CN111378695A - Method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine, and eye drops - Google Patents
Method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine, and eye drops Download PDFInfo
- Publication number
- CN111378695A CN111378695A CN202010263927.XA CN202010263927A CN111378695A CN 111378695 A CN111378695 A CN 111378695A CN 202010263927 A CN202010263927 A CN 202010263927A CN 111378695 A CN111378695 A CN 111378695A
- Authority
- CN
- China
- Prior art keywords
- chloro
- reaction
- hydroxyethyl
- phenol
- ketoreductase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
- A61K31/137—Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine or methadone
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C213/00—Preparation of compounds containing amino and hydroxy, amino and etherified hydroxy or amino and esterified hydroxy groups bound to the same carbon skeleton
- C07C213/02—Preparation of compounds containing amino and hydroxy, amino and etherified hydroxy or amino and esterified hydroxy groups bound to the same carbon skeleton by reactions involving the formation of amino groups from compounds containing hydroxy groups or etherified or esterified hydroxy groups
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C215/00—Compounds containing amino and hydroxy groups bound to the same carbon skeleton
- C07C215/46—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton
- C07C215/56—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton with amino groups linked to the six-membered aromatic ring, or to the condensed ring system containing that ring, by carbon chains further substituted by hydroxy groups
- C07C215/58—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton with amino groups linked to the six-membered aromatic ring, or to the condensed ring system containing that ring, by carbon chains further substituted by hydroxy groups with hydroxy groups and the six-membered aromatic ring, or the condensed ring system containing that ring, bound to the same carbon atom of the carbon chain
- C07C215/60—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton with amino groups linked to the six-membered aromatic ring, or to the condensed ring system containing that ring, by carbon chains further substituted by hydroxy groups with hydroxy groups and the six-membered aromatic ring, or the condensed ring system containing that ring, bound to the same carbon atom of the carbon chain the chain having two carbon atoms between the amino groups and the six-membered aromatic ring or the condensed ring system containing that ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C39/00—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring
- C07C39/24—Halogenated derivatives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Abstract
The invention relates to the field of bioengineering, and particularly discloses a method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops, wherein the method for synthesizing the R-3- (2-chloro-1-hydroxyethyl) phenol comprises the following steps: taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking ketoreductase as a catalyst, and adding a hydrogen donor, a buffer solution and coenzyme to form a reaction system for catalytic reaction to obtain a phenylephrine intermediate. The ketoreductase provided by the embodiment of the invention has high activity and stereoselectivity, and the synthesis method provided by the embodiment of the invention adopts ketoreductase to carry out enzyme catalysis synthesis on phenylephrine intermediates, only one-step reaction is needed, the used reagents are few, the synthesis steps are greatly simplified, the problem of complex steps in the existing R-3- (2-chloro-1-hydroxyethyl) phenol synthesis method is solved, the reaction conditions are mild, the optical purity is high, and the method is green and environment-friendly.
Description
Technical Field
The invention relates to the field of bioengineering, in particular to a method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops.
Background
Phenylephrine is a powerful vasoconstrictor, is widely applied to hypotension emergency treatment or is used as a mydriasis drug in ophthalmological examination, and the R-type isomer of phenylephrine has far higher agonism than the S-type isomer, so that the problem of chiral selectivity needs to be considered when preparing phenylephrine, wherein R-3- (2-chloro-1-hydroxyethyl) phenol is a common phenylephrine intermediate and belongs to the R-type isomer.
At present, the synthesis method of R-3- (2-chloro-1-hydroxyethyl) phenol is generally synthesized by a resolution method, namely, a phenylephrine intermediate is synthesized by two steps of resolution and turnover, and the method cannot directly solve the chiral problem in the phenylephrine synthesis process, and has the defects of more reagents, complex operation and more three wastes.
Therefore, the above technical solution has the following disadvantages in practical operation: most of the existing synthetic methods of the phenylephrine intermediates have complicated steps, so that the chiral problem in the phenylephrine synthetic process cannot be directly solved.
Disclosure of Invention
The embodiment of the invention aims to provide a method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops, so as to solve the problem that the existing method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol proposed in the background art has complicated steps.
In order to achieve the above purpose, the embodiments of the present invention provide the following technical solutions:
a method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol comprises the following steps:
taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking ketoreductase as a catalyst, adding a hydrogen donor, a buffer solution and coenzyme to form a reaction system for catalytic reaction, and extracting a reaction solution after the reaction is completed to obtain the R-3- (2-chloro-1-hydroxyethyl) phenol.
Specifically, the synthetic route of the method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol is as follows:
as a further scheme of the invention: the ketoreductase is a reductase encoded by a ketoreductase gene, wherein the nucleotide sequence of the ketoreductase gene is shown as SEQ ID No.1, and the amino acid sequence of the ketoreductase is shown as SEQID No. 2.
Specifically, the nucleotide sequence shown in SEQ ID No.1 is:
atggcagaaa tcccggaaaa acagacggcg ttcgtgttca aaaatggctc gttcgcactg
gaaaaaaaag aaatcgaagt cccgaaaccg gatgccggca aagtcctgct gaaagtggcg
gccgcaggtg tttgtcatag cgatctgcat gtcctgcacg gcggtctgcc gtatccggac
ggcctgattc tgggtcatga aattgcaggc cacatcgtcg cttatggcga tggtgtggac
aaagctgcgt ttccgtctga tgcactgtac gctgtggttg gcccgaaccc gtgcggcatg
tgtaaagcgt gccgtaccgg tgccgataat gtgtgcgaag acccgagtcg tacgcacatg
ggcctgggtt ccccgggcgg ttatgaacag tacacccaag tgagcgcgcg taacattacg
aaagttccgg aaggtatccc ggccgcagtc gctgcggcct ctaccgatgc cgttctgacg
ccgtatcacg cgctgaaacg tgccggcatt aacggtatga cccgtctgct gatcgtgggc
ctgggcggtc tgggtattaa tgccgttcag atcgcgaaag ccttcggcag ctacgttatc
gcagtcgatc cgaaagaaag ctctcgtgac ctggcaaaac agtatggtgc taatgaagtg
tacgcgaaac tgccggaaga atcactggat gtcgacgtgg cagctgattt ttatggctcg
cagggtacct tcgacctgtg tcagaaacat gtgaaagcac aaggcattct gctgccggtt
ggtctgcaag atccgaaaat cacctttgac ctgaaccacc tggcgttccg cgaatacacg
attatcggca atttttgggg taccagtcag gatcaaacgg aagttttcga actggtcaaa
aaaggtctgg tgaccccgca ggttgaaacc acgtcctggc tgaacgtgaa taaagttctg
aaagacctgg acgaaggcaa aatcaaatct cgcatggtgc tggtgcataa cgaagacaac
tagtaa。
further, the amino acid sequence shown in SEQ ID No.2 is:
Met Ala Glu Ile Pro Glu Lys Gln Thr Ala Phe Val Phe Lys Asn Gly
Ser Phe Ala Leu Glu Lys Lys Glu Ile Glu Val Pro Lys Pro Asp Ala
Gly Lys Val Leu Leu Lys Val Ala Ala Ala Gly Val Cys His Ser Asp
Leu His Val Leu His Gly Gly Leu Pro Tyr Pro Asp Gly Leu Ile Leu
Gly His Glu Ile Ala Gly His Ile Val Ala Tyr Gly Asp Gly Val Asp
Lys Ala Ala Phe Pro Ser Asp Ala Leu Tyr Ala Val Val Gly Pro Asn
Pro Cys Gly Met Cys Lys AlaCys Arg Thr Gly Ala Asp Asn Val Cys
Glu Asp Pro Ser Arg Thr His Met Gly Leu Gly Ser Pro Gly Gly Tyr
Glu Gln Tyr Thr Gln Val Ser Ala Arg Asn Ile Thr Lys Val Pro Glu
Gly Ile Pro Ala Ala Val Ala Ala Ala Ser Thr Asp Ala Val Leu Thr
Pro Tyr His Ala Leu Lys Arg Ala Gly Ile Asn Gly Met Thr Arg Leu
Leu Ile Val Gly Leu Gly Gly Leu Gly Ile Asn Ala Val Gln Ile Ala
Lys Ala Phe Gly Ser Tyr Val Ile Ala Val Asp Pro Lys Glu Ser Ser
Arg Asp Leu Ala Lys Gln Tyr Gly Ala Asn Glu Val Tyr Ala Lys Leu
Pro Glu Glu Ser Leu Asp Val Asp Val Ala Ala Asp Phe Tyr Gly Ser
Gln Gly Thr Phe Asp Leu Cys Gln Lys His Val Lys Ala Gln Gly Ile
Leu Leu Pro Val Gly Leu Gln Asp Pro Lys Ile Thr Phe Asp Leu Asn
His Leu Ala Phe Arg Glu Tyr Thr Ile Ile Gly Asn Phe Trp Gly Thr
Ser Gln Asp Gln Thr Glu Val Phe Glu Leu Val Lys Lys Gly Leu Val
Thr Pro Gln Val Glu Thr Thr Ser Trp Leu Asn Val Asn Lys Val Leu
Lys Asp Leu Asp Glu Gly Lys Ile Lys Ser Arg Met Val Leu Val His
Asn Glu Asp Asn。
as a still further scheme of the invention: the ketoreductase is an escherichia coli expression product, and the host cell is E.coli, BL21(DE3), and the E.coli, BL21(DE3) is purchased from Beijing Quanjin Biotechnology Co., Ltd.
As a still further scheme of the invention: the reaction temperature of the catalytic reaction is 20 to 50 ℃, preferably 30 ℃.
As a still further scheme of the invention: the concentration of the coenzyme in the reaction system is 0.003-1 g/L.
Preferably, the concentration of the coenzyme in the reaction system is 0.1 g/L.
As a still further scheme of the invention: the coenzyme is NAD (nicotinamide adenine dinucleotide) or NADP (nicotinamide adenine dinucleotide phosphate).
As a still further scheme of the invention: the hydrogen donor in the catalytic reaction is Isopropanol (IPA), 1, 3-butanediol, ethanol, 2-butanol, 2, 3-butanediol and the like.
As a still further scheme of the invention: the buffer solution is 0.1mol/L PBS buffer solution (i.e. phosphate buffered saline solution), and the pH range of the PBS buffer solution is 7-9, and the pH value is 7 more preferably.
As a still further scheme of the invention: the ketoreductase used in the reaction system is coliphage, cell disruption supernatant or enzyme powder for expressing the ketoreductase.
As a still further scheme of the invention: the method for catalytically synthesizing the R-3- (2-chloro-1-hydroxyethyl) phenol adopts two reaction coupling modes, uses cheaper coenzyme NAD as a hydrogen electron carrier, and uses isopropanol as a hydrogen donor, thereby realizing the cyclic utilization of NAD.
Another object of the embodiments of the present invention is to provide a phenylephrine intermediate prepared by the above method for catalytic synthesis of R-3- (2-chloro-1-hydroxyethyl) phenol.
Preferably, the phenylephrine intermediate is R-3- (2-chloro-1-hydroxyethyl) phenol.
It is another object of embodiments of the present invention to provide phenylephrine prepared from the above-described R-3- (2-chloro-1-hydroxyethyl) phenol.
It is another object of embodiments of the present invention to provide eye drops, which partially contain phenylephrine as described above.
Compared with the prior art, the invention has the beneficial effects that:
the method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol provided by the embodiment of the invention adopts ketoreductase to carry out enzyme catalysis synthesis on phenylephrine intermediate R-3- (2-chloro-1-hydroxyethyl) phenol, can efficiently synthesize the phenylephrine intermediate by only one step of reaction, directly solves the chiral problem in the phenylephrine synthesis process, simultaneously uses few reagents and greatly simplifies the synthesis steps, the ketoreductase prepared by the embodiment of the invention has extremely high activity and stereoselectivity, the conversion rate can reach more than 99 percent, the chiral selectivity can reach more than 99.7 percent, is suitable for a plurality of production scenes, and solves the problem of complicated steps of the existing R-3- (2-chloro-1-hydroxyethyl) phenol synthesis method, moreover, the reaction condition is mild, the optical purity is high, the operation is simple and convenient, and the method is green and environment-friendly.
Detailed Description
The present invention will be described in further detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that variations and modifications can be made by persons skilled in the art without departing from the spirit of the invention. All falling within the scope of the present invention.
Example 1
An Escherichia coli for expressing ketoreductase, wherein the ketoreductase is a reductase encoded by a ketoreductase gene, the amino acid sequence of the ketoreductase is shown as SEQ ID No.2, and the nucleotide sequence of the ketoreductase gene is shown as SEQ ID No. 1.
Specifically, the construction and culture method of the escherichia coli for expressing ketoreductase comprises the following steps:
1) carrying out double digestion on the artificially synthesized ketoreductase gene DNA fragment for 8h at 37 ℃ by using restriction enzyme NdeI and restriction enzyme EcoRI, purifying by agarose gel electrophoresis, and recovering a target fragment by using an agarose gel DNA recovery kit;
2) connecting the target fragment with plasmid pET24a which is cut by restriction enzymes NdeI and EcoRI under the action of T4DNA ligase at 25 ℃, staying overnight, and transforming the connection product to obtain recombinant escherichia coli;
3) inoculating recombinant Escherichia coli into a culture dish containing 30mg/L chloramphenicol resistant LB solid culture medium, culturing at 37 ℃ for 20h, selecting a single colony, inoculating the single colony into 50mL chloramphenicol resistant LB liquid culture medium, performing shaking culture for 20h, transferring a bacterial solution after the culture is finished, culturing in 250mL TB liquid culture medium for 2.5h, diluting the bacterial solution to detect that the OD value is 0.7, adding 0.1mmol/L IPTG (isopropyl-beta-thiogalactoside) to induce protein expression, performing shaking culture at 30 ℃ for 18h, and centrifuging at 8000rpm to collect bacteria.
Example 2
The bacterial cells prepared in example 1 were reconstituted with 0.1mol/L PBS buffer (pH 7.0), homogenized and disrupted, and enzyme supernatant was collected by centrifugation and freeze-dried to obtain ketoreductase (enzyme powder), wherein the PBS buffer was added in the following amounts by weight: PBS buffer 1: 5 was added.
Example 3
The ketoreductase prepared in the example 2 is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, and specifically, the method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol comprises the following steps: taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking the ketoreductase prepared in the embodiment 2 as a catalyst, adding a hydrogen donor, a buffer solution and coenzyme NAD to form a reaction system, and carrying out catalytic reaction in a reaction bottle, specifically, adding magnetons into the reaction bottle, placing the reaction bottle on a reactor preheated to 30 ℃ in advance, regulating the rotation speed of the reactor to 400rpm, carrying out stirring reaction, and adding 5mL of acetonitrile to terminate the reaction after 24 hours, thereby obtaining a reaction solution.
In an embodiment of the invention, the phenylephrine intermediate is R-3- (2-chloro-1-hydroxyethyl) phenol.
In the present example, the total volume of the catalytic system was 5mL, in the catalytic system, the coenzyme NAD was 0.5mL of 1g/L coenzyme NAD (i.e. the final concentration of coenzyme NAD in the final catalytic system was 0.1g/L), the hydrogen donor was 2.5mL of isopropanol, the amount of 2-chloro-1- (3-hydroxyphenyl) ethanone added was 2g (concentration was 400g/L), and finally the system was made up with 0.1mol/L PBS buffer (pH 7).
In the examples of the present invention, the reaction conditions of the catalytic reaction are: the reaction was carried out at 30 ℃ and 400rpm with magnetic stirring for 24 hours.
Example 4
R-3- (2-chloro-1-hydroxyethyl) phenol was synthesized in the same manner as in example 3, wherein ketoreductase prepared in example 2 was used as a catalyst in amounts of 0.05g, 0.09g and 0.125g, respectively, i.e., 0.05g, 0.09g and 0.125g, and the reaction solutions obtained by 0.05g of the reaction group, 0.09g of the reaction group and 0.125g of the reaction group were diluted with 50% acetonitrile (v/v), respectively, and then subjected to HPLC analysis, wherein the results of the HPLC analysis are shown in Table 1, wherein the conditions of the HPLC analysis are that the apparatus type is Agilent1100, the column is ZOAX RBSB-C18 (specification 4.6. sup. 4.6 × 150mm, particle size 5 μm), the column temperature is 45 ℃, the detection wavelength is 215nm, the mobile phase A is 0.4% perchloric acid, the mobile phase B is Acetonitrile (ACN), and the mobile phase A: 80% by mass (flow rate B: 2.5 min), the retention time is 2.5mL of the reaction product, and the retention time is 2.5 mL.
TABLE 1 HPLC TEST ANALYSIS RESULT TABLE
| Ketoreductase Mass | Conversion rate | Chiral/% ee |
| 0.05g | 40.1％ | 99.74 |
| 0.09g | 75.2％ | 99.72 |
| 0.125g | 99.4％ | 99.77 |
According to the data in the table 1, the ketoreductase prepared in the embodiment of the invention is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, the conversion rate can reach more than 99%, the chiral selectivity can reach more than 99.7%, the whole reaction only needs one-step synthesis, the used reagents are few, the complicated steps of synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol by adopting a chemical process are greatly simplified, and the method is a more economic and environment-friendly synthesis method.
Example 5
The ketoreductase prepared in the example 2 is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, and specifically, the method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol comprises the following steps: taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, adding a ketoreductase prepared in example 2 as a catalyst, adding a hydrogen donor, a buffer solution and coenzyme NAD to form a reaction system, placing the reaction system in a reaction bottle for catalytic reaction, specifically, adding magnetons into the reaction bottle, placing the reaction bottle on a reactor preheated to 30 ℃, adjusting the rotation speed of the reactor to 400rpm, stirring for reaction, adding 5mL of acetonitrile after 24 hours to terminate the reaction, obtaining a reaction solution, and extracting the reaction solution to obtain the R-3- (2-chloro-1-hydroxyethyl) phenol; wherein the total volume of the catalytic system is 5mL, in the catalytic system, the hydrogen donor is 2.5mL of isopropanol, the addition amount of the 2-chloro-1- (3-hydroxyphenyl) ethanone is 2g (the concentration is 400g/L), the addition amount of the ketoreductase is 0.05g, and finally the system is supplemented with 0.1mol/L of PBS buffer (pH 7).
In the present example, the final concentrations of coenzyme NAD in the reaction system were four groups of 0.003g/L, 0.1g/L, 0.5g/L and 1g/L, and after completion of the reaction, the reaction solutions obtained from the 0.003g/L reaction group, the 0.1g/L reaction group, the 0.5g/L reaction group and the 1g/L reaction group were diluted with 50% acetonitrile (v/v), respectively, and subjected to HPLC assay, the specific results of which are shown in table 2, wherein the conditions of the HPLC assay were Agilent1100, column ZORBAX SB-C18 (specification 4.6 × 150mm, particle size 5 μm), column temperature 45 ℃, assay wavelength 215nm, mobile phase a was 0.4% perchloric acid, mobile phase B was Acetonitrile (ACN), and mobile phase a: mobile phase B: 80% (mass): 20% (mass), flow rate 2mL/min, retention time of the reaction product was 2.6min, and retention time of the substrate was 3.5 min.
TABLE 2 coenzyme concentration optimization results table
| Concentration of coenzyme | 24 hours conversion/%) |
| 0.003g/L | 38.9 |
| 0.1g/L | 41.5 |
| 0.5g/L | 40.7 |
| 1g/L | 42.1 |
As can be seen from the data in Table 2, increasing the coenzyme concentration based on the coenzyme concentration of 0.1g/L does not significantly contribute to the increase of the reaction rate, and the amount of the coenzyme of 0.1g/L is the optimal condition in terms of the enzyme catalysis rate and the cost.
Example 6
The ketoreductase prepared in the example 2 is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, and specifically, the method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol comprises the following steps: taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking the ketoreductase prepared in the embodiment 2 as a catalyst, adding a hydrogen donor, a buffer solution and coenzyme NAD to form a reaction system, and carrying out catalytic reaction in a reaction bottle, specifically, adding magnetons into the reaction bottle, placing the reaction bottle on a reactor preheated to 30 ℃ in advance, regulating the rotation speed of the reactor to 400rpm, carrying out stirring reaction, and adding 5mL of acetonitrile to terminate the reaction after 24 hours to obtain a reaction solution; wherein the total volume of the catalytic system is 5mL, in the catalytic system, the hydrogen donor is 2.5mL of isopropanol, the addition amount of the 2-chloro-1- (3-hydroxyphenyl) ethanone is 2g (the concentration is 400g/L), the addition amount of the ketoreductase is 0.05g, the final concentration of the coenzyme NAD in the reaction system is 0.1g/L, and finally the system is supplemented with 0.1mol/L of PBS buffer solution.
In the present example, the PBS buffer solution was pH 6, pH 7, pH 8, pH 9 and pH 10, and after completion of the reaction, the reaction solutions obtained in the pH 6 reaction group, the pH 7 reaction group, the pH 8 reaction group, the pH 9 reaction group and the pH 10 reaction group were diluted with 50% acetonitrile (v/v), respectively, and then subjected to HPLC assay, and the results of the HPLC assay are shown in table 3, wherein the conditions of the HPLC assay were Agilent1100 as the instrument model, zoax rbax SB-C18 (specification 4.6 × 150mm, particle size 5 μm), column temperature 45 ℃, detection wavelength 215nm, mobile phase a was 0.4% perchloric acid, mobile phase B was Acetonitrile (ACN), and mobile phase a: mobile phase B: 20% by mass (2 mL/min), retention time of the product was 3.5% by mass, retention time of the substrate was 3.5.
Table 3 buffer pH optimization results table
| Buffer pH | 24 hours conversion/%) |
| 6 | 32.5 |
| 7 | 42.7 |
| 8 | 39.4 |
| 9 | 34.3 |
| 10 | 30.3 |
From the data in Table 3, the enzyme catalysis rate was the fastest at a buffer pH of 7.
Example 7
The ketoreductase prepared in the example 2 is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, and specifically, the method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol comprises the following steps: taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking the ketoreductase prepared in the embodiment 2 as a catalyst, adding a hydrogen donor, a buffer solution and coenzyme NADP to form a reaction system, placing the reaction system in a reaction bottle for catalytic reaction, specifically, adding magnetons into the reaction bottle, placing the reaction bottle on a reactor preheated to 50 ℃, adjusting the rotation speed of the reactor to 400rpm, stirring for reaction, and adding 5mL of acetonitrile for terminating the reaction after 24 hours to obtain a reaction solution; wherein the total volume of the catalytic system is 5mL, in the catalytic system, the adding amount of the 2-chloro-1- (3-hydroxyphenyl) ethanone is 0.05g (the concentration is 10g/L), the adding amount of the ketoreductase is 0.1g, the final concentration of the coenzyme NADP in the reaction system is 0.003g/L, the hydrogen donor is 1, 3-butanediol, the adding amount of the 1, 3-butanediol is 2.5mL, and after the reaction is completed, the system is finally complemented with 0.1mol/L PBS buffer solution (pH 7).
In the present example, the obtained reaction solution was diluted with 50% acetonitrile (v/v) and subjected to HPLC analysis under conditions of an apparatus model of Agilent1100, a column of ZORBAX SB-C18 (Specification 4.6 × 150mm, particle size 5 μm), column temperature 45 ℃, detection wavelength 215nm, mobile phase A of 0.4% perchloric acid, mobile phase B of Acetonitrile (ACN), and mobile phase A of 80% mobile phase B of 20% by mass, flow rate 2mL/min, retention time of the reaction product of 2.6min, and retention time of the substrate of 5.3min, and the conversion rate was 99.2% at 24 hours of the reaction.
Example 8
The ketoreductase prepared in the example 2 is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, and the specific method comprises the following steps:
taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, adding a hydrogen donor, a buffer solution and coenzyme NAD (nicotinamide adenine dinucleotide) as a catalyst to form a reaction system, and performing catalytic reaction in a reaction bottle, specifically, preparing a plurality of reaction bottles, respectively adding magnetons into the reaction bottles, placing the reaction bottles on a preheated reactor with the temperature of 20 ℃, 30 ℃, 40 ℃ and 50 ℃, adjusting the rotation speed of the reactor to 400rpm, stirring for reaction, and adding 5mL of acetonitrile for 24 hours to terminate the reaction to obtain a reaction solution.
In the present example, the total volume of the catalytic system was 5mL, in the catalytic system, the coenzyme NAD was 0.5mL of 1g/L coenzyme NAD (i.e. the final concentration of the coenzyme NAD in the final catalytic system was 0.1g/L), the hydrogen donor was 2.5mL of isopropanol, the amount of 2-chloro-1- (3-hydroxyphenyl) ethanone added was 0.05g (concentration was 10g/L), and finally the system was made up with 0.1mol/L PBS buffer (pH 7).
In the examples of the present invention, the reaction conditions of the catalytic reaction are: the temperature is 20 ℃, 30 ℃, 40 ℃, 50 ℃ and 400rpm respectively, and the reaction is carried out for 24 hours by magnetic stirring.
In the present example, the obtained reaction solution was diluted with 50% acetonitrile (v/v) and subjected to HPLC analysis under conditions of an apparatus model of Agilent1100, a column of ZORBAX SB-C18 (size: 5 μm, size: 4.6 × 150 mm), a column temperature of 45 ℃, a detection wavelength of 215nm, a mobile phase A of 0.4% perchloric acid, a mobile phase B of Acetonitrile (ACN), a mobile phase A of 80% mobile phase B of 20% by mass, a flow rate of 2mL/min, a retention time of the reaction product of 2.44min, and a retention time of the substrate of 3.70min, and specific results of the HPLC analysis are shown in Table 4.
TABLE 4 reaction results at different temperatures
| Reaction temperature | Conversion rate of 24 hours |
| 20℃ | 98.2％ |
| 30℃ | 99.4％ |
| 40℃ | 99.1％ |
| 50℃ | 98.2％ |
Example 9
The ketoreductase prepared in the example 2 is used as a catalyst to catalyze and synthesize R-3- (2-chloro-1-hydroxyethyl) phenol, and the specific method comprises the following steps:
taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking the ketoreductase prepared in example 2 as a catalyst, respectively adding a hydrogen donor (the hydrogen donor can be respectively one of ethanol, isopropanol, 2-butanol, 1, 3-butanediol and 2, 3-butanediol), a buffer solution and coenzyme NAD to form a reaction system, and carrying out catalytic reaction in a reaction bottle, specifically, adding a magneton into the reaction bottle, placing the reaction bottle on a reactor preheated to 30 ℃, adjusting the rotation speed of the reactor to 400rpm, stirring for reaction, and adding 5mL of acetonitrile after 24 hours to terminate the reaction to obtain a reaction solution.
In the present example, the total volume of the catalytic system was 5mL, in the catalytic system, the coenzyme NAD was 0.5mL of 1g/L coenzyme NAD (i.e. the final concentration of the coenzyme NAD in the final catalytic system was 0.1g/L), the amount of the 2-chloro-1- (3-hydroxyphenyl) ethanone added was 0.05g (the concentration was 10g/L), and finally the system was made up with 0.1mol/L PBS buffer (pH 7).
In the examples of the present invention, the reaction conditions of the catalytic reaction are: the reaction was carried out at 30 ℃ and 400rpm with magnetic stirring for 24 hours.
In the present example, the obtained reaction solution was diluted with 50% acetonitrile (v/v) and subjected to HPLC analysis, the specific results of which are shown in Table 5, wherein the conditions of the HPLC analysis were that the model of the apparatus was Agilent1100, the column was ZORBAX SB-C18 (size 4.6 × 150mm, particle size 5 μm), the column temperature was 45 ℃, the detection wavelength was 215nm, the mobile phase A was 0.4% perchloric acid, the mobile phase B was Acetonitrile (ACN), and the mobile phase A was 80% (by mass) of the mobile phase B, the flow rate was 2mL/min, the retention time of the reaction product was 2.44min, and the retention time of the substrate was 3.70 min.
TABLE 5 results of different hydrogen donor reactions
| Hydrogen donor | Conversion rate of 24 hours |
| Ethanol | 72.3％ |
| Isopropanol (I-propanol) | 99.8％ |
| 2-Butanol | 99.2％ |
| 1, 3-butanediol | 99.2％ |
| 2, 3-butanediol | 99.6％ |
Example 10
The ketoreductase prepared in example 2 is used as a catalyst to catalytically synthesize phenylephrine intermediates, and specifically, the method for catalytically synthesizing phenylephrine intermediates comprises the following steps:
taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking the ketoreductase prepared in example 2 as a catalyst, adding a hydrogen donor (IPA (circulating through self-ketoreductase), glucose (circulating through GDH), ammonium formate (circulating through FDH), a buffer solution, coenzyme NAD and self-ketoreductase, GDH and FDH respectively as circulating enzymes to form a reaction system, carrying out catalytic reaction in a reaction bottle, specifically, adding a magneton into the reaction bottle, placing the reaction bottle on a reactor preheated to 30 ℃, adjusting the rotation speed of the reactor to 400rpm, carrying out stirring reaction, adding 5mL of acetonitrile after 24 hours to terminate the reaction, obtaining a reaction solution, wherein the total volume of the catalytic system is 5mL, the adding amount of the 2-chloro-1- (3-hydroxyphenyl) ethanone in the catalytic system is 0.05g (the concentration is 10g/L), the ketoreductase was added in an amount of 0.1g, the final concentration of the coenzyme NAD in the reaction system was 0.003g/L, the hydrogen donor isopropanol was 2.5mL, the hydrogen donor glucose was added in an amount of 0.2g (4 times substrate equivalent), the hydrogen donor ammonium formate was added in an amount of 0.037g (2 times substrate equivalent), the recycling enzyme GDH was added in an amount of 0.5g/L, the recycling enzyme FDH was added in an amount of 0.5g/L, and finally the system was supplemented with 0.1mol/L of PBS buffer (pH 7).
In the present example, the obtained reaction solution was diluted with 50% acetonitrile (v/v) and subjected to HPLC analysis under conditions of an apparatus model of Agilent1100, a column of ZORBAX SB-C18 (size: 5 μm, size: 4.6 × 150 mm), a column temperature of 45 ℃, a detection wavelength of 215nm, a mobile phase A of 0.4% perchloric acid, a mobile phase B of Acetonitrile (ACN), a mobile phase A of 80% mobile phase B of 20% by mass, a flow rate of 2mL/min, a retention time of the reaction product of 2.44min, and a retention time of the substrate of 3.70min, and specific results of the HPLC analysis are shown in Table 6.
TABLE 6 results for different recycle systems
| Coenzyme circulation system | Conversion rate of 24 hours |
| Self ketoreductase cycling systems | 99.2％ |
| GDH cycling System | 99.4％ |
| FDH circulation system | 99.4％ |
From the results, the ketoreductase prepared by the embodiment of the invention has extremely high activity and stereoselectivity, is a ketoreductase with industrial potential, is used for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol by enzyme catalysis, has mild reaction conditions, high optical purity, simple and convenient operation, is green and environment-friendly, and is a method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol with extreme competitiveness in the future; moreover, the single reaction substrate feeding amount can be more than 400g/L, the conversion rate can be more than 99%, the chiral selectivity can be more than 99.7%, the ketoreductase used in the reaction has excellent performances of high temperature resistance, high organic resistance and the like, the method is suitable for multiple production scenes, the whole reaction only needs one-step synthesis, the used reagents are few, and the complicated steps of synthesizing the R-3- (2-chloro-1-hydroxyethyl) phenol by adopting a chemical process are greatly simplified.
While the preferred embodiments of the present invention have been described in detail, the present invention is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present invention within the knowledge of those skilled in the art. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the scope of the invention.
Sequence listing
<110> Ningbo Saise bioengineering Co., Ltd
<120> method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine, and eye drops
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>1026
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggcagaaa tcccggaaaa acagacggcg ttcgtgttca aaaatggctc gttcgcactg 60
gaaaaaaaag aaatcgaagt cccgaaaccg gatgccggca aagtcctgct gaaagtggcg 120
gccgcaggtg tttgtcatag cgatctgcat gtcctgcacg gcggtctgcc gtatccggac 180
ggcctgattc tgggtcatga aattgcaggc cacatcgtcg cttatggcga tggtgtggac 240
aaagctgcgt ttccgtctga tgcactgtac gctgtggttg gcccgaaccc gtgcggcatg 300
tgtaaagcgt gccgtaccgg tgccgataat gtgtgcgaag acccgagtcg tacgcacatg 360
ggcctgggtt ccccgggcgg ttatgaacag tacacccaag tgagcgcgcg taacattacg 420
aaagttccgg aaggtatccc ggccgcagtc gctgcggcct ctaccgatgc cgttctgacg 480
ccgtatcacg cgctgaaacg tgccggcatt aacggtatga cccgtctgct gatcgtgggc 540
ctgggcggtc tgggtattaa tgccgttcag atcgcgaaag ccttcggcag ctacgttatc 600
gcagtcgatc cgaaagaaag ctctcgtgac ctggcaaaac agtatggtgc taatgaagtg 660
tacgcgaaac tgccggaaga atcactggat gtcgacgtgg cagctgattt ttatggctcg 720
cagggtacct tcgacctgtg tcagaaacat gtgaaagcac aaggcattct gctgccggtt 780
ggtctgcaag atccgaaaat cacctttgac ctgaaccacc tggcgttccg cgaatacacg 840
attatcggca atttttgggg taccagtcag gatcaaacggaagttttcga actggtcaaa 900
aaaggtctgg tgaccccgca ggttgaaacc acgtcctggc tgaacgtgaa taaagttctg 960
aaagacctgg acgaaggcaa aatcaaatct cgcatggtgc tggtgcataa cgaagacaac 1020
tagtaa 1026
<210>2
<211>340
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>2
Met Ala Glu Ile Pro Glu Lys Gln Thr Ala Phe Val Phe Lys Asn Gly
1 5 10 15
Ser Phe Ala Leu Glu Lys Lys Glu Ile Glu Val Pro Lys Pro Asp Ala
20 25 30
Gly Lys Val Leu Leu Lys Val Ala Ala Ala Gly Val Cys His Ser Asp
35 40 45
Leu His Val Leu His Gly Gly Leu Pro Tyr Pro Asp Gly Leu Ile Leu
50 55 60
Gly His Glu Ile Ala Gly His Ile Val Ala Tyr Gly Asp Gly Val Asp
65 70 75 80
Lys Ala Ala Phe Pro Ser Asp Ala Leu Tyr Ala Val Val Gly Pro Asn
85 90 95
Pro Cys Gly Met Cys Lys Ala Cys Arg Thr Gly Ala Asp Asn Val Cys
100 105 110
Glu Asp Pro Ser Arg Thr His Met Gly Leu Gly Ser Pro Gly Gly Tyr
115 120 125
Glu Gln Tyr Thr Gln Val Ser Ala Arg Asn Ile Thr Lys Val Pro Glu
130 135 140
Gly Ile Pro Ala Ala Val Ala Ala Ala Ser Thr Asp Ala Val Leu Thr
145 150 155 160
Pro Tyr His Ala Leu Lys Arg Ala Gly Ile Asn Gly Met Thr Arg Leu
165 170 175
Leu Ile Val Gly Leu Gly Gly Leu Gly Ile Asn Ala Val Gln Ile Ala
180 185 190
Lys Ala Phe Gly Ser Tyr Val Ile Ala Val Asp Pro Lys Glu Ser Ser
195 200 205
Arg Asp Leu Ala Lys Gln Tyr Gly Ala Asn Glu Val Tyr Ala Lys Leu
210 215 220
Pro Glu Glu Ser Leu Asp Val Asp Val Ala Ala Asp Phe Tyr Gly Ser
225 230 235 240
Gln Gly Thr Phe Asp Leu Cys Gln Lys His Val Lys Ala Gln Gly Ile
245 250 255
Leu Leu Pro Val Gly Leu Gln Asp Pro Lys Ile Thr Phe Asp Leu Asn
260 265 270
His Leu Ala Phe Arg Glu Tyr Thr Ile Ile Gly Asn Phe Trp Gly Thr
275 280 285
Ser Gln Asp Gln Thr Glu Val Phe Glu Leu Val Lys Lys Gly Leu Val
290 295 300
Thr Pro Gln Val Glu Thr Thr Ser Trp Leu Asn Val Asn Lys Val Leu
305 310 315 320
Lys Asp Leu Asp Glu Gly Lys Ile Lys Ser Arg Met Val Leu Val His
325 330 335
Asn Glu Asp Asn
340
Claims (10)
1. A method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol is characterized by comprising the following steps: taking 2-chloro-1- (3-hydroxyphenyl) ethanone as a substrate, taking ketoreductase as a catalyst, adding a hydrogen donor, a buffer solution and coenzyme to form a reaction system for catalytic reaction, and extracting a reaction solution after the reaction is completed to obtain the R-3- (2-chloro-1-hydroxyethyl) phenol.
2. The method of catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol according to claim 1, wherein the ketoreductase is a reductase encoded by a ketoreductase gene;
wherein the nucleotide sequence of the ketoreductase gene is shown as SEQ ID No.1, and the amino acid sequence of the ketoreductase gene is shown as SEQ ID No. 2.
3. The method for the catalytic synthesis of R-3- (2-chloro-1-hydroxyethyl) phenol according to claim 1, wherein the reaction temperature of the catalytic reaction is 20-50 ℃.
4. The method for catalytically synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol according to claim 1, wherein the concentration of the coenzyme in the reaction system is 0.003 to 1 g/L.
5. The method of claim 1, wherein the coenzyme is nicotinamide adenine dinucleotide or nicotinamide adenine dinucleotide phosphate.
6. The method for catalytic synthesis of R-3- (2-chloro-1-hydroxyethyl) phenol according to claim 1, wherein the hydrogen donor is any one of isopropanol, 1, 3-butanediol, ethanol, 2-butanol or 2, 3-butanediol,
in the coenzyme circulation system, the enzyme may be ketoreductase itself or another coenzyme circulation system, and GDH, FDH and hydrogen donors corresponding thereto may be used.
7. The method for the catalytic synthesis of R-3- (2-chloro-1-hydroxyethyl) phenol according to claim 1, wherein the pH of the buffer is in the range of 7 to 9.
8. R-3- (2-chloro-1-hydroxyethyl) phenol prepared by the catalytic synthesis method of R-3- (2-chloro-1-hydroxyethyl) phenol according to any one of claims 1 to 7.
9. Phenylephrine made from the R-3- (2-chloro-1-hydroxyethyl) phenol of claim 8.
10. An eye drop characterized in that it comprises, in part, phenylephrine according to claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010263927.XA CN111378695B (en) | 2020-04-07 | 2020-04-07 | Method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010263927.XA CN111378695B (en) | 2020-04-07 | 2020-04-07 | Method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111378695A true CN111378695A (en) | 2020-07-07 |
| CN111378695B CN111378695B (en) | 2023-07-28 |
Family
ID=71220084
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010263927.XA Active CN111378695B (en) | 2020-04-07 | 2020-04-07 | Method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111378695B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112225665A (en) * | 2020-10-28 | 2021-01-15 | 合肥亿帆生物制药有限公司 | Preparation method of noradrenaline bitartrate |
| CN113337546A (en) * | 2021-06-04 | 2021-09-03 | 上海启讯医药科技有限公司 | Preparation method of (S) -1,2, 4-butanetriol |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080318295A1 (en) * | 2007-02-08 | 2008-12-25 | Codexis, Inc. | Ketoreductases and Uses Thereof |
| CN102482648A (en) * | 2009-06-22 | 2012-05-30 | 科德克希思公司 | Ketoreductase-mediated stereoselective route to alpha chloroalcohols |
| CN102776251A (en) * | 2012-08-21 | 2012-11-14 | 尚科生物医药（上海）有限公司 | Preparation method of phenylephrine |
| US20180002676A1 (en) * | 2015-02-10 | 2018-01-04 | Codexis, Inc. | Ketoreductase polypeptides for the synthesis of chiral compounds |
| CN109576312A (en) * | 2017-09-29 | 2019-04-05 | 尚科生物医药（上海）有限公司 | A method of preparing the chloro- 1-(3- hydroxy phenyl of (R) -2-) ethyl alcohol |
-
2020
- 2020-04-07 CN CN202010263927.XA patent/CN111378695B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080318295A1 (en) * | 2007-02-08 | 2008-12-25 | Codexis, Inc. | Ketoreductases and Uses Thereof |
| CN102482648A (en) * | 2009-06-22 | 2012-05-30 | 科德克希思公司 | Ketoreductase-mediated stereoselective route to alpha chloroalcohols |
| CN102776251A (en) * | 2012-08-21 | 2012-11-14 | 尚科生物医药（上海）有限公司 | Preparation method of phenylephrine |
| US20180002676A1 (en) * | 2015-02-10 | 2018-01-04 | Codexis, Inc. | Ketoreductase polypeptides for the synthesis of chiral compounds |
| CN109576312A (en) * | 2017-09-29 | 2019-04-05 | 尚科生物医药（上海）有限公司 | A method of preparing the chloro- 1-(3- hydroxy phenyl of (R) -2-) ethyl alcohol |
Non-Patent Citations (2)
| Title |
|---|
| KEIKO YAMADA-ONODERA等: "Cloning, sequence analysis, and expression in Escherichia coli of gene encoding N-Benzyl-3-pyrrolidinol dehydrogenase from Geotrichum capitatum"，Keiko Yamada-Onodera等，《Journal of Bioscience and Bioengineering", vol. 104, no. 104, pages 379 - 384 * |
| KEIKO YAMADA-ONODERA等: "Purification and characterization of alcohol dehydrogenase reducing N-benzyl-3-pyrrolidinone from Geotrichum capitatum", 《J BIOSCI BIOENG》, vol. 103, no. 2, pages 174 - 178, XP005939370, DOI: 10.1263/jbb.103.174 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112225665A (en) * | 2020-10-28 | 2021-01-15 | 合肥亿帆生物制药有限公司 | Preparation method of noradrenaline bitartrate |
| CN113337546A (en) * | 2021-06-04 | 2021-09-03 | 上海启讯医药科技有限公司 | Preparation method of (S) -1,2, 4-butanetriol |
| CN113337546B (en) * | 2021-06-04 | 2023-09-12 | 上海启讯医药科技有限公司 | Preparation method of (S) -1,2, 4-butanetriol |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111378695B (en) | 2023-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107384892B (en) | Candida antarctica lipase B mutant, and transformation method and application thereof | |
| CN109735553B (en) | Preparation method of anti-AIDS drug atazanavir intermediate | |
| CN111378695B (en) | Method for synthesizing R-3- (2-chloro-1-hydroxyethyl) phenol, phenylephrine and eye drops | |
| CN108048416A (en) | Improved Ketoreductase mutant and its preparation method and application | |
| CN112143764B (en) | Method for preparing intermediate compound of brivaracetam by using biological enzyme catalysis | |
| CN110628841B (en) | Novel method for synthesizing key intermediate of dextromethorphan through enzyme catalysis asymmetry | |
| CN104152506A (en) | Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system | |
| CN109055324B (en) | Improved ketoreductase and application thereof | |
| CN112941115A (en) | Preparation method of ticagrelor chiral intermediate | |
| CN112662637A (en) | Formate dehydrogenase mutant and preparation method and application thereof | |
| CN113355367B (en) | Application of ketoacid reductase in synthesis of chiral aromatic 2-hydroxy acid | |
| CN109943542B (en) | Alcohol dehydrogenase for producing atazanavir intermediate | |
| CN109679978B (en) | Recombinant co-expression system for preparing L-2-aminobutyric acid and application thereof | |
| CN109706189B (en) | Preparation method of D-chiro-inositol | |
| CN113913399B (en) | Ketopantolactone reductase from Candida maltosa Xu316 | |
| CN114085820B (en) | Ketopantolactone reductase from Candida viswanathii | |
| CN114908129B (en) | Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| CN103966185A (en) | Double-enzyme system for efficiently synthesizing S-adenosylhomocysteine and application method thereof | |
| CN114891707A (en) | Recombinant strain and method for producing bilirubin through whole-cell catalysis of recombinant strain | |
| CN114426978A (en) | Recombinant engineering bacterium and construction method and application thereof | |
| CN111575334B (en) | Method for preparing (S) -2-chloro-1- (3, 4-difluorophenyl) ethanol | |
| CN114438052B (en) | Nicotinamide mononucleotide adenyltransferase mutant and application thereof | |
| CN114410619B (en) | Method for synthesizing (S) -N-Boc-hydroxy piperidine by immobilized biocatalyst | |
| CN112941124B (en) | Method for preparing irinotecan intermediate by whole cell catalysis | |
| CN114277013B (en) | NAD kinase mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |