GenBank: NC-001457) is shown as SEQ ID No.10, the amino acid sequence is shown as SEQ ID No.11, and the cDNA sequence after codon optimization is shown as SEQ ID No. 12.

In the invention, the HPV 18L 1 cDNA sequence (GenBank: AY262282) is shown as SEQ ID No.13, the amino acid sequence is shown as SEQ ID No.14, and the cDNA sequence after codon optimization is shown as SEQ ID No. 15.

The invention also provides application of the expression vector in expressing human papilloma virus proteins.

In addition, the invention also provides application of the expression vector in preparation of a human cervical cancer vaccine. In some embodiments of the invention, the human cervical cancer vaccine comprises HPV.

The invention also provides a method for expressing the human papilloma virus protein by using the plant as a host, which comprises the steps of transforming the expression vector into agrobacterium, penetrating the agrobacterium into plant tissues through agrobacterium-mediated vacuum, extracting and separating protein to obtain the human papilloma virus protein;

the plant is selected from lettuce, spinach, tomato, radish, Chinese cabbage, corn, soybean, wheat or tobacco; the plant organ is selected from the group consisting of seed, leaf, rhizome, or whole plant.

The invention also provides a method for preparing the human cervical cancer vaccine by using the plant as a host, which comprises the steps of transforming the expression vector into agrobacterium, penetrating the agrobacterium into plant tissues in a vacuum manner through mediation of the agrobacterium, extracting and separating protein, and obtaining the human cervical cancer vaccine.

In some embodiments of the invention, the agrobacterium-mediated vacuum infiltration comprises the steps of:

step 1: vacuumizing for 25-45 s;

step 2: keeping the vacuum at-95 kPa for 30-60 s;

and step 3: releasing the pressure such that the permeate permeates the plant tissue;

repeating the steps for 2-3 times, and carrying out light-proof treatment for 4 d.

In some embodiments of the invention, the agrobacterium is agrobacterium tumefaciens EHA 105.

Specifically, Agrobacterium-mediated Vacuum infiltration is performed by placing the prepared Agrobacterium culture suspension in a 2L beaker and in a desiccator, inverting (core up) the lettuce stored in this laboratory and gently spinning it into the bacterial suspension, sealing the desiccator, opening the Vacuum pump (Welch Vacuum, Niles, I L) to evacuate and see the permeate in the leaf tissue, maintaining the pressure for 30-60 s, rapidly opening the system to release the pressure, allowing the permeate to permeate the space within the tissue, gently removing the lettuce tissue from the permeate and sequentially rinsing it three times with distilled water, then transferring it to a plastic film covered container, and keeping the treated sample in the dark for 4 d.

After infiltration, most lettuce tissues were submerged during vacuum infiltration, except for the firm intercostal areas, which all showed a light tan area 4 days after vacuum infiltration. To increase the number of Agrobacterium tumefaciens that are immersed in the leaf tissue, 10% of the lettuce leaves were cut off from the head with scissors so that the lettuce leaf tissue was as infiltrated in the permeate as possible and released. This method reduces leaf tissue necrosis compared to longer vacuum exposure times.

In some embodiments of the invention, the extracting and isolating of proteins is in particular:

a lettuce sample subjected to vacuum infiltration by Agrobacterium is disrupted with a stirrer and homogenized at high speed for 1-2 min in an extraction buffer (100mM KPi, pH 7.8; 5mM EDTA; 10mM β -mercaptoethanol) mixer at a volume ratio of 1:1, the homogenate is adjusted to pH 8.0, filtered with gauze, the filtrate is centrifuged at 10,000g for 15min at 4 ℃ to remove cell debris, the supernatant is collected, mixed with ammonium sulfate (50%), and incubated with shaking on ice for 60min, the resulting supernatant is again separated by a centrifuge (10,000g) at 4 ℃ for 15min, the resulting supernatant is subjected to a second round of ammonium sulfate (70%) precipitation, suspended with shaking on ice for 60min, centrifuged again at 10,000g at 4 ℃ for 15min, then the supernatant is discarded, and the treated sample precipitation protein is dissolved in 5m L buffer (20mM KPi, pH 7.8; 2mM EDTA; 10m β -mercaptoethanol) and stored at 4 ℃.

The purified protein from the Agrobacterium vacuum osmosed lettuce was collected and a sample (5u L) was heat denatured (95 ℃) loading buffer (Biorad, Hercules, Calif., USA) at 12%

Bis-Tris Plus SDS-gel (ThermoF)isherScientific, Waltham, MA, USA) followed by staining with Coomassie brilliant blue G250(Biorad) and photographing of the gel. For Western Blot Western Blot hybridization of recombinant HPV proteins, 10ul of recombinant samples were 12%

Bis-Tris Plus polyacrylamide gel separation and electrophoretic transfer to polyvinylidene fluoride (PVDF) membrane, with anti-HPV antibody (Abcam or HPV 5L 1V L P immune serum anti-L1, or polyclonal antibody anti-L2 serum) immune reaction, respectively, dilution 1: 5000 and horseradish peroxidase (HRP) labeled goat anti-rabbit IgG (Beyotime), respectively, dilution 1:10000, and use EC L Plus (Amersham biosciences) color development, picture taking.

Immunogenicity of recombinant HPV vaccine proteins was detected by enzyme-linked immunosorbent assay (E L ISA). recombinant chimeric proteins HPV 5L 1-17RG1 and HPV 1L 1-4RG1 virus-like protein particles were detected using polyclonal serum generated by immunization with HPV 16L 2 amino acids 11-200 as primary antibodies after rinsing with PBS buffer 1:10,000 was added to goat or goat anti-rabbit secondary antibodies (IgG-HRP, Bio-Rad) and incubated at room temperature for 45 minutes, followed by 2, 2' -azino-bis (3-ethyllbenzhiazoline-6-thiophonic acid) (Roche). Absorbance at 405nm was read using an E L ISA microplate reader (Opsys MR, Dynextechnologies).

Downstream processing of plant-derived recombinant proteins is often difficult and expensive because of the difficulty in lysing the cellulose cell wall and secondary plant metabolites. The invention uses the stirrer to stir and homogenize, thereby greatly saving the homogenization cost and the process. Separation of recombinant HPV proteins by SDS-PAGE we observed a band with an estimated molecular weight of approximately 50kDa in the lanes (figure 3, marks). The Western blot analysis also detected a corresponding band (fig. 4, labeled), whereas no relevant signal was detected in the Negative Control (NC).

The detection of expressed HPV recombinant protein by titrating with HPV L2 specific antibody can show that the absorbance at 405nm decreases linearly with the increase of the dilution multiple of the antibody, while the non-immune serum blank does not have such linear relationship (FIG. 5).

The growth time of tobacco plants for vacuum agroinfiltration is typically 4 to 6 weeks. According to the invention, lettuce is used as an effective platform for recombinant protein production, so that the influence of long growth cycle of plants is eliminated, and the time for cultivating the plants at the early stage is greatly saved. The invention uses lettuce system to express human cervical cancer vaccine, and successfully separates active foreign protein under mild condition, which proves that lettuce expression platform can be used to produce human cervical cancer vaccine.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a human papillomavirus protein cloning vector (constructed and synthesized by Kinsley);

FIG. 2 shows a schematic diagram of HPV gene binary vector construction; cutting HPV fragments from the cloning vector in the figure 1 by using restriction enzyme (XbaI/SacI) double digestion, and connecting the HPV fragments into XbaI/SacI sites of pCam35S to generate plant transient expression vectors p 35S-HPVs;

wherein 35S is the CaMV 35S promoter with Tobacco Mosaic Virus (TMV) 5' UTR; NPT II, the expression of the nptII gene encoding for kanamycin resistance; nos 3', terminator;

FIG. 3 shows Coomassie Brilliant blue staining of recombinant HPV proteins;

FIG. 4 shows Western blot hybridization detection of purified recombinant human HPV proteins;

FIG. 5 shows the result of detecting the immunogen activity of the HPV recombinant protein E L ISA.

Detailed Description

The invention discloses application of lettuce as a host in expressing human papilloma virus protein or preparing human cervical cancer vaccine, and the technical personnel in the field can appropriately improve process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The research of the invention shows that the lettuce system can be an effective expression platform and provides a method for quickly and instantaneously expressing recombinant protein. The vacuum agrobacterium infiltration method is simple and rapid, reduces the leaf necrosis and can improve the yield of recombinant protein. Lettuce can increase protein production by withstanding vacuum pressure and allow for more complete penetration of each leaf. Lettuce is easier to grow and cheaper to produce commercially in large quantities than other transiently expressing plants, such as tobacco and the like. And is more cost effective as no special equipment or liquid nitrogen is required. The invention proves that the method can be used for large-scale production of HPV recombinant protein in a short time.

The lettuce provided by the invention can be used as a host to express human papilloma virus protein or prepare raw materials and reagents used in the application of human cervical cancer vaccine.

The invention is further illustrated by the following examples:

example 1 construction of plant transient expression vectors

In order to provide for efficient expression of foreign proteins in plants, the present invention optimizes human HPV 16L 1(variant 114K; EU118173) codons to plant-preferred codons by GeneArt^TMGeneOptimizer^TMThe human HPV 16L gene fragment was isolated from pUC57-INS by Kpnl/Sacl and cloned into the binary plant vector pCam35S, creating transient expression vectors p35S-HPV 16L, respectively.A plant expression construct was generated by using MultipoThe resulting strains were spread evenly on selective YEP plates containing kanamycin antibiotic (50 mg/L), after 48 hours of incubation in the dark at 28 ℃, single colonies were picked up and inoculated into 200m L YEB (yeast extract broth, 5 g/L sucrose, 5 g/L tryptone, 6 g/L yeast extract, 0.24 g/L MgSO4, pH7.2) and supplemented with antibiotic liquid medium (50 mg/L kanamycin), the inoculated culture was incubated in a shaker (220rpm) at 25-28 ℃ for more than 48 hours, OD600 values were measured by addition of YEB medium and adjusted to 1.5, the culture was then collected, centrifuged (5000rpm) for 10min, Agrobacterium cells MES were resuspended in osmotic medium (10mM, 10mM 4 mM) to O2.2D 600.

Example 2 Agrobacterium-mediated vacuum infiltration

The invention optimizes the method of Vacuum infiltration of Agrobacterium, place the well prepared Agrobacterium culture suspension in a 2L beaker and place in a desiccator, invert (core up) lettuce stored in this laboratory and gently rotate in bacterial suspension, seal the desiccator, open the Vacuum pump (Welch Vacuum, nieles, I L) to evacuate and see the permeate in leaf tissue, maintain the pressure state for 30-60 s, open the system quickly to release the pressure, let the permeate penetrate the space within the tissue, clearly see the permeate spread apparently in lettuce tissue, then gently take out lettuce tissue from permeate and flush three times with distilled water in succession, then transfer to plastic film covered container, keep the treated sample in the dark for 4 d.

After infiltration, most lettuce tissues were submerged during vacuum infiltration, except for the firm intercostal areas, which all showed a light tan area 4 days after vacuum infiltration. To increase the number of Agrobacterium tumefaciens that are immersed in the leaf tissue, 10% of the lettuce leaves were cut off from the head with scissors so that the lettuce leaf tissue was as infiltrated in the permeate as possible and released. This method reduces leaf tissue necrosis compared to longer vacuum exposure times.

Example 3 protein extraction and isolation

Vacuum infiltration of AgrobacteriumThe vegetable sample was stirred with a stirrer and extracted with an extraction buffer (100mM KPi, pH 7.8; 5mM EDTA; 10 m) at a volume ratio of 1:1

-mercaptoethanol) mixer, homogenizing at high speed for 1-2 min, adjusting the homogenate to pH 8.0, filtering with gauze, centrifuging the filtrate at 10,000g for 15min at 4 ℃ to remove cell debris, collecting the supernatant, mixing with ammonium sulfate (50%), and incubating for 60min on ice with shaking, separating again for 15min at 4 ℃ by centrifuge (10,000g), subjecting the resulting supernatant to a second round of ammonium sulfate (70%) precipitation, suspending with shaking on ice for 60min, centrifuging again at 10,000g for 15min at 4 ℃, then discarding the supernatant, dissolving the treated sample precipitate protein in 5m L buffer (20mM kpi, pH 7.8; 2mM EDTA; 10mM β -mercaptoethanol) and storing at 4 ℃.

Example 4 SDS-PAGE gel electrophoresis and Western Blot hybridization

The purified protein from vacuum infiltrated lettuce of Agrobacterium was collected and a sample (5u L) was heat denatured (95 ℃) loading buffer (Biorad, Hercules, Calif., USA) at 4-12%

Bis-Tris Plus SDS-gel (ThermoFisher Scientific, Waltham, MA, USA) was run and photographed after staining with Coomassie Brilliant blue G250 (Biorad). For Western Blot Western Blot hybridization of recombinant HPV proteins, 10ul of recombinant samples were 12%

Bis-Tris Plus polyacrylamide gel separation and electrophoretic transfer to polyvinylidene fluoride (PVDF) membrane, with anti-HPV antibodies (Camvir-1 and anti-16L 2 polyclonal antibody) respectively for immunoreaction, 1:10000 and horseradish peroxidase (HRP) -labeled goat anti-rabbit IgG (Beyotime) respectively for dilution of 1:20000, and use EC L Plus (Amersham biosciences) for visualization, and photograph the display image.

Downstream processing of recombinant proteins of plant origin is often difficult and expensive because of the difficulty of lysis of the cellulose cell wall and secondary plant metabolites. The homogenizer is used for stirring and homogenizing, so that the homogenizing cost and the homogenizing process are greatly saved. Separation of recombinant HPV proteins by SDS-PAGE We observed a band corresponding to the estimated molecular weight in the lane (FIG. 3), and an approximate band corresponding to the molecular weight detected by Western blot analysis (FIG. 4), with no signal detected in the corresponding molecular weight region, and no signal detected in the negative control (FIG. 4 NC).

The comprehensive test results show that the plant system, especially the lettuce system, is a more economic and efficient expression platform. Can express recombinant protein rapidly and transiently, and can produce human HPV vaccine protein in large scale in short time.

Example 5

Experimental group 1: the plant provided by the invention produces human papilloma virus protein;

control group 1: producing human papillomavirus protein by using animal cells;

experimental group 2: producing human papilloma virus protein by using tobacco leaves;

TABLE 1 human papillomavirus proteins

^*Shows that P is less than or equal to 0.05 compared with the control group 1;^**shows that P is less than or equal to 0.01 compared with the control group 1;

^#shows that P is less than or equal to 0.05 compared with the experimental group 2;^##shows that P is less than or equal to 0.01 compared with the experimental group 2;

as can be seen from Table 1, compared with the animal system of the control group 1, the lettuce provided by the invention can express the human papilloma virus protein instantly, so that the production period is shortened remarkably (P is less than or equal to 0.01), the protein content is increased remarkably (P is less than or equal to 0.01), the difficulty of protein purification is simplified, and the production cost is reduced remarkably (P is less than or equal to 0.01).

Compared with the tobacco leaf system of the experimental group 1 and the experimental group 2, the lettuce instantaneously expresses the human papilloma virus protein, obviously (P is less than or equal to 0.05), shortens the production period, simplifies the difficulty of protein purification, and remarkably (P is less than or equal to 0.01) reduces the production cost.

Compared with a control group, the experimental group 2 has the advantages that the tobacco leaf transient expression human papilloma virus protein obviously (P is less than or equal to 0.05) shortens the production period compared with an animal system, obviously (P is less than or equal to 0.05) improves the expression quantity, simplifies the difficulty of protein purification, and obviously (P is less than or equal to 0.05) reduces the production cost.

The comprehensive test results show that the plant system, especially the lettuce system, is a more economic and efficient expression platform. Can express recombinant protein rapidly and transiently, and can produce human papilloma virus protein in large scale in short time.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> king league

Application of lettuce as host in expressing human papilloma virus protein or preparing human cervical cancer vaccine

<130>MP1916307

<160>15

<170>SIPOSequenceListing 1.0

<210>1

<211>479

<212>DNA

<213>HPV16 L1

<400>1

atgcaccaaa agagaactgc aatgtttcag gacccacagg agcgacccag aaagttacaa 60

cacagttatg cacagagctg caaacaacta tacatgatat aatattagaa tgtgtgtact 120

gcaagcaaca gttactgcga cgtgaggtat atgactttgcttttcgggat ttatgcatag 180

tatatagaga tgggaatcca tatgctgtat gtgataaatg tttaaagttt tattctaaaa 240

ttagtgagta tagacattat tgttatagtg tgtatggaac aacattagaa cagcaataca 300

acaaaccgtt gtgtgatttg ttaattaggt gtattaactg tcaaaagcca ctgtgtcctg 360

aagaaaagca aagacatctg gacaaaaagc aaagattcca taatataagg ggtcggtgga 420

ccggtcgatg tatgtcttgt tgcagatcat caagaacacg tagagaaacc cagctgtaa 479

<210>2

<211>158

<212>PRT

<213>HPV16 L1

<400>2

Met His Gln Lys Arg Thr Ala Met Phe Gln Asp Pro Gln Glu Arg Pro

1 5 10 15

Arg Lys Leu Pro Gln Leu Cys Thr Glu Leu Gln Thr Thr Ile His Asp

20 25 30

Ile Ile Leu Glu Cys Val Tyr Cys Lys Gln Gln Leu Leu Arg Arg Glu

35 40 45

Val Tyr Asp Phe Ala Phe Arg Asp Leu Cys Ile Val Tyr Arg Asp Gly

50 55 60

Asn Pro Tyr Ala Val Cys Asp Lys Cys Leu Lys Phe Tyr Ser Lys Ile

65 70 75 80

Ser Glu Tyr Arg His Tyr Cys Tyr Ser Val Tyr Gly Thr Thr Leu Glu

85 90 95

Gln Gln Tyr Asn Lys Pro Leu Cys Asp Leu Leu Ile Arg Cys Ile Asn

100 105 110

Cys Gln Lys Pro Leu Cys Pro Glu Glu Lys Gln Arg His Leu Asp Lys

115 120 125

Lys Gln Arg Phe His Asn Ile Arg Gly Arg Trp Thr Gly Arg Cys Met

130 135 140

Ser Cys Cys Arg Ser Ser Arg Thr Arg Arg Glu Thr Gln Leu

145 150 155

<210>3

<211>471

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgcaccaga agcgcaccgc catgttccag gacccgcagg agcgcccgcg caagctgccg 60

cagctgtgca ccgagctgca gaccaccatc cacgacatca tcctggagtg cgtgtactgc 120

aagcagcagc tgcgccgcga ggtgtacgac ttcgccttcc gcgacctgtg catcgtgtac 180

cgcgacggca acccgtacgc cgtgtgcgac aagtgcctga agttctactc gaagatctcg 240

gagtaccgcc actactgcta ctcggtgtac ggcaccaccc tggagcagca gtacaacaag 300

ccgctgtgcg acctgctgat ccgctgcatc aactgccaga agccgctgtg cccggaggag 360

aagcagcgcc acctggacaa gaagcagcgc ttccacaaca tccgcggccg ctggaccggc 420

cgctgcatgt cgtgctgccg ctcgtcgcgc acccgccgcg agacccagct g 471

<210>4

<211>1611

<212>DNA

<213>HPV17 L2

<400>4

atggctcgct cacgacgcat aaagcgtgcc tctgtaactg acatctacag gggttgcaag 60

caggctggta cttgcccccc tgatgttatt aataaagtgg aacaaactac aatagcagat 120

aaaattttaa aatatggtag ttctggtgtt ttttttggtg ggctgggcat tagtacaggt 180

cgtggcacgg gtggagcaac aggttatttc cctttgggtg aagggcctgg ggtacgcgta 240

ggtggcgccc ccactatagt tcgccctggg gttatacctg aactcattgg cccagcggat 300

gtaataccta tcgatacagt cactccaatt gaccccgcag cacctagtat tgttacaatc 360

acagacagca gtgctgttga cctattacct actgaattgg aaaccattgc agaaatacat 420

cctgtgccta ctgacaattt agatattgac actcctgttg tttcaggagg cagggattcc 480

agtgctgttt tagaggttgc tgatcctagt ccccctgtaa gaacaagggt gtctcgtact 540

cagtaccaca acccatcatt tcaagtaatt actgaatcta cacctttatc tggagaatca 600

gctatggcgg atcatgtttt agtgtttgaa ggttttggtg gacaaaacat aggtggttcc 660

aggaatgcag ctatcgacac agcacaggaa agctttgaaa tgcaatcctg gcccagcaga 720

tacagctttg agatagagga aggtacacct cctagaacaa gtactcctgt tcaacgtgca 780

gtacaatcac tatcaagctt aagaagagct ttatacaata gacgattaac tgaacaagtt 840

gcagtgacag atccactctt tttaagtagg ccctcacact tggttcaatt tcagtttgat 900

aatcctgcgt ttgaagaaga agttacacag ctgtttgaaa gagatattga agcagtggag 960

gaacctcctg atagacagtt tttagatgtt gtacgcttag gaaggcctac atattcagaa 1020

acaccacagg gttatttacg agtcagtaga ctaggtagaa gagccagtat tcgtactcgc 1080

agtggagcac aagtaggagc tcaggtacat ttttatagag atattagcac tattgattca 1140

gatgctttag aaatgcaatt attgggggaa cattcaggtg acactactat agtacaaggt 1200

cctgtagaaa gctcctttgt agacattaat attgatgacc cagggccttt aaatgtaggc 1260

atccaagaat caccactggt tgatactata gaagaagatt ttaattctgc agatttgtta 1320

ctggaagatg ctatagatga ttttagcggg tctcagctgg tatttggtaa tcctcgccgc 1380

agcacaacat ctgtaactgt accccggttt gaaacaccaa gggatactgg attttacata 1440

catgacactc agggatacac agtagcatat ccagaatcac gtgataccac tgaaatcatt 1500

cttccacacc ctgatacacc aactgtagta attaaatttg cagaagcagg ggcagatttt 1560

tatttacacc ctagtttaag gaaacgaaaa agaaaacgaa aatatttgta a 1611

<210>5

<211>551

<212>PRT

<213>HPV17 L2

<400>5

Met Ala Arg Ser Arg Arg Ile Lys Arg Ala Ser Val Thr Asp Ile Tyr

1 5 10 15

Arg Gly Cys Lys Gln Ala Gly Thr Cys Pro Pro Asp Val Ile Asn Lys

20 25 30

Val Glu Gln Thr Thr Ile Ala Asp Lys Ile Leu LysAla Asp His Val

35 40 45

Leu Val Phe Glu Gly Phe Asp Gly Phe Tyr Gly Ser Ser Gly Val Phe

50 55 60

Phe Gly Gly Leu Gly Ile Ser Thr Gly Arg Gly Thr Gly Gly Ala Thr

65 70 75 80

Gly Tyr Phe Pro Leu Gly Glu Gly Pro Gly Val Arg Val Gly Gly Ala

85 90 95

Pro Thr Ile Val Arg Pro Gly Val Ile Pro Glu Leu Ile Gly Pro Ala

100 105 110

Asp Val Ile Pro Ile Asp Thr Val Thr Pro Ile Asp Pro Ala Ala Pro

115 120 125

Ser Ile Val Thr Ile Thr Asp Ser Ser Ala Val Asp Leu Leu Pro Thr

130 135 140

Glu Leu Glu Thr Ile Ala Glu Ile His Pro Val Pro Thr Asp Asn Leu

145 150 155 160

Asp Ile Asp Thr Pro Val Val Ser Gly Gly Arg Asp Ser Lys Asn Ser

165 170 175

Ala Val Leu Glu Val Ala Asp Pro Ser Pro Pro Val Arg Thr Arg Val

180 185 190

Ser Arg Thr Gln Tyr His Asn Pro Ser Phe Gln Val Ile Thr GluSer

195 200 205

Thr Pro Leu Ser Gly Glu Ser Ala Met Ala Asp His Val Leu Val Phe

210 215 220

Glu Gly Phe Gly Gly Gln Asn Ile Gly Gly Ser Arg Asn Ala Ala Ile

225 230 235 240

Asp Thr Ala Gln Glu Ser Phe Glu Met Gln Ser Trp Pro Ser Arg Tyr

245 250 255

Ser Phe Glu Ile Glu Glu Gly Thr Pro Pro Arg Thr Ser Thr Pro Val

260 265 270

Gln Arg Ala Val Gln Ser Leu Ser Ser Leu Arg Arg Ala Leu Tyr Asn

275 280 285

Arg Arg Leu Thr Glu Gln Val Ala Val Thr Asp Pro Leu Phe Leu Ser

290 295 300

Arg Pro Ser His Leu Val Gln Phe Gln Phe Asp Asn Pro Ala Phe Glu

305 310 315 320

Glu Glu Val Thr Gln Leu Phe Glu Arg Asp Ile Glu Ala Val Glu Glu

325 330 335

Pro Pro Asp Arg Gln Phe Leu Asp Val Val Arg Leu Gly Arg Pro Thr

340 345 350

Tyr Ser Glu Thr Pro Gln Gly Tyr Leu Arg Val Ser Arg Leu Gly Arg

355 360 365

Arg Ala Ser Ile Arg Thr Arg Ser Gly Ala Gln Val Gly Ala Gln Val

370 375 380

His Phe Tyr Arg Asp Ile Ser Thr Ile Asp Ser Asp Ala Leu Glu Met

385 390 395 400

Gln Leu Leu Gly Glu His Ser Gly Asp Thr Thr Ile Val Gln Gly Pro

405 410 415

Val Glu Ser Ser Phe Val Asp Ile Asn Ile Asp Asp Pro Gly Pro Leu

420 425 430

Asn Val Gly Ile Gln Glu Ser Pro Leu Val Asp Thr Ile Glu Glu Asp

435 440 445

Phe Asn Ser Ala Asp Leu Leu Leu Glu Asp Ala Ile Asp Asp Phe Ser

450 455 460

Gly Ser Gln Leu Val Phe Gly Asn Pro Arg Arg Ser Thr Thr Ser Val

465 470 475 480

Thr Val Pro Arg Phe Glu Thr Pro Arg Asp Thr Gly Phe Tyr Ile His

485 490 495

Asp Thr Gln Gly Tyr Thr Val Ala Tyr Pro Glu Ser Arg Asp Thr Thr

500 505 510

Glu Ile Ile Leu Pro His Pro Asp Thr Pro Thr Val Val Ile Lys Phe

515 520 525

Ala Glu Ala Gly Ala Asp Phe Tyr Leu His Pro Ser Leu Arg Lys Arg

530 535 540

Lys Arg Lys Arg Lys Tyr Leu

545 550

<210>6

<211>1607

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

atggccagga gcaggaggat caagagggcc agcgtgaccg acatctacag gggctgcaag 60

caggccggca cctgcccgcc ggacgtgatc aacaaggtgg agcagaccac catcgccgac 120

aagatcctca agtacggcag cagcggcgtg ttcttcggcg gcctcggcat cagcaccggc 180

aggggcaccg gcggcgccac cggctacttc ccgctcggcg agggcccggg cgtgagggtg 240

ggcggcgccc cgaccatcgt gaggccgggc gtgatcccgg agctcatcgg cccggccgac 300

gtgatcccga tcgacaccgt gaccccgatc gacccggccg ccccgagcat cgtgaccatc 360

accgacagca gcgccgtgga cctcctcccg accgagctcg agaccatcgc cgagatccac 420

ccggtgccga ccgacaacct cgacatcgac accccggtgg tgagcggcgg cagggacagc 480

agcgccgtgc tcgaggtggc cgacccgagc ccgccggtga ggaccagggt gagcaggacc 540

cagtaccaca acccgagctt ccaggtgatc accgagagca ccccgctcag cggcgagagc 600

gccatggccg accacgtgct cgtgttcgag ggcttcggcg gccagaacat cggcggcagc 660

aggaacgccg ccatcgacac cgcccaggag agcttcgagatgcagagctg gccgagcagg 720

tacagcttcg agatcgagga gggcaccccg ccgaggacca gcaccccggt gcagagggcc 780

gtgcagagcc tcagcagcct caggagggcc ctctacaaca ggaggctcac cgagcaggtg 840

gccgtgaccg acccgctctt cctcagcagg ccgagccacc tcgtgcagtt ccagttcgac 900

aacccggcct tcgaggagga ggtgacccag ctcttcgaga gggacatcga ggccgtggag 960

gagccgccgg acaggcagtt cctcgacgtg gtgaggctcg gcaggccgac ctacagcgag 1020

accccgcagg gctacctcag ggtgagcagg ctcggcagga gggccagcat caggaccagg 1080

agcggcgccc aggtgggcgc ccaggtgcac ttctacaggg acatcagcac catcgacagc 1140

gacgccctcg agatgcagct cctcggcgag cacagcggcg acaccaccat cgtgcagggc 1200

ccggtggaga gcagcttcgt ggacatcaac atcgacgacc cgggcccgct caacgtgggc 1260

atccaggaga gcccgctcgt ggacaccatc gaggaggact tcaacagcgc gacctcctcc 1320

tcgaggacgc catcgacgac ttcagcggca gccagctcgt gttcggcaac ccgaggagga 1380

gcaccaccag cgtgaccgtg ccgaggttcg agaccccgag ggacaccggc ttctacatcc 1440

acgacaccca gggctacacc gtggcctacc cggagagcag ggacaccacc gagatcatcc 1500

tcccgcaccc ggacaccccg accgtggtga tcaagttcgc cgaggccggc gccgacttct 1560

acctccaccc gagcctcagg aagaggaaga ggaagaggaa gtacctc 1607

<210>7

<211>1527

<212>DNA

<213>HPV1 L1

<400>7

atgtataatgtttttcagat ggctgtctgg ttaccagcgc agaataagtt ctatcttcct 60

ccccagccca tcactagaat cctgtccact gatgaatatg taaccagaac caatctcttc 120

taccatgcaa catctgaacg tctactgctg gtcggacatc ctttgtttga gatctccagt 180

aatcaaactg taactatacc aaaagtgtca ccaaatgcat ttagagtttt tagggtgcgt 240

tttgctgatc caaatagatt tgcatttggg gataaggcaa tttttaatcc agaaacagaa 300

agattagttt ggggcctaag agggatagag ataggtagag gccagccttt aggtatagga 360

ataacgggcc accctctttt aaataagtta gatgatgcag aaaatccaac aaattatatt 420

aatactcatg caaatggaga ttctagacaa aatactgctt ttgatgcaaa acagacacaa 480

atgttcctcg tcggctgtac tcctgcttca ggtgaacact ggacaagtag tcgttgccca 540

ggggaacaag tgaaacttgg ggactgcccc agggtgcaaa tgatagagtc tgtcatagaa 600

gatggtgaca tgatggatat tggttttggg gctatggatt ttgctgcttt acagcaagac 660

aagtctgatg tccctttaga tgttgttcaa gcaacatgca aatatcctga ttatatcaga 720

atgaaccatg aagcctatgg caactctatg tttttttttg cacgtcgcga gcaaatgtat 780

accaggcact tttttactcg cgggggttcg gtgggtgata aggaggcagt cccacaaagc 840

ctgtatttaa cagcagatgc tgaaccaaga acaactttag caacaacaaa ttatgtaggc 900

acaccaagtg gctctatggt ttcatctgat gtccaattgt ttaatagatc ttactggctt 960

cagcgatgtc aaggccagaa taatggcatt tgctggagaa accagttatt tattacagtt 1020

ggagataata ccagaggaac aagtttatct atcagtatga aaaacaatgc aagtactaca 1080

tattccaatg ctaattttaa tgattttcta agacatactg aagaatttga tctttctttt 1140

atagttcagc tttgtaaagt aaagttaact cccgaaaatc tagcctacat tcatacaatg 1200

gaccctaata ttttagagga ttggcaacta tctgtatctc aaccacctac caatcctcta 1260

gaagatcaat ataggttttt agggtcttcc ttggcagcaa aatgtccaga acaggcgcct 1320

cctgagcccc agactgatcc ttatagtcaa tataaattct gggaagtcga tctcacagaa 1380

aggatgtccg aacaattaga ccaatttcca ctaggaagga aatttctata tcaaagtggc 1440

atgacacaac gtactgctac tagttccacc acaaagcgca aaacagtgcg tgtatctacg 1500

tcagccaagc gcaggcgtaa ggcttag 1527

<210>8

<211>522

<212>PRT

<213>HPV1 L1

<400>8

Met Tyr Asn Val Phe Gln Met Ala Val Trp Leu Pro Ala Gln Asn Lys

1 5 10 15

Phe Tyr Leu Pro Pro Gln Pro Ile Thr Arg Ile Leu Ser Thr Asp Glu

20 25 30

Tyr Val Thr Arg Thr Asn Leu Phe Tyr His Ala Thr Val Ile Glu Asp

35 40 45

Gly Asp Met Met Asp Ile Gly Phe His Gly Ser Glu Arg Leu Leu Leu

50 55 60

Val Gly His Pro Leu Phe Glu Ile Ser Ser Asn Gln Thr Val Thr Ile

65 7075 80

Pro Lys Val Ser Pro Asn Ala Phe Arg Val Phe Arg Val Arg Phe Ala

85 90 95

Asp Pro Asn Arg Phe Ala Phe Gly Asp Lys Ala Ile Phe Asn Pro Glu

100 105 110

Thr Glu Arg Leu Val Trp Gly Leu Arg Gly Ile Glu Ile Gly Arg Gly

115 120 125

Gln Pro Leu Gly Ile Gly Ile Thr Gly His Pro Leu Leu Asn Lys Leu

130 135 140

Asp Asp Ala Glu Asn Pro Thr Asn Tyr Ile Asn Thr His Ala Asn Gly

145 150 155 160

Asp Ser Arg Gln Asn Thr Ala Phe Asp Ala Lys Gln Thr Gln Met Phe

165 170 175

Leu Val Gly Cys Thr Pro Ala Ser Gly Glu His Trp Thr Ser Ser Arg

180 185 190

Cys Pro Gly Glu Gln Val Lys Leu Gly Asp Cys Pro Arg Val Gln Met

195 200 205

Ile Glu Ser Val Ile Glu Asp Gly Asp Met Met Asp Ile Gly Phe Gly

210 215 220

Ala Met Asp Phe Ala Ala Leu Gln Gln Asp Lys Ser Asp Val Pro Leu

225 230235 240

Asp Val Val Gln Ala Thr Cys Lys Tyr Pro Asp Tyr Ile Arg Met Asn

245 250 255

His Glu Ala Tyr Gly Asn Ser Met Phe Phe Phe Ala Arg Arg Glu Gln

260 265 270

Met Tyr Thr Arg His Phe Phe Thr Arg Gly Gly Ser Val Gly Asp Lys

275 280 285

Glu Ala Val Pro Gln Ser Leu Tyr Leu Thr Ala Asp Ala Glu Pro Arg

290 295 300

Thr Thr Leu Ala Thr Thr Asn Tyr Val Gly Thr Pro Ser Gly Ser Met

305 310 315 320

Val Ser Ser Asp Val Gln Leu Phe Asn Arg Ser Tyr Trp Leu Gln Arg

325 330 335

Cys Gln Gly Gln Asn Asn Gly Ile Cys Trp Arg Asn Gln Leu Phe Ile

340 345 350

Thr Val Gly Asp Asn Thr Arg Gly Thr Ser Leu Ser Ile Ser Met Lys

355 360 365

Asn Asn Ala Ser Thr Thr Tyr Ser Asn Ala Asn Phe Asn Asp Phe Leu

370 375 380

Arg His Thr Glu Glu Phe Asp Leu Ser Phe Ile Val Gln Leu Cys Lys

385 390395 400

Val Lys Leu Thr Pro Glu Asn Leu Ala Tyr Ile His Thr Met Asp Pro

405 410 415

Asn Ile Leu Glu Asp Trp Gln Leu Ser Val Ser Gln Pro Pro Thr Asn

420 425 430

Pro Leu Glu Asp Gln Tyr Arg Phe Leu Gly Ser Ser Leu Ala Ala Lys

435 440 445

Cys Pro Glu Gln Ala Pro Pro Glu Pro Gln Thr Asp Pro Tyr Ser Gln

450 455 460

Tyr Lys Phe Trp Glu Val Asp Leu Thr Glu Arg Met Ser Glu Gln Leu

465 470 475 480

Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Tyr Gln Ser Gly Met Thr

485 490 495

Gln Arg Thr Ala Thr Ser Ser Thr Thr Lys Arg Lys Thr Val Arg Val

500 505 510

Ser Thr Ser Ala Lys Arg Arg Arg Lys Ala

515 520

<210>9

<211>1524

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

atgtacaacg tgttccagat ggccgtgtgg ctcccggccc agaacaagtt ctacctcccg 60

ccgcagccga tcaccaggat cctcagcacc gacgagtacg tgaccaggac caacctcttc 120

taccacgcca ccagcgagag gctcctcctc gtgggccacc cgctcttcga gatcagcagc 180

aaccagaccg tgaccatccc gaaggtgagc ccgaacgcct tcagggtgtt cagggtgagg 240

ttcgccgacc cgaacaggtt cgccttcggc gacaaggcca tcttcaaccc ggagaccgag 300

aggctcgtgt ggggcctcag gggcatcgag atcggcaggg gccagccgct cggcatcggc 360

atcaccggcc acccgctcct caacaagctc gacgacgccg agaacccgac caactacatc 420

aacacccacg ccaacggcga cagcaggcag aacaccgcct tcgacgccaa gcagacccag 480

atgttcctcg tgggctgcac cccggccagc ggcgagcact ggaccagcag caggtgcccg 540

ggcgagcagg tgaagctcgg cgactgcccg agggtgcaga tgatcgagag cgtgatcgag 600

gacggcgaca tgatggacat cggcttcggc gccatggact tcgccgccct ccagcaggac 660

aagagcgacg tgccgctcga cgtggtgcag gccacctgca agtacccgga ctacatcagg 720

atgaaccacg aggcctacgg caacagcatg ttcttcttcg ccaggaggga gcagatgtac 780

accaggcact tcttcaccag gggcggcagc gtgggcgaca aggaggccgt gccgcagagc 840

ctctacctca ccgccgacgc cgagccgagg accaccctcg ccaccaccaa ctacgtgggc 900

accccgagcg gcagcatggt gagcagcgac gtgcagctct tcaacaggag ctactggctc 960

cagaggtgcc agggccagaa caacggcatc tgctggagga accagctctt catcaccgtg 1020

ggcgacaaca ccaggggcac cagcctcagc atcagcatga agaacaacgc cagcaccacc 1080

tacagcaacg ccaacttcaa cgacttcctc aggcacaccg aggagttcga cctcagcttc 1140

atcgtgcagc tctgcaaggt gaagctcacc ccggagaacc tcgcctacat ccacaccatg 1200

gacccgaaca tcctcgagga ctggcagctc agcgtgagcc agccgccgac caacccgctc 1260

gaggaccagt acaggttcct cggcagcagc ctcgccgcca agtgcccgga gcaggccccg 1320

ccggagccgc agaccgaccc gtacagccag tacaagttct gggaggtgga cctcaccgag 1380

aggatgagcg agcagctcga ccagttcccg ctcggcagga agttcctcta ccagagcggc 1440

atgacccaga ggaccgccac cagcagcacc accaagagga agaccgtgag ggtgagcacc 1500

agcgccaaga ggaggaggaa ggcc 1524

<210>10

<211>1569

<212>DNA

<213>HPV4 L2

<400>10

atgcaaagct tgagtagaag gaaaagagat tcagttccaa atctttatgc aaaatgttga 60

caactgtctg gcaattgcct acctgatgta aaaaataaag tagaagctga tactcttgct 120

gatcgtttgc tgagatggtt gggaagtgta atatacctag gaggcttggg tattggtact 180

gggagaggta gtggggggtc aactgggtat aatccaattg gagctccaag tagagtcaca 240

cctagtggta ctttagtaag gcctacagtg cctgtggaaa gtttgggacc ctcagaaata 300

atcccaatag atgcaataga cccaacaaca tcttctgttg tgccattaga ggatctgacc 360

atcccagatg tcacagtaga tagtggagat acaagaggaa taggggagac tactcttcag 420

cctgcacaag tagatatttc aacatcacat gaccctatat cagatgtcac tggtgctagc 480

agccacccta caatcatatc tggcgaggat aacgccattg cagtgttaga tgtgtcccct 540

atagaacctc ccacaaaacg gatagcattg gcaactaggg gagcctcagc aactccacat 600

gtaagtgtca tatctggcac aaccgaattc ggtcagtcat ctgatctgaa tgtatttgtg 660

aatgccacat tttcaggcga ttccattggt tatacagaag aaattccatt agaaccgttg 720

aacccctttc aagaattcga aatagaaagc cctccaaaaa ctagtacacc acgtgacgtt 780

ttaaatcgtg caataggaag agcacgggat ttatataata gaagggttca gcaaatacct 840

actaggaacc cagctttact gacacagcct tcccgcgcaa tagtatttgg atttgaaaat 900

cccgcctttg atgctgacat cactcaaaca tttgagcggg atttagaaca ggttgcagca 960

gctccagatg ctgactttgc agacatagtc actatagggc gtccaaggtt ttcagagaca 1020

gatgctggtc aaattagagt tagcaggctt ggacgccgag gcacaataaa aactagaagt 1080

ggtgtgcaaa ttgggcaggc ggttcatttt tattacgacc taagtacaat agatactgct 1140

gatgctattg aattatctac tttaggtcaa cattcaggag aacaaagcat tgttgatgct 1200

atgatagaaa gcagcttaat agatcctttt gaaatgcccg atcctacttt tacagaagaa 1260

caacagcttt tagatccact tacagaagat tttagtcagt cacacttggt gcttactagt 1320

agcagacgtg ggacatcatt tactatacct acaataccac ctggattagg tcttagaatt 1380

tatgtagatg atgtaggttc tgatttattt gtttcctatc cagaatctag agtaatacct 1440

gctggaggtt taccaactga gccatttgtt cctctagaac cagctttgtt atctgatata 1500

tttagtacgg attttgtata tcgtcctagt ttatatcgca agaaacggaa acgattagaa 1560

atgttttaa 1569

<210>11

<211>522

<212>PRT

<213>HPV4 L2

<400>11

Met Tyr Asn Val Phe Gln Met Ala Val Trp Leu Pro Ala Gln Asn Lys

1 5 10 15

Phe Tyr Leu Pro Pro Gln Pro Ile Thr Arg Ile Leu Ser Thr Asp Glu

20 25 30

Tyr Val Thr Arg Thr Asn Leu Phe Tyr His Ala Thr Thr His Ala Asn

35 40 45

Gly Asp Ser Arg Gln Asn Thr Ala Ser Gly Ser Glu Arg Leu Leu Leu

50 55 60

Val Gly His Pro Leu Phe Glu Ile Ser Ser Asn Gln Thr Val Thr Ile

65 70 75 80

Pro Lys Val Ser Pro Asn Ala Phe Arg Val Phe Arg Val Arg Phe Ala

85 90 95

Asp Pro Asn Arg Phe Ala Phe Gly Asp Lys Ala Ile Phe Asn Pro Glu

100 105 110

Thr Glu Arg Leu Val Trp Gly Leu Arg Gly Ile Glu Ile Gly Arg Gly

115 120 125

Gln Pro Leu Gly Ile Gly Ile Thr Gly His Pro Leu Leu Asn Lys Leu

130 135 140

Asp Asp Ala Glu Asn Pro Thr Asn Tyr Ile Asn Thr His Ala Asn Gly

145 150 155 160

Asp Ser Arg Gln Asn Thr Ala Phe Asp Ala Lys Gln Thr Gln Met Phe

165 170 175

Leu Val Gly Cys Thr Pro Ala Ser Gly Glu His Trp Thr Ser Ser Arg

180 185 190

Cys Pro Gly Glu Gln Val Lys Leu Gly Asp Cys Pro Arg Val Gln Met

195 200 205

Ile Glu Ser Val Ile Glu Asp Gly Asp Met Met Asp Ile Gly Phe Gly

210 215 220

Ala Met Asp Phe Ala Ala Leu Gln Gln Asp Lys Ser Asp Val Pro Leu

225 230 235 240

Asp Val Val Gln Ala Thr Cys Lys Tyr Pro Asp Tyr Ile Arg Met Asn

245 250 255

His Glu Ala Tyr Gly Asn Ser Met Phe Phe Phe Ala Arg Arg Glu Gln

260 265 270

Met Tyr Thr Arg His Phe Phe Thr Arg Gly Gly Ser Val Gly Asp Lys

275 280 285

Glu Ala Val Pro Gln Ser Leu Tyr Leu Thr Ala Asp Ala Glu Pro Arg

290 295 300

Thr ThrLeu Ala Thr Thr Asn Tyr Val Gly Thr Pro Ser Gly Ser Met

305 310 315 320

Val Ser Ser Asp Val Gln Leu Phe Asn Arg Ser Tyr Trp Leu Gln Arg

325 330 335

Cys Gln Gly Gln Asn Asn Gly Ile Cys Trp Arg Asn Gln Leu Phe Ile

340 345 350

Thr Val Gly Asp Asn Thr Arg Gly Thr Ser Leu Ser Ile Ser Met Lys

355 360 365

Asn Asn Ala Ser Thr Thr Tyr Ser Asn Ala Asn Phe Asn Asp Phe Leu

370 375 380

Arg His Thr Glu Glu Phe Asp Leu Ser Phe Ile Val Gln Leu Cys Lys

385 390 395 400

Val Lys Leu Thr Pro Glu Asn Leu Ala Tyr Ile His Thr Met Asp Pro

405 410 415

Asn Ile Leu Glu Asp Trp Gln Leu Ser Val Ser Gln Pro Pro Thr Asn

420 425 430

Pro Leu Glu Asp Gln Tyr Arg Phe Leu Gly Ser Ser Leu Ala Ala Lys

435 440 445

Cys Pro Glu Gln Ala Pro Pro Glu Pro Gln Thr Asp Pro Tyr Ser Gln

450 455 460

Tyr Lys Phe TrpGlu Val Asp Leu Thr Glu Arg Met Ser Glu Gln Leu

465 470 475 480

Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Tyr Gln Ser Gly Met Thr

485 490 495

Gln Arg Thr Ala Thr Ser Ser Thr Thr Lys Arg Lys Thr Val Arg Val

500 505 510

Ser Thr Ser Ala Lys Arg Arg Arg Lys Ala

515 520

<210>12

<211>1524

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

atgtacaacg tgttccagat ggccgtgtgg ctcccggccc agaacaagtt ctacctcccg 60

ccgcagccga tcaccaggat cctcagcacc gacgagtacg tgaccaggac caacctcttc 120

taccacgcca ccagcgagag gctcctcctc gtgggccacc cgctcttcga gatcagcagc 180

aaccagaccg tgaccatccc gaaggtgagc ccgaacgcct tcagggtgtt cagggtgagg 240

ttcgccgacc cgaacaggtt cgccttcggc gacaaggcca tcttcaaccc ggagaccgag 300

aggctcgtgt ggggcctcag gggcatcgag atcggcaggg gccagccgct cggcatcggc 360

atcaccggcc acccgctcct caacaagctc gacgacgccg agaacccgac caactacatc 420

aacacccacg ccaacggcga cagcaggcag aacaccgcct tcgacgccaa gcagacccag 480

atgttcctcg tgggctgcac cccggccagc ggcgagcact ggaccagcag caggtgcccg 540

ggcgagcagg tgaagctcgg cgactgcccg agggtgcaga tgatcgagag cgtgatcgag 600

gacggcgaca tgatggacat cggcttcggc gccatggact tcgccgccct ccagcaggac 660

aagagcgacg tgccgctcga cgtggtgcag gccacctgca agtacccgga ctacatcagg 720

atgaaccacg aggcctacgg caacagcatg ttcttcttcg ccaggaggga gcagatgtac 780

accaggcact tcttcaccag gggcggcagc gtgggcgaca aggaggccgt gccgcagagc 840

ctctacctca ccgccgacgc cgagccgagg accaccctcg ccaccaccaa ctacgtgggc 900

accccgagcg gcagcatggt gagcagcgac gtgcagctct tcaacaggag ctactggctc 960

cagaggtgcc agggccagaa caacggcatc tgctggagga accagctctt catcaccgtg 1020

ggcgacaaca ccaggggcac cagcctcagc atcagcatga agaacaacgc cagcaccacc 1080

tacagcaacg ccaacttcaa cgacttcctc aggcacaccg aggagttcga cctcagcttc 1140

atcgtgcagc tctgcaaggt gaagctcacc ccggagaacc tcgcctacat ccacaccatg 1200

gacccgaaca tcctcgagga ctggcagctc agcgtgagcc agccgccgac caacccgctc 1260

gaggaccagt acaggttcct cggcagcagc ctcgccgcca agtgcccgga gcaggccccg 1320

ccggagccgc agaccgaccc gtacagccag tacaagttct gggaggtgga cctcaccgag 1380

aggatgagcg agcagctcga ccagttcccg ctcggcagga agttcctcta ccagagcggc 1440

atgacccaga ggaccgccac cagcagcacc accaagagga agaccgtgag ggtgagcacc 1500

agcgccaaga ggaggaggaa ggcc 1524

<210>13

<211>1707

<212>DNA

<213>HPV18 L1

<400>13

atgtgcctgt atacacgggt cctgatatta cattaccatc tactacctct gtatggccca 60

ttgtatcacc cacggcccct gcctctacac agtatattgg tatacatggt acacattatt 120

atttgtggcc attatattat tttattccta agaaacgtaa acgtgttccc tatttttttg 180

cagatggctt tgtggcggcc tagtgacaat accgtatatc ttccacctcc ttctgtggca 240

agagttgtaa ataccgatga ttatgtgact cgcacaagca tattttatca tgctggcagc 300

tctagattat taactgttgg taatccatat tttagggttc ctgcaggtgg tggcaataag 360

caggatattc ctaaggtttc tgcataccaa tatagagtat ttagggtgca gttacctgac 420

ccaaataaat ttggtttacc tgatactagt atttataatc ctgaaacaca acgtttagtg 480

tgggcctgtg ctggagtgga aattggccgt ggtcagcctt taggtgttgg ccttagtggg 540

catccatttt ataataaatt agatgacact gaaagttccc atgccgccac gtctaatgtt 600

tctgaggacg ttagggacaa tgtgtctgta gattataagc agacacagtt atgtattttg 660

ggctgtgccc ctgctattgg ggaacactgg gctaaaggca ctgcttgtaa atcgcgtcct 720

ttatcacagg gcgattgccc ccctttagaa cttaaaaaca cagttttgga agatggtgat 780

atggtagata ctggatatgg tgccatggac tttagtacat tgcaagatac taaatgtgag 840

gtaccattgg atatttgtca gtctatttgt aaatatcctg attatttaca aatgtctgca 900

gatccttatg gggattccat gtttttttgc ttacggcgtg agcagctttt tgctaggcat 960

ttttggaata gagcaggtac tatgggtgac actgtgcctc aatccttata tattaaaggc 1020

acaggtatgc gtgcttcacc tggcagctgt gtgtattctc cctctccaag tggctctatt 1080

gttacctctg actcccagtt gtttaataaa ccatattggt tacataaggc acagggtcat 1140

aacaatggtg tttgctggca taatcaatta tttgttactg tggtagatac cactcgcagt 1200

accaatttaa caatatgtgc ttctacacag tctcctgtac ctgggcaata tgatgctacc 1260

aaatttaagc agtatagcag acatgttgag gaatatgatt tgcagtttat ttttcagttg 1320

tgtactatta ctttaactgc agatgttatg tcctatattc atagtatgaa tagcagtatt 1380

ttagaggatt ggaactttgg tgttcccccc ccgccaacta ctagtttggt ggatacatat 1440

cgttttgtac aatctgttgc tattacctgt caaaaggatg ctgcaccggc tgaaaataag 1500

gatccctatg ataagttaaa gttttggaat gtggatttaa aggaaaagtt ttctttagac 1560

ttagatcaat atccccttgg acgtaaattt ttggttcagg ctggattgcg tcgcaagccc 1620

accataggcc ctcgcaaacg ttctgctcca tctgccacta cgtcttctaa acctgccaag 1680

cgtgtgcgtg tacgtgccag gaagtaa 1707

<210>14

<211>582

<212>PRT

<213>HPV18 L1

<400>14

Met Cys Leu Tyr Thr Arg Val Leu Ile Leu His Tyr His Leu Leu Pro

1 5 10 15

Leu Tyr Gly Pro Leu Tyr His Pro Arg Pro Leu Pro Leu His Ser Ile

20 25 30

LeuVal Tyr Met Val His Ile Ile Ile Cys Gly His Phe Gly Leu Pro

35 40 45

Asp Thr Ser Ile Tyr Asn Pro Glu Thr Phe Tyr Ile Ile Leu Phe Leu

50 55 60

Arg Asn Val Asn Val Phe Pro Ile Phe Leu Gln Met Ala Leu Trp Arg

65 70 75 80

Pro Ser Asp Asn Thr Val Tyr Leu Pro Pro Pro Ser Val Ala Arg Val

85 90 95

Val Asn Thr Asp Asp Tyr Val Thr Arg Thr Ser Ile Phe Tyr His Ala

100 105 110

Gly Ser Ser Arg Leu Leu Thr Val Gly Asn Pro Tyr Phe Arg Val Pro

115 120 125

Ala Gly Gly Gly Asn Lys Gln Asp Ile Pro Lys Val Ser Ala Tyr Gln

130 135 140

Tyr Arg Val Phe Arg Val Gln Leu Pro Asp Pro Asn Lys Phe Gly Leu

145 150 155 160

Pro Asp Thr Ser Ile Tyr Asn Pro Glu Thr Gln Arg Leu Val Trp Ala

165 170 175

Cys Ala Gly Val Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Leu

180 185 190

Ser Gly His ProPhe Tyr Asn Lys Leu Asp Asp Thr Glu Ser Ser His

195 200 205

Ala Ala Thr Ser Asn Val Ser Glu Asp Val Arg Asp Asn Val Ser Val

210 215 220

Asp Tyr Lys Gln Thr Gln Leu Cys Ile Leu Gly Cys Ala Pro Ala Ile

225 230 235 240

Gly Glu His Trp Ala Lys Gly Thr Ala Cys Lys Ser Arg Pro Leu Ser

245 250 255

Gln Gly Asp Cys Pro Pro Leu Glu Leu Lys Asn Thr Val Leu Glu Asp

260 265 270

Gly Asp Met Val Asp Thr Gly Tyr Gly Ala Met Asp Phe Ser Thr Leu

275 280 285

Gln Asp Thr Lys Cys Glu Val Pro Leu Asp Ile Cys Gln Ser Ile Cys

290 295 300

Lys Tyr Pro Asp Tyr Leu Gln Met Ser Ala Asp Pro Tyr Gly Asp Ser

305 310 315 320

Met Phe Phe Cys Leu Arg Arg Glu Gln Leu Phe Ala Arg His Phe Trp

325 330 335

Asn Arg Ala Gly Thr Met Gly Asp Thr Val Pro Gln Ser Leu Tyr Ile

340 345 350

Lys Gly Thr Gly Met ArgAla Ser Pro Gly Ser Cys Val Tyr Ser Pro

355 360 365

Ser Pro Ser Gly Ser Ile Val Thr Ser Asp Ser Gln Leu Phe Asn Lys

370 375 380

Pro Tyr Trp Leu His Lys Ala Gln Gly His Asn Asn Gly Val Cys Trp

385 390 395 400

His Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn

405 410 415

Leu Thr Ile Cys Ala Ser Thr Gln Ser Pro Val Pro Gly Gln Tyr Asp

420 425 430

Ala Thr Lys Phe Lys Gln Tyr Ser Arg His Val Glu Glu Tyr Asp Leu

435 440 445

Gln Phe Ile Phe Gln Leu Cys Thr Ile Thr Leu Thr Ala Asp Val Met

450 455 460

Ser Tyr Ile His Ser Met Asn Ser Ser Ile Leu Glu Asp Trp Asn Phe

465 470 475 480

Gly Val Pro Pro Pro Pro Thr Thr Ser Leu Val Asp Thr Tyr Arg Phe

485 490 495

Val Gln Ser Val Ala Ile Thr Cys Gln Lys Asp Ala Ala Pro Ala Glu

500 505 510

Asn Lys Asp Pro Tyr Asp Lys LeuLys Phe Trp Asn Val Asp Leu Lys

515 520 525

Glu Lys Phe Ser Leu Asp Leu Asp Gln Tyr Pro Leu Gly Arg Lys Phe

530 535 540

Leu Val Gln Ala Gly Leu Arg Arg Lys Pro Thr Ile Gly Pro Arg Lys

545 550 555 560

Arg Ser Ala Pro Ser Ala Thr Thr Ser Ser Lys Pro Ala Lys Arg Val

565 570 575

Arg Val Arg Ala Arg Lys

580

<210>15

<211>1704

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

atgtgcctct acaccagggt gctcatcctc cactaccacc tcctcccgct ctacggcccg 60

ctctaccacc cgaggccgct cccgctccac agcatcctcg tgtacatggt gcacatcatc 120

atctgcggcc actacatcat cctcttcctc aggaacgtga acgtgttccc gatcttcctc 180

cagatggccc tctggaggcc gagcgacaac accgtgtacc tcccgccgcc gagcgtggcc 240

agggtggtga acaccgacga ctacgtgacc aggaccagca tcttctacca cgccggcagc 300

agcaggctcc tcaccgtggg caacccgtac ttcagggtgc cggccggcgg cggcaacaag 360

caggacatcc cgaaggtgag cgcctaccag tacagggtgt tcagggtgca gctcccggac 420

ccgaacaagt tcggcctccc ggacaccagc atctacaacc cggagaccca gaggctcgtg 480

tgggcctgcg ccggcgtgga gatcggcagg ggccagccgc tcggcgtggg cctcagcggc 540

cacccgttct acaacaagct cgacgacacc gagagcagcc acgccgccac cagcaacgtg 600

agcgaggacg tgagggacaa cgtgagcgtg gactacaagc agacccagct ctgcatcctc 660

ggctgcgccc cggccatcgg cgagcactgg gccaagggca ccgcctgcaa gagcaggccg 720

ctcagccagg gcgactgccc gccgctcgag ctcaagaaca ccgtgctcga ggacggcgac 780

atggtggaca ccggctacgg cgccatggac ttcagcaccc tccaggacac caagtgcgag 840

gtgccgctcg acatctgcca gagcatctgc aagtacccgg actacctcca gatgagcgcc 900

gacccgtacg gcgacagcat gttcttctgc ctcaggaggg agcagctctt cgccaggcac 960

ttctggaaca gggccggcac catgggcgac accgtgccgc agagcctcta catcaagggc 1020

accggcatga gggccagccc gggcagctgc gtgtacagcc cgagcccgag cggcagcatc 1080

gtgaccagcg acagccagct cttcaacaag ccgtactggc tccacaaggc ccagggccac 1140

aacaacggcg tgtgctggca caaccagctc ttcgtgaccg tggtggacac caccaggagc 1200

accaacctca ccatctgcgc cagcacccag agcccggtgc cgggccagta cgacgccacc 1260

aagttcaagc agtacagcag gcacgtggag gagtacgacc tccagttcat cttccagctc 1320

tgcaccatca ccctcaccgc cgacgtgatg agctacatcc acagcatgaa cagcagcatc 1380

ctcgaggact ggaacttcgg cgtgccgccg ccgccgacca ccagcctcgt ggacacctac 1440

aggttcgtgc agagcgtggc catcacctgc cagaaggacg ccgccccggc cgagaacaag 1500

gacccgtacg acaagctcaa gttctggaac gtggacctca aggagaagtt cagcctcgac 1560

ctcgaccagt acccgctcgg caggaagttc ctcgtgcagg ccggcctcag gaggaagccg 1620

accatcggcc cgaggaagag gagcgccccg agcgccacca ccagcagcaa gccggccaag 1680

agggtgaggg tgagggccag gaag 1704

Claims (10)

1. The application of the plant as a host in expressing human papilloma virus protein; the plant is selected from lettuce, spinach, tomato, radish, Chinese cabbage, corn, soybean, wheat or tobacco; the organ of the plant is selected from seeds, leaves, rhizomes or the whole plant;

the human papillomavirus protein comprises one or more of HPV 16L 1, HPV 17L 2, HPV 1L 1, HPV 4L 2 or HPV 18L 1.

2. The plant is used as a host to prepare the vaccine for human cervical cancer; the plant is selected from lettuce, spinach, tomato, radish, Chinese cabbage, corn, soybean, wheat or tobacco; the organ of the plant is selected from seeds, leaves, rhizomes or the whole plant;

the human cervical cancer vaccine comprises human papilloma virus proteins, wherein the human papilloma virus proteins comprise one or more of HPV 16L 1, HPV 17L 2, HPV 1L 1, HPV 4L 2 or HPV 18L 1.

3. An expression vector, comprising a nucleotide sequence of a human papillomavirus protein and a binary plant expression vector;

the human papillomavirus protein comprises one or more of HPV 16L 1, HPV 17L 2, HPV 1L 1, HPV 4L 2 or HPV 18L 1.

4. The expression vector of claim 3, wherein the human papilloma virus protein is HPV 16L 1, the cDNA sequence of which is shown as SEQ ID No.3 and the amino acid sequence of which is shown as SEQ ID No.2, or

The human papilloma virus protein is HPV 17L 2, the cDNA sequence of the human papilloma virus protein is shown as SEQ ID No.6, and the amino acid sequence is shown as SEQ ID No.5, or

The human papilloma virus protein is HPV 1L 1, the cDNA sequence of the human papilloma virus protein is shown as SEQ ID No.9, and the amino acid sequence is shown as SEQ ID No.8, or

The human papilloma virus protein is HPV 4L 2, the cDNA sequence of the human papilloma virus protein is shown as SEQ ID No.12, the amino acid sequence is shown as SEQ ID No.11, or

The human papilloma virus protein is HPV 18L 1, the cDNA sequence of the human papilloma virus protein is shown as SEQ ID No.15, and the amino acid sequence is shown as SEQ ID No. 14.

5. The expression vector according to claim 3 or 4, wherein the construction method comprises the steps of:

step 1: adding an Xbal restriction site at the 5 'end and a Sacl restriction site at the 3' end of a nucleotide sequence of Human Papilloma Virus (HPV);

step 2: cloning the nucleotide sequence of the modified human papilloma virus obtained in the step 1 into a vector pUC57 to obtain a cloning vector pUC-HPVs;

and step 3: obtaining gene fragments HPV from the cloning vector pUC-HPVs obtained in the step 2 through Xbal/Sacl respectively, cloning to a binary plant vector pCam35S, and obtaining an expression vector p 35S-HPVs.

6. Use of the expression vector according to any one of claims 3 to 5 for expressing human papillomavirus protein.

7. Use of the expression vector according to any one of claims 3 to 5 in the preparation of a vaccine for human cervical cancer.

8. A method for expressing human papillomavirus protein by a plant as a host, which is characterized in that the expression vector of any one of claims 3 to 5 is transformed into agrobacterium and is infiltrated into plant tissues through agrobacterium-mediated vacuum, and then the protein is extracted and separated to obtain the human papillomavirus protein;

the plant is selected from lettuce, spinach, tomato, radish, Chinese cabbage, corn, soybean, wheat or tobacco; the plant organ is selected from the group consisting of seed, leaf, rhizome, or whole plant.

9. A method for preparing a vaccine for human cervical cancer by using a plant as a host, which is characterized in that the expression vector of any one of claims 3 to 5 is transformed into agrobacterium, and after the agrobacterium-mediated vacuum infiltration is carried out into plant tissues, protein is extracted and separated, and the vaccine for human cervical cancer is obtained.

10. The method according to claim 8 or 9, wherein said agrobacterium-mediated vacuum infiltration comprises the steps of:

step 1: vacuumizing for 25-45 s;

step 2: keeping the vacuum at-95 kPa for 30-60 s;

and step 3: releasing the pressure such that the permeate permeates the plant tissue;

repeating the steps for 2-3 times, and carrying out light-proof treatment for 4 d.

Images