CN111378657A

CN111378657A - siRNA for inhibiting COL1A1 gene expression, pharmaceutical composition containing siRNA and application thereof

Info

Publication number: CN111378657A
Application number: CN201811625527.8A
Authority: CN
Inventors: 张鸿雁; 高山; 康代武
Original assignee: Suzhou Ribo Life Science Co Ltd
Current assignee: Suzhou Ribo Life Science Co Ltd
Priority date: 2018-12-28
Filing date: 2018-12-28
Publication date: 2020-07-07
Anticipated expiration: 2038-12-28
Also published as: CN111378657B

Abstract

An siRNA for inhibiting expression of COL1A1 gene, comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are both 19 nucleotides in length, and the nucleotide sequence II is at least partially complementary with a sequence of 19 continuous nucleotides in the 800-. According to the direction from the 5 'end to the 3' end, the nucleotides at the 7 th, 8 th and 9 th positions of the nucleotide sequence I are fluorine modified nucleotides, and the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the nucleotide sequence II are fluorine modified nucleotides. The disclosure also provides pharmaceutical compositions comprising the siRNA. The siRNA and the pharmaceutical composition containing the siRNA can treat or improve diseases related to COL1A1 gene expression.

Description

siRNA for inhibiting COL1A1 gene expression, pharmaceutical composition containing siRNA and application thereof

Technical Field

The disclosure relates to a nucleic acid capable of inhibiting expression of COL1A1 gene and a pharmaceutical composition containing the nucleic acid, belonging to the field of nucleic acid pharmacy. The disclosure also relates to uses of these nucleic acids and pharmaceutical compositions.

Background

Hepatic fibrosis refers to excessive deposition of diffuse extracellular matrix (ECM) in liver, is a compensatory reaction in a tissue repair process after various forms of chronic liver injury, and is also a necessary pathological change process for the development of chronic liver diseases into serious fatal diseases such as liver cirrhosis, liver cancer and the like, so that hepatic fibrosis resistance becomes the important factor for treating chronic liver diseases.

The existing means for preventing and treating hepatic fibrosis are very limited, and mainly comprise two major aspects: firstly, pathogenic factors such as virus resistance, alcohol withdrawal and the like are removed aiming at the primary morbidity; the other is to treat hepatic fibrosis itself, for example, by inhibiting inflammation or lipid peroxidation, or inhibiting proliferation and activation of Hepatic Stellate Cells (HSC), and promoting collagen degradation. In clinical medicine, interferon is used to inhibit the activation of stellate cells and the expression of proliferation extracellular matrix, lamivudine is used to inhibit the replication of HBV DNA, and colchicine and silymarin are used to interfere with the collagen secretion of cells. However, the treatment effect of the medicines on hepatic fibrosis is not exact, the survival rate of hepatic fibrosis patients is not obviously improved, and the incidence rate of side effects is obviously increased.

The major collagen types in normal liver are CoLI and CoLIII, roughly in a 1:1 ratio. When liver cells are injured, one of the responses to cellular stress is to increase collagen expression and increase the amount of extracellular matrix synthesis to protect injured tissues. In hepatic fibrosis and cirrhosis, the expression of collagen is sharply increased, the collagen production amount is far higher than the natural enzymolysis speed, at the moment, the collagen can account for 50% of the total liver protein, the ratio of CoLI to CoLIII is increased, and the ratio can be increased to about 3 times in the later period.

The siRNA aiming at Col1- α is used for effectively inhibiting the expression level of mRNA, so that the generation of collagen and the accumulation in liver tissues can be reduced to a certain degree, thereby reducing the accumulation amount of the extracellular matrix, and further relieving and inhibiting the pathogenesis process of the hepatic fibrosis.

However, to date, the clinical application of siRNA drugs for treating diseases associated with the expression of the comli gene has been slow, and among them, poor activity of siRNA itself is one of the reasons for the slow progress of such drugs. Therefore, there is an urgent need to develop an siRNA and a pharmaceutical composition containing siRNA that have potential clinical application value, good stability and biological activity for treating diseases associated with the expression of the comli gene.

Disclosure of Invention

In some embodiments, the present disclosure provides an siRNA capable of inhibiting expression of COL1a1 gene, the siRNA comprising a sense strand and an antisense strand, each nucleotide of the sense strand and the antisense strand being independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide, wherein the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are both 19 nucleotides in length, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complementary to form a double-stranded region, the nucleotide sequence II is at least partially reverse-complementary to a first nucleotide sequence selected from a sequence of 19 consecutive nucleotides in the 800-th region of COL1a 352200 mRNA; the nucleotides at the 7 th, 8 th and 9 th positions of the nucleotide sequence I are fluorine-modified nucleotides according to the direction from the 5 'end to the 3' end; the first nucleotide at the 5 'end of the nucleotide sequence II is the first nucleotide at the 5' end of the antisense strand, and the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence II are fluoro-modified nucleotides.

In some embodiments, the present disclosure provides a pharmaceutical composition comprising an siRNA of the present disclosure and a pharmaceutically acceptable carrier.

In some embodiments, the present disclosure provides for the use of an siRNA and/or pharmaceutical composition of the present disclosure in the preparation of a medicament for treating or ameliorating a disease associated with COL1a1 gene expression.

In some embodiments, the present disclosure provides a kit comprising an siRNA and/or a pharmaceutical composition of the present disclosure.

Is incorporated by reference

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Advantageous effects

The siRNA and the pharmaceutical composition containing the siRNA provided by the disclosure have good stability, higher gene inhibition activity and very low off-target effect, and/or can significantly improve the level of hepatic fibrosis.

In some embodiments, the siRNA or pharmaceutical composition comprising the siRNA provided by the present disclosure has greater stability and/or greater activity. In some embodiments, the siRNA or pharmaceutical composition provided by the present disclosure exhibits a rate of inhibition of expression of the target gene of at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 85%.

In some embodiments, the sirnas provided by the present disclosure or pharmaceutical compositions comprising the sirnas do not exhibit significant off-target effects. The off-target effect can be, for example, inhibition of normal expression of a gene other than the target gene. It is believed that off-target effects are not significant if the binding/inhibition of off-target gene expression is less than 50%, 40%, 30%, 20% or 10% compared to the effect on the target gene.

In some embodiments, the sirnas provided by the present disclosure have good stability, and maintain consistent stability in vitro lysosomal lysates, human plasma, or monkey plasma.

Therefore, the siRNA or the pharmaceutical composition provided by the disclosure can inhibit the expression of the COL1A1 gene, effectively treat or improve diseases related to the expression of the COL1A1 gene, and has a good application prospect.

Additional features and advantages of the disclosure will be set forth in the detailed description which follows.

Detailed Description

The following describes in detail specific embodiments of the present disclosure. It should be understood that the detailed description and specific examples, while indicating the present disclosure, are given by way of illustration and explanation only, not limitation.

In the present disclosure, the COL1a1 gene, the comli gene, and the target gene all refer to mRNA sequences such as those shown in Genbank accession No. NM _ 000088.3.

Definition of

In the above and below, capital C, G, U, A represents the base composition of nucleotides, unless otherwise specified; the lower case letter m indicates that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lower case letter f indicates that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide; the lower case letter s indicates a phosphorothioate-based linkage between two nucleotides adjacent to the left and right of the letter s; p1 indicates that the nucleotide adjacent to the right of the P1 is a 5' -phosphate nucleotide or a 5' -phosphate analog modified nucleotide, the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate modified nucleotide, the letter combination Ps indicates that the nucleotide adjacent to the right of the letter combination Ps is a phosphorothioate modified nucleotide, and the capital letter P indicates that the nucleotide adjacent to the right of the letter P is a 5' -phosphate nucleotide.

In the above and below, the "fluorine-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2 '-position of the ribosyl group of the nucleotide is substituted with fluorine, and the "non-fluorine-modified nucleotide" refers to a nucleotide or a nucleotide analog in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorine group. "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Such as a heteronucleotide, a bridged nucleotide (BNA for short) or an acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide in which the 2' -hydroxyl group of the ribosyl group is substituted with a methoxy group.

In the present context, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning well known to the skilled person, i.e. in a double stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (a) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair comprises a purine and a pyrimidine. Two strands are considered to be complementary to each other when adenine on one strand always pairs with thymine (or uracil) on the other strand and guanine always pairs with cytosine, and the sequence of that strand can be deduced from the sequence of its complementary strand. Accordingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at the corresponding positions are not paired in a complementary fashion.

In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that no more than 1 base mismatch exists between two nucleotide sequences; "completely complementary" means that there is no base mismatch between two nucleotide sequences.

In the above and below, the "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the former has a change in the base type of the nucleotide at the same position as compared with the latter, for example, in the latter, when one nucleotide base is A, in the case where the corresponding nucleotide base at the same position of the former is U, C, G or T, it is considered that there is a nucleotide difference between the two nucleotide sequences at that position. In some embodiments, when a nucleotide in situ is replaced with a nucleotide without a base or its equivalent, it is also believed that a nucleotide difference is created at that position.

The term "subject", as used herein, refers to any animal, e.g., a mammal or a marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and any species of poultry.

As used herein, "treat," "alleviate," or "improve" may be used interchangeably herein. These terms refer to methods of achieving beneficial or desired results, including but not limited to therapeutic benefits. By "therapeutic benefit" is meant eradication or amelioration of the underlying disorder being treated. In addition, therapeutic benefit is achieved by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

As used herein, "prevent" and "prevention" are used interchangeably. These terms refer to methods of achieving beneficial or desired results, including but not limited to prophylactic benefits. To obtain a "prophylactic benefit," a composition can be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more pathological symptoms of a disease, even though a diagnosis of the disease may not have been made.

siRNA

The present disclosure provides an siRNA capable of inhibiting expression of COL1a1 gene.

The sirnas of the present disclosure contain a nucleotide group as a basic structural unit, which is well known to those skilled in the art, and the nucleotide group contains a phosphate group, a ribose group and a base, which are not described in detail herein.

The siRNA of the present disclosure comprises a sense strand and an antisense strand, each nucleotide of the sense strand and the antisense strand is independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide, wherein the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are both 19 nucleotides in length, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complementary to form a double-stranded region, the nucleotide sequence II is at least partially reverse-complementary to a first nucleotide sequence selected from a sequence of 19 consecutive nucleotides in the 800-2200 bit region of COL1A1 mRNA; the nucleotides at the 7 th, 8 th and 9 th positions of the nucleotide sequence I are fluorine-modified nucleotides according to the direction from the 5 'end to the 3' end; the first nucleotide at the 5 'end of the nucleotide sequence II is the first nucleotide at the 5' end of the antisense strand, and the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence II are fluoro-modified nucleotides.

In some embodiments, the first nucleotide sequence is selected from the group consisting of COL1A1mRNA sequence 810-828 consecutive nucleotides in length 19, defined as SEQ ID NO:2, and the nucleotide sequence set forth in SEQ ID NO:1 is the sequence fully reverse complementary to SEQ ID NO: 2. The modified siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the sense strand and the antisense strand is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide, the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially complementary reversely to form a double-stranded region, wherein the nucleotide sequence I is equal to the nucleotide sequence shown in SEQ ID NO. 1 in length and has NO more than 3 nucleotide differences, and the nucleotide sequence II is equal to the nucleotide sequence shown in SEQ ID NO. 2 in length and has NO more than 3 nucleotide differences:

5'-GAAUGGAGAUGAUGGGGAZa₁-3'(SEQ ID NO:1)；

5'-Zb₁UCCCCAUCAUCUCCAUUC-3'(SEQ ID NO:2)，

wherein, Za₁Is A, Zb₁Is a group of U, and the number of U,

the nucleotide sequence I comprises a position corresponding to Za₁Of nucleotide ZA₁The nucleotide sequence II comprises a position corresponding to Zb₁Nucleotide of (A) ZB₁Said ZB₁Is the first nucleotide at the 5' end of the antisense strand.

In the above and below, "positional correspondence" means that they are at the same position in the nucleotide sequence from the same end of the nucleotide sequence. For example, the 1 st nucleotide ZA at the 3' end of the nucleotide sequence I₁Is the 1 st nucleotide Za at the position corresponding to the 3' end of SEQ ID NO. 1₁The nucleotide of (a).

In some embodiments, the first nucleotide sequence is selected from the group consisting of COL1A1mRNA 1853-1871-th sequence of 19 consecutive nucleotides in length, defined as SEQ ID NO:4, and the nucleotide sequence set forth in SEQ ID NO:3 is the sequence fully reverse complementary to SEQ ID NO: 4. The modified siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the sense strand and the antisense strand is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide, the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially complementary reversely to form a double-stranded region, wherein the nucleotide sequence I is equal to the nucleotide sequence shown in SEQ ID NO. 3 in length and has NO more than 3 nucleotide differences, and the nucleotide sequence II is equal to the nucleotide sequence shown in SEQ ID NO. 4 in length and has NO more than 3 nucleotide differences:

5'-AGGCUGGUGUGAUGGGAUZa₂-3'(SEQ ID NO:3)；

5'-Zb₂AUCCCAUCACACCAGCCU-3'(SEQ ID NO:4)，

wherein, Za₂Is U, Zb₂The content of the compound is A,

the nucleotide sequence I comprises a position pairIn response to Za₂Of nucleotide ZA₂The nucleotide sequence II comprises a position corresponding to Zb₂Nucleotide of (A) ZB₂Said ZB₂Is the first nucleotide at the 5' end of the antisense strand.

In some embodiments, the first nucleotide sequence is selected from the group consisting of COL1A1mRNA sequence having a length of 19 consecutive nucleotides 2109-2127, defined as SEQ ID NO:6, and the nucleotide sequence set forth in SEQ ID NO:5 is a sequence fully reverse complementary to SEQ ID NO: 6. The modified siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the sense strand and the antisense strand is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide, the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially complementary reversely to form a double-stranded region, wherein the nucleotide sequence I is equal to the nucleotide sequence shown in SEQ ID NO. 5 in length and has NO more than 3 nucleotide differences, and the nucleotide sequence II is equal to the nucleotide sequence shown in SEQ ID NO. 6 in length and has NO more than 3 nucleotide differences:

5'-GGGUGUUCCUGGAGACCUZa₃-3'(SEQ ID NO:5)；

5'-Zb₃AGGUCUCCAGGAACACCC-3'(SEQ ID NO:6)，

wherein, Za₃Is U, Zb₃The content of the compound is A,

the nucleotide sequence I comprises a position corresponding to Za₃Of nucleotide ZA₃The nucleotide sequence II comprises a position corresponding to Zb₃Nucleotide of (A) ZB₃Said ZB₃Is the first nucleotide at the 5' end of the antisense strand.

In some embodiments, nucleotide sequence II is substantially reverse complementary, or fully reverse complementary to the first stretch of nucleotide sequence.

In some embodiments, at least nucleotides from positions 2-19 of the nucleotide sequence II are complementary to the first stretch of nucleotide sequence in the 5 'to 3' terminal direction.

In some embodiments, the nucleotide at position 1 of the nucleotide sequence II is a or U in the 5 'to 3' direction.

In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, or fully reverse complementary.

In some embodiments, the nucleotide sequence I differs by NO more than 1 nucleotide from the nucleotide sequence set forth in SEQ ID NO. 1, and/or the nucleotide sequence II differs by NO more than 1 nucleotide from the nucleotide sequence set forth in SEQ ID NO. 2.

In some embodiments, the nucleotide sequence I differs by NO more than 1 nucleotide from the nucleotide sequence set forth in SEQ ID NO. 3, and/or the nucleotide sequence II differs by NO more than 1 nucleotide from the nucleotide sequence set forth in SEQ ID NO. 4.

In some embodiments, the nucleotide sequence I differs by NO more than 1 nucleotide from the nucleotide sequence set forth in SEQ ID NO. 5, and/or the nucleotide sequence II differs by NO more than 1 nucleotide from the nucleotide sequence set forth in SEQ ID NO. 6.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO. 2 comprises ZB₁A difference in position, and ZB₁Selected from A, C or G. In some embodiments, the nucleotide difference is ZB₁Difference in position, ZB₁Selected from A, C or G. In some embodiments, ZA₁Is with ZB₁A complementary nucleotide.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO. 4 comprises ZB₂A difference in position, and ZB₂Selected from U, C or G. In some embodiments, the nucleotide difference is ZB₂Difference in position, ZB₂Selected from U, C or G. In some embodiments, ZA₂Is with ZB₂A complementary nucleotide.

In some embodiments, the nucleotide sequence II is identical to the nucleotide sequence shown in SEQ ID NO. 6Nucleotide differences between the sequences include ZB₃A difference in position, and ZB₃Selected from A, C or G. In some embodiments, the nucleotide difference is ZB₃Difference in position, ZB₃Selected from A, C or G. In some embodiments, ZA₃Is with ZB₃A complementary nucleotide.

These nucleotide differences do not significantly reduce the target gene suppression ability of the siRNA, and the siRNA including the nucleotide differences are also within the scope of the present disclosure.

In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO. 7, nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO. 8:

5'-GAAUGGAGAUGAUGGGGAZA₁-3'(SEQ ID NO:7)；

5'-ZB₁UCCCCAUCAUCUCCAUUC-3'(SEQ ID NO:8)，

wherein the ZB₁Is the first nucleotide at the 5' end of the antisense strand, ZA₁Selected from A, U, G or C, and ZB₁Is and ZA₁A complementary nucleotide; in some embodiments, ZA₁Is U, ZB₁Is A.

In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO. 9, nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO. 10:

5'-AGGCUGGUGUGAUGGGAUZA₂-3'(SEQ ID NO:9)；

5'-ZB₂AUCCCAUCACACCAGCCU-3'(SEQ ID NO:10)，

wherein the ZB₂Is the first nucleotide at the 5' end of the antisense strand, ZA₂Selected from A, U, G or C, and ZB₂Is and ZA₂A complementary nucleotide; in some embodiments, ZA₂Is U, ZB₂Is A.

In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO. 11, nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO. 12:

5'-GGGUGUUCCUGGAGACCUZA₃-3'(SEQ ID NO:11)；

5'-ZB₃AGGUCUCCAGGAACACCC-3'(SEQ ID NO:12)，

wherein the ZB₃Is the first nucleotide at the 5' end of the antisense strand, ZA₃Selected from A, U, G or C, and ZB₃Is and ZA₃A complementary nucleotide; in some embodiments, ZA₃Is U, ZB₃Is A.

In some embodiments, the sense strand comprises only nucleotide sequence i and the antisense strand comprises only nucleotide sequence ii. In some embodiments, the sense strand is nucleotide sequence i and the antisense strand is nucleotide sequence ii. In this case, the length ratio of the sense strand to the antisense strand was 19/19.

In some embodiments, the sense strand further comprises nucleotide sequence III and the antisense strand further comprises nucleotide sequence IV, each nucleotide of nucleotide sequence III and nucleotide sequence IV being independently one of a non-fluorinated modified nucleotide, the length of the nucleotide sequence III and the nucleotide sequence IV is 1-4 nucleotides respectively, the nucleotide sequence III and the nucleotide sequence IV are of equal length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is connected at the 5 'end of the nucleotide sequence I, the nucleotide sequence IV is connected at the 3' end of the nucleotide sequence II, the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, the second nucleotide sequence is adjacent to the first nucleotide sequence in the target mRNA and has the same length as the nucleotide sequence IV.

In some embodiments, the siRNA is one of:

1) the nucleotide sequence I is shown as SEQ ID NO. 7, the nucleotide sequence II is shown as SEQ ID NO. 8, at the moment, the siRNA further comprises a nucleotide sequence III and a nucleotide sequence IV, the length of the nucleotide sequences III and IV is 1 nucleotide, and the base of the nucleotide sequence III is A; in this case, the length ratio of the sense strand to the antisense strand was 20/20; or, the length of the nucleotide sequences III and IV is 2 nucleotides, and the bases of the nucleotide sequence III are A and A in sequence according to the direction from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 21/21; or, the length of the nucleotide sequences III and IV is 3 nucleotides, and the bases of the nucleotide sequence III are A, A and A in sequence from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 22/22; or, the length of the nucleotide sequences III and IV is 4 nucleotides, and the bases of the nucleotide sequence III are G, A, A and A in sequence from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 23/23.

2) The nucleotide sequence I is a sequence shown as SEQ ID NO. 9, the nucleotide sequence II is a sequence shown as SEQ ID NO. 10, at the moment, the siRNA further comprises a nucleotide sequence III and a nucleotide sequence IV, the length of the nucleotide sequences III and IV is 1 nucleotide, and the base of the nucleotide sequence III is C; in this case, the length ratio of the sense strand to the antisense strand was 20/20; or, the length of the nucleotide sequences III and IV is 2 nucleotides, and the bases of the nucleotide sequence III are U and C in sequence according to the direction from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 21/21; or, the length of the nucleotide sequences III and IV is 3 nucleotides, and the bases of the nucleotide sequence III are G, U and C in sequence from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 22/22; or, the length of the nucleotide sequences III and IV is 4 nucleotides, and the bases of the nucleotide sequence III are G, G, U and C in sequence from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 23/23.

3) The nucleotide sequence I is a sequence shown as SEQ ID NO. 11, the nucleotide sequence II is a sequence shown as SEQ ID NO. 12, at the moment, the siRNA further comprises a nucleotide sequence III and a nucleotide sequence IV, the length of the nucleotide sequences III and IV is 1 nucleotide, and the base of the nucleotide sequence III is A; in this case, the length ratio of the sense strand to the antisense strand was 20/20; or, the length of the nucleotide sequences III and IV is 2 nucleotides, and the bases of the nucleotide sequence III are C and A in sequence according to the direction from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 21/21; or, the length of the nucleotide sequences III and IV is 3 nucleotides, and the bases of the nucleotide sequence III are A, C and A in sequence from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 22/22; or, the length of the nucleotide sequences III and IV is 4 nucleotides, and the bases of the nucleotide sequence III are A, A, C and A in sequence from the 5 'end to the 3' end; in this case, the length ratio of the sense strand to the antisense strand was 23/23.

In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are the same length and are fully complementary in reverse orientation, such that, given the base of the nucleotide sequence III, the base of the nucleotide sequence IV is defined.

In some embodiments, the siRNA further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V being independently one of a non-fluorinated modified nucleotide; the nucleotide sequence V is 1 to 3 nucleotides in length and is ligated to the 3 'end of the antisense strand to form a 3' overhang of the antisense strand. Thus, the present disclosure provides siRNA sense and antisense strands that can have a length ratio of 19/20, 19/21, 19/22, 20/21, 20/22, 20/23, 21/22, 21/23, 21/24, 22/23, 22/24, 22/25, 23/24, 23/25, or 23/26.

In some embodiments, each nucleotide in the nucleotide sequence V may be any nucleotide. In some embodiments, the nucleotide sequence V is 2 consecutive thymidylate ribonucleotides (dTdT) or 2 consecutive uracil ribonucleotides (UU) in the 5 'to 3' direction; alternatively, the nucleotide sequence V is completely reverse complementary to the third nucleotide sequence; the third nucleotide sequence is a nucleotide sequence which is adjacent to the first nucleotide sequence or the second nucleotide sequence in the target mRNA and has the length equal to the nucleotide sequence V. Thus, in some embodiments, the siRNA of the present disclosure has a ratio of the length of the sense strand to the length of the antisense strand of 19/21 or 21/23, where the siRNA of the present disclosure has better mRNA silencing activity.

In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO. 13 and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO. 14:

5'-GAAUGGAGAUGAUGGGGAZA₁-3'(SEQ ID NO:13)；

5'-ZB₁UCCCCAUCAUCUCCAUUCUU-3'(SEQ ID NO:14)；

or, the sense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO. 15, and the antisense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO. 16:

5'-AAGAAUGGAGAUGAUGGGGAZA₁-3'(SEQ ID NO:15)；

5'-ZB₁UCCCCAUCAUCUCCAUUCUUUC-3'(SEQ ID NO:16)；

wherein the ZB₁Is the first nucleotide at the 5' end of the antisense strand, ZA₁Selected from A, U, G or C, and ZB₁Is and ZA₁A complementary nucleotide.

In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO. 17 and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO. 18:

5'-AGGCUGGUGUGAUGGGAUZA₂-3'(SEQ ID NO:17)；

5'-ZB₂AUCCCAUCACACCAGCCUGA-3'(SEQ ID NO:18)；

or, the sense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO. 19, and the antisense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO. 20:

5'-UCAGGCUGGUGUGAUGGGAUZA₂-3'(SEQ ID NO:19)；

5'-ZB₂AUCCCAUCACACCAGCCUGACC-3'(SEQ ID NO:20)；

wherein the ZB₂Is the first nucleotide at the 5' end of the antisense strand, ZA₂Selected from A, U, G or C, and ZB₂Is and ZA₂A complementary nucleotide.

In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO. 21 and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO. 22:

5'-GGGUGUUCCUGGAGACCUZA₃-3'(SEQ ID NO:21)；

5'-ZB₃AGGUCUCCAGGAACACCCUG-3'(SEQ ID NO:22)；

or, the sense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO. 23, and the antisense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO. 24:

5'-CAGGGUGUUCCUGGAGACCUZA₃-3'(SEQ ID NO:23)；

5'-ZB₃AGGUCUCCAGGAACACCCUGUU-3'(SEQ ID NO:24)；

wherein the ZB₃Is the first nucleotide at the 5' end of the antisense strand, ZA₃Selected from A, U, G or C, and ZB₃Is and ZA₃A complementary nucleotide.

In some embodiments, the siRNA of the present disclosure is siCOLa1, siCOLa2, sicoll 1, sicoll 2, sicoll 1, or sicoll 2:

siCOLa1

sense strand: 5'-GAAUGGAGAUGAUGGGGAA-3' (SEQ ID NO:25)

Antisense strand: 5'-UUCCCCAUCAUCUCCAUUCUU-3' (SEQ ID NO:26)

siCOLa2

Sense strand: 5'-AAGAAUGGAGAUGAUGGGGAA-3' (SEQ ID NO:27)

Antisense strand: 5'-UUCCCCAUCAUCUCCAUUCUUUC-3' (SEQ ID NO:28)

siCOLb1

Sense strand: 5'-AGGCUGGUGUGAUGGGAUU-3' (SEQ ID NO:29)

Antisense strand: 5'-AAUCCCAUCACACCAGCCUGA-3' (SEQ ID NO:30)

siCOLb2

Sense strand: 5'-UCAGGCUGGUGUGAUGGGAUU-3' (SEQ ID NO:31)

Antisense strand: 5'-AAUCCCAUCACACCAGCCUGACC-3' (SEQ ID NO:32)

siCOLc1

Sense strand: 5'-GGGUGUUCCUGGAGACCUU-3' (SEQ ID NO:33)

Antisense strand: 5'-AAGGUCUCCAGGAACACCCUG-3' (SEQ ID NO:34)

siCOLc2

Sense strand: 5'-CAGGGUGUUCCUGGAGACCUU-3' (SEQ ID NO:35)

Antisense strand: 5'-AAGGUCUCCAGGAACACCCUGUU-3' (SEQ ID NO:36)

In some embodiments, the fluoro-modified nucleotide is located in nucleotide sequence I and nucleotide sequence II, the fluoro-modified nucleotide is no more than 5 in the nucleotide sequence I, and the nucleotides at positions 7, 8, and 9 of the nucleotide sequence I are fluoro-modified nucleotides in the direction from the 5 'end to the 3' end; the number of the fluorinated modified nucleotides in the nucleotide sequence II is not more than 7, and the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the nucleotide sequence II are fluorinated modified nucleotides.

In some embodiments, the fluoro-modified nucleotide and the non-fluoro-modified nucleotide are located in nucleotide sequence I and nucleotide sequence II, and, in the direction from the 5 'end to the 3' end, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence I are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are non-fluoro-modified nucleotides; according to the direction from the 5 'end to the 3' end, the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the nucleotide sequence II are fluorine-containing modified nucleotides, and the nucleotides at the rest positions in the antisense strand are non-fluorine-containing modified nucleotides.

In some embodiments, the fluoro-modified nucleotide and the non-fluoro-modified nucleotide are located in nucleotide sequence I and nucleotide sequence II, and, in the direction from the 5 'end to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence I are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are non-fluoro-modified nucleotides; according to the direction from the 5 'end to the 3' end, the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the nucleotide sequence II are fluorine-containing modified nucleotides, and the nucleotides at the rest positions in the antisense strand are non-fluorine-containing modified nucleotides.

In this context, "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with fluorine, and has a structure represented by the following formula (7). "non-fluorinated modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorinated group, or a nucleotide analog. In some embodiments, each non-fluorinated modified nucleotide is independently selected from one of a nucleotide or a nucleotide analog in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorinated group.

The nucleotide in which the hydroxyl group at the 2 '-position of the ribosyl group is substituted with a non-fluorine group is known to those skilled in the art, and the nucleotide may be one selected from the group consisting of a 2' -alkoxy-modified nucleotide, a2 '-substituted alkoxy-modified nucleotide, a 2' -alkyl-modified nucleotide, a2 '-substituted alkyl-modified nucleotide, a 2' -amino-modified nucleotide, a2 '-substituted amino-modified nucleotide, and a 2' -deoxynucleotide.

In some embodiments, the 2 '-alkoxy modified nucleotide is a methoxy modified nucleotide (2' -OMe), as shown in formula (8). In some embodiments, the 2' -substituted alkoxy modified nucleotide, for example, can be a 2' -O-methoxyethyl modified nucleotide (2' -MOE), as shown in formula (9). In some embodiments, 2 '-amino modified nucleotides (2' -NH)₂) As shown in equation (10). In some embodiments, the 2' -Deoxynucleotide (DNA) is according to formula (11):

a nucleotide analog refers to a group that can replace a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, the nucleotide analog can be a heteronucleotide, a bridged nucleotide (BNA for short), or an acyclic nucleotide.

BNA refers to a constrained or inaccessible nucleotide. BNAs may contain five-membered, six-membered, or seven-membered ring bridged structures with "fixed" C3' -endo-sugar pull-down. The bridge is typically incorporated at the 2'-, 4' -position of the ribose to provide a 2',4' -BNA nucleotide. In some embodiments, BNA may be LNA, ENA, cET BNA, etc., where LNA is as shown in equation (12), ENA is as shown in equation (13), and cET BNA is as shown in equation (14):

acyclic nucleotides are a class of nucleotides in which the sugar ring of the nucleotide is opened. In some embodiments, the acyclic nucleotide can be an Unlocked Nucleic Acid (UNA) or a Glycerol Nucleic Acid (GNA), wherein UNA is represented by formula (15) and GNA is represented by formula (16):

in the above formulae (15) and (16), R represents a group selected from the group consisting of H, OH and an alkoxy group (O-alkyl).

An isonucleotide is a compound formed by changing the position of a base in a nucleotide on a ribose ring. In some embodiments, the isonucleotides can be compounds in which the base moves from the 1' -position to the 2' -position or the 3' -position of the ribose ring, as shown in formula (17) or (18):

in the compounds of the above-mentioned formula (17) to formula (18), Base represents a Base selected from A, U, G, C or T; r represents a group selected from the group consisting of H, OH, F and a non-fluorine group as described above.

In some embodiments, the nucleotide analog is selected from one of a heteronucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments, each of the non-fluorinated modified nucleotides is a methoxy modified nucleotide, which refers to a nucleotide in which the 2' -hydroxyl group of the ribosyl group is substituted with a methoxy group, both supra and infra.

In the above and hereinafter, "fluoro-modified nucleotide", "2 '-fluoro-modified nucleotide", "nucleotide in which 2' -hydroxyl group of ribose group is substituted with fluorine" and "2 '-fluoro-ribosyl group" have the same meaning, and all refer to a compound having a structure represented by formula (7) in which 2' -hydroxyl group of nucleotide is substituted with fluorine; the terms "methoxy-modified nucleotide", "2 '-methoxy-modified nucleotide", "nucleotide in which 2' -hydroxyl group of ribose group is substituted with methoxy group" and "2 '-methoxy ribosyl group" have the same meaning, and refer to a compound having a structure represented by formula (8) in which 2' -hydroxyl group of ribose group of nucleotide is substituted with methoxy group.

In some embodiments, the sirnas of the present disclosure are resistant to rnase cleavage in blood, thereby increasing the blood stability of the siRNA, allowing the siRNA to have greater resistance to nuclease hydrolysis while maintaining higher target gene regulatory activity.

In some embodiments, the sirnas of the present disclosure achieve a high balance of stability and gene expression regulation efficiency, and some also have the advantages of being simpler and less costly.

In some embodiments, the siRNA of the present disclosure is an siRNA with the following modifications:

the nucleotides at positions 7, 8 and 9 of the nucleotide sequence I in the sense strand of the siRNA are fluorine-modified nucleotides, the nucleotides at the rest positions of the sense strand of the siRNA are methoxy-modified nucleotides, according to the direction from the 5 'end to the 3' end, and the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence II in the antisense strand of the siRNA are fluorine-modified nucleotides, and the nucleotides at the rest positions of the antisense strand of the siRNA are methoxy-modified nucleotides, according to the direction from the 5 'end to the 3' end.

The nucleotides at the 5 th, 7 th, 8 th and 9 th positions of the nucleotide sequence I in the sense strand of the siRNA are fluorine-modified nucleotides, the nucleotides at the rest positions of the sense strand of the siRNA are methoxy-modified nucleotides, according to the direction from the 5 'end to the 3' end, and the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the nucleotide sequence II in the antisense strand of the siRNA are fluorine-modified nucleotides, and the nucleotides at the rest positions of the antisense strand of the siRNA are methoxy-modified nucleotides, according to the direction from the 5 'end to the 3' end.

In some embodiments, the sirnas of the present disclosure further contain other modified nucleotide groups that do not result in a significant impairment or loss of the function of the siRNA to modulate expression of a target gene.

Currently, there are various ways available in the art for modifying siRNA, including, in addition to the ribose group modifications mentioned above, backbone modifications (e.g., phosphate group modifications), base modifications, etc. (see, for example, Watts, J.K., G.F.Delevavey and M.J.Damha, chemical modified siRNA: tools and applications. drug discovery, 2008.13 (19-20): p.842-55, the entire contents of which are incorporated herein by reference).

In some embodiments, at least 1 of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand or the antisense strand of an siRNA provided by the present disclosure is a phosphate group having a modifying group. In some embodiments, the phosphate group having a modifying group is a phosphorothioate group formed by substitution of at least one oxygen atom in a phosphodiester bond in the phosphate group with a sulfur atom. In some embodiments, the phosphate group having a modifying group is a phosphorothioate group having a structure as shown in formula (1):

the modification can stabilize the double-stranded structure of siRNA and maintain the high specificity and high affinity of base pairing.

In some embodiments, the present disclosure provides sirnas wherein the phosphorothioate-based linkage is present at least one of the group consisting of: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination of the above. In some embodiments, phosphorothioate-based linkages are present at all of the above positions except at the 5' end of the sense strand. In some embodiments, phosphorothioate-based linkages are present at all of the above positions except at the 3' end of the sense strand. In some embodiments, the phosphorothioate-based linkage is present in at least one of the following positions:

between the 1 st and 2 nd nucleotides at the 5' terminal end of the sense strand;

between the 2 nd and 3 rd nucleotides at the 5' terminal end of the sense strand;

between the 1 st and 2 nd nucleotides at the 3' terminal end of the sense strand;

between the 2 nd and 3 rd nucleotides at the 3' terminal end of the sense strand;

between the 1 st and 2 nd nucleotides at the 5' terminal end of the antisense strand;

between the 2 nd and 3 rd nucleotides at the 5' terminal end of the antisense strand;

between the 1 st and 2 nd nucleotides at the 3' terminal end of the antisense strand; and

the 3' terminal end of the antisense strand is between the 2 nd and 3 rd nucleotides.

In some embodiments, the 5' terminal nucleotide of the siRNA antisense strand is a 5' -phosphate nucleotide or a 5' -phosphate analog modified nucleotide.

Commonly used nucleotides of said 5 '-phosphate or 5' -phosphate analogue modified nucleotides are well known to the person skilled in the art. In some embodiments, the nucleotide 5' -phosphate has the structure shown in formula (2):

5' -phosphate analogue modified nucleotides represented by formulae (3) to (6) are disclosed in Anastasia Khvorova and Jonathan K.Watts, The chemical evolution of oligonucleotide therapeutics of clinical utility.Nature Biotechnology,2017,35(3): 238-48:

wherein R represents a group selected from the group consisting of H, OH, methoxy, and fluoro; base represents a Base selected from A, U, C, G or T.

In some embodiments, the 5 '-phosphate analog modified nucleotide is a vinyl phosphate (5' - (E) -vinylphosphonate, E-VP) -containing nucleotide represented by formula (3), or a phosphorothioate-containing nucleotide represented by formula (5).

In some embodiments, the sirnas provided by the present disclosure can be the sirnas shown in tables 1A-1C.

Table 1A siRNA sequences in some embodiments

Table 1B siRNA sequences in some embodiments

TABLE 1C siRNA sequences in some embodiments

The inventors of the present disclosure have surprisingly found that the sirnas provided by the present disclosure not only have significantly enhanced plasma and lysosomal stability, but also retain very high gene suppression activity.

In the siRNA of the present disclosure, each adjacent nucleotide is connected by a phosphodiester bond or a phosphorothioate diester bond, and the non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate diester bond has a negative charge, and can exist in the form of a hydroxyl group or a thiol group, and the hydrogen ion in the hydroxyl group or the thiol group can be partially or completely replaced by a cation. The cation may be any cation, such as a metal cation, ammonium NH4⁺One of organic ammonium cations. For solubility enhancement, in some embodiments, the cation isThe cation is selected from one or more of alkali metal ions, tertiary amine formed ammonium cations and quaternary ammonium cations. The alkali metal ion may be K⁺And/or Na⁺The cation formed by the tertiary amine may be an ammonium ion formed by triethylamine and/or an ammonium ion formed by N, N-diisopropylethylamine. Thus, the sirnas described in the present disclosure may be present, at least in part, in the form of a salt. In one embodiment, the non-bridging oxygen or sulfur atoms in the phosphodiester or phosphorothioate linkages are at least partially bound to sodium ions, and the sirnas described in the present disclosure are present in the form of a sodium salt or a partial sodium salt.

The sirnas of the present disclosure can be prepared using conventional methods, such as solid phase phosphoramidite synthesis, which is well known in the art, or can be prepared using commercially custom synthesis.

It is clear to one skilled in the art that modified nucleotide groups can be introduced into the sirnas described in the present disclosure by using nucleoside monomers with corresponding modifications. Methods for preparing nucleoside monomers with corresponding modifications and methods for introducing modified nucleotide groups into siRNA are also well known to those skilled in the art. All modified nucleoside monomers are commercially available or can be prepared by known methods.

Pharmaceutical composition

The present disclosure provides a pharmaceutical composition comprising the siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier can be a carrier conventionally used in the art of siRNA administration, such as, but not limited to, magnetic nanoparticles (e.g., Fe-based)₃O₄Or Fe₂O₃Nanoparticles of (a), carbon nanotubes (carbon nanotubes), mesoporous silicon (mesopore silicon), calcium phosphate nanoparticles (calcium phosphate nanoparticles), Polyethyleneimine (PEI), polyamidoamine (pamam) dendrimer), polylysine (L-lysine), PLL), chitosan (chitosan), 1, 2-dioleoyl-3-trimethyol propane (1, 2-dioleoyl-3-trimethyo-propane, DOTAP), poly (D) or L-lactic acid/hydroxy ethyl ketone (tapp), poly (gamma-lactide), poly (gamma-co)Acid copolymer (poly (D)&L-lactic/glycolic acid) copolymer, PLGA, poly (2-aminoethylethylene phosphate), PPEEA, and poly (N, N-dimethylaminoethyl methacrylate), PDMAEMA, and derivatives thereof.

In some embodiments, the content of siRNA and pharmaceutically acceptable carrier in the pharmaceutical composition is not particularly required, and in some embodiments, the weight ratio of siRNA to pharmaceutically acceptable carrier may be 1 (1-500), and in some embodiments, the above weight ratio is 1 (1-50).

In some embodiments, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally employed in the art. For example, the pharmaceutically acceptable additional excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

The pH buffer may be a tris hydrochloride buffer at a pH of 7.5 to 8.5 and/or a phosphate buffer at a pH of 5.5 to 8.5, for example a phosphate buffer at a pH of 5.5 to 8.5.

The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The content of the protective agent may be 0.01 to 30% by weight, based on the total weight of the pharmaceutical composition.

The osmotic pressure regulator may be sodium chloride and/or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the pharmaceutical composition is 200-700 milliosmol/kilogram (mOsm/kg). The content of the osmolality adjusting agent can be easily determined by the skilled person, depending on the desired osmolality.

In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injection solution; or can be lyophilized powder for injection, and can be mixed with liquid adjuvant to make into liquid preparation. The liquid preparation can be used for subcutaneous, intramuscular or intravenous injection, and can also be used for spraying administration to the lung or spraying administration to other organ tissues (such as liver). In some embodiments, the pharmaceutical composition is for intravenous administration.

In some embodiments, the pharmaceutical composition may be in the form of a liposomal formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (which may also be referred to hereinafter as an organic amine), a helper lipid, and/or a pegylated lipid. Wherein the organic amine, helper lipid, and pegylated lipid may be selected from one or more of the amine-containing transfection compounds described in CN103380113A (herein incorporated by reference in its entirety), or a pharmaceutically acceptable salt or derivative thereof, helper lipid, and pegylated lipid, respectively.

In some embodiments, the organic amine may be a compound described in CN103380113A as shown in formula (201) or a pharmaceutically acceptable salt thereof:

wherein:

X₁₀₁and X₁₀₂Each independently O, S, N-A or C-A, wherein A is hydrogen or a C1-C20 hydrocarbon chain;

Y₁₀₁and Z₁₀₁Each independently is C O, C S, S O, CH OH or SO₂；

R₁₀₁、R₁₀₂、R₁₀₃、R₁₀₄、R₁₀₅、R₁₀₆And R₁₀₇Each independently is hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or linear aliphatic group, a cyclic or acyclic, substituted or unsubstituted, branched or linear heteroaliphatic group, a substituted or unsubstituted, branched or linear acyl group, a substituted or unsubstituted, branched or linear aryl group, a substituted or unsubstituted, branched or linear heteroaryl group;

x is an integer from 1 to 10;

n is an integer of 1 to 3, m is an integer of 0 to 20, p is 0 or 1; wherein if m ═ p ═ 0, then R₁₀₂Is hydrogen;

and, if at least one of n or m is 2, then R₁₀₃And the nitrogen in formula (201) forms a structure as shown in formula (202) or formula (203):

wherein g, e and f are each independently an integer of 1 to 6, "HCC" represents a hydrocarbon chain, and each xn represents a nitrogen atom in formula (201).

In some embodiments, R₁₀₃Is a polyamine. In other embodiments, R₁₀₃Is a ketal. In some embodiments, R in formula (201)₁₀₁And R₁₀₂Each of which is independently any substituted or unsubstituted, branched or straight chain alkyl or alkenyl group having from 3 to about 20 carbon atoms, such as from 8 to about 18 carbon atoms, and from 0 to 4 double bonds, such as from 0 to 2 double bonds.

In some embodiments, if each of n and m independently has a value of 1 or 3, then R₁₀₃May be any of the following formulae (204) to (213):

wherein, in formula (204) -formula (213), g, e and f are each independently an integer of 1 to 6, each "HCC" represents a hydrocarbon chain, and each indicates R₁₀₃A possible point of attachment to the nitrogen atom in formula (201), wherein each H at any x position may be replaced to achieve attachment to the nitrogen atom in formula (201).

Among them, the compound represented by formula (201) can be prepared according to the description in CN 103380113A.

In some embodiments, the organic amine is an organic amine according to formula (214) and/or an organic amine according to formula (215):

the helper lipid is cholesterol, cholesterol analogue and/or cholesterol derivative;

the pegylated lipid is 1, 2-dipalmitoamide-sn-glycerol-3-phosphatidylethanolamine-N- [ methoxy (polyethylene glycol) ] -2000.

In some embodiments, the molar ratio between the organic amine, the helper lipid, and the pegylated lipid in the pharmaceutical composition is (19.7-80): (19.7-80): (0.3-50), for example, (50-70): (20-40): (3-20).

In some embodiments, the pharmaceutical composition particles formed from the sirnas of the present disclosure and the above-described amine-containing transfection reagents have an average diameter of about 30nm to about 200nm, typically about 40nm to about 135nm, more typically the liposome particles have an average diameter of about 50nm to about 120nm, about 50nm to about 100nm, about 60nm to about 90nm, or about 70nm to about 90nm, e.g., the liposome particles have an average diameter of about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.

In some embodiments, the weight ratio (weight/weight ratio) of siRNA to total lipid (e.g., organic amine, helper lipid, and/or pegylated lipid) in the pharmaceutical composition formed from siRNA of the present disclosure and the above-described amine-containing transfection reagent is in a range from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1:18, from about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12, or from about 1:6 to about 1:10, for example, the weight ratio of siRNA of the present disclosure to total lipid is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1: 18.

In some embodiments, the pharmaceutical compositions may be sold with the components present separately and may be in the form of a liquid formulation for use. In some embodiments, the pharmaceutical composition of the siRNA provided by the present disclosure and the above pharmaceutically acceptable carrier can be prepared according to various known methods, except that the siRNA provided by the present disclosure is used to replace the existing siRNA; in some embodiments, the following methods may be used:

suspending organic amine, auxiliary lipid and pegylated lipid in alcohol according to the molar ratio and uniformly mixing to obtain a lipid solution; the amount of alcohol used is such that the total mass concentration of the resulting lipid solution is 2-25mg/mL, for example, 8-18 mg/mL. The alcohol is selected from pharmaceutically acceptable alcohols such as alcohols that are liquid at about room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, polyethylene glycol 200, polyethylene glycol 300, polyethylene glycol 400, which may be, for example, ethanol.

The siRNA provided by the present disclosure is dissolved in a buffered salt solution to obtain an siRNA aqueous solution. The concentration of the buffered salt solution is 0.05-0.5M, such as 0.1-0.2M, the pH of the buffered salt solution is adjusted to 4.0-5.5, such as 5.0-5.2, and the amount of buffered salt solution is such that the concentration of siRNA does not exceed 0.6mg/mL, such as 0.2-0.4 mg/mL. The buffer salt is selected from one or more of soluble acetate and soluble citrate, and can be sodium acetate and/or potassium acetate.

The lipid solution and the aqueous siRNA solution are mixed, and the resulting mixture is incubated at 40-60 ℃ for at least 2 minutes, which may be, for example, 5-30 minutes, to obtain a post-incubation liposome preparation. The volume ratio of the lipid solution to the siRNA aqueous solution is 1: (2-5) may be, for example, 1: 4.

Concentrating or diluting the incubated liposome preparation, removing impurities and sterilizing to obtain the pharmaceutical composition provided by the disclosure, wherein the physicochemical parameters are that the pH value is 6.5-8, the encapsulation rate is not lower than 80%, the particle size is 40-200nm, the polydispersity index is not higher than 0.30, and the osmotic pressure is 250-400 mOsm/kg; for example, the physical and chemical parameters can be pH value of 7.2-7.6, encapsulation rate of not less than 90%, particle size of 60-100nm, polydispersity index of not more than 0.20, and osmotic pressure of 300-400 mOsm/kg.

Wherein the concentration or dilution may be performed before, after or simultaneously with the removal of the impurities. The impurities can be removed by various methods, such as ultrafiltration using a cut-phase flow system and a hollow fiber column under 100K Da conditions, and the ultrafiltration exchange solution is Phosphate Buffered Saline (PBS) with pH 7.4. The sterilization can be carried out by various methods, for example, by filtration sterilization on a 0.22 μm filter.

Application of siRNA and pharmaceutical composition containing siRNA

In some embodiments, the present disclosure provides a method of treating or ameliorating a disease associated with COL1a1 gene expression, the method comprising administering to a subject in need thereof an effective amount of an siRNA and/or pharmaceutical composition of the present disclosure.

By administering the siRNA active ingredients of the present disclosure to a subject in need thereof, diseases associated with COL1a1 gene expression can be treated or improved by the mechanism of RNA interference. Therefore, the siRNA and/or the pharmaceutical composition of the present disclosure may be used for treating or improving a disease associated with COL1a1 gene expression, or for preparing a medicament for treating or improving a disease associated with COL1a1 gene expression.

The disease associated with expression of COL1A1 gene refers to a disease caused by overexpression of COL1A1 gene in cells, such as a fibrotic disorder and/or fibrillogenesis. Specific examples of such diseases include, but are not limited to: liver fibrosis, kidney fibrosis, lung fibrosis, peritoneal fibrosis, vocal cord fibrosis, intestinal fibrosis, bone marrow fibrosis, heart fibrosis, fibrosis associated with cerebral infarction, abnormal scarring associated with all possible types of accidental or iatrogenic skin injury, scleroderma, glaucoma filtration failure, intestinal adhesion, cirrhosis or chronic liver injury.

The term "administering" as used herein refers to placing an siRNA and/or pharmaceutical composition of the present disclosure into a subject by a method or route that results in at least partially positioning the siRNA and/or pharmaceutical composition of the present disclosure at a desired site to produce a desired effect. Routes of administration suitable for the methods of the present disclosure include local administration and systemic administration. In general, topical administration results in delivery of more siRNA active ingredient to a particular site as compared to the subject's entire body; whereas systemic administration results in delivery of the siRNA and/or pharmaceutical composition of the present disclosure to substantially the entire body of the subject. In view of the present disclosure directed to providing a means of treating or ameliorating liver fibrosis, in some embodiments is a mode of administration capable of delivering a drug to the liver.

Administration to a subject can be by any suitable route known in the art, including but not limited to: oral or parenteral routes, such as intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal and topical (including buccal and sublingual) administration. The frequency of administration may be 1 or more times per day, week, month, or year.

The dosage of the siRNA or pharmaceutical composition described in the present disclosure may be a dosage that is conventional in the art, and the dosage may be determined according to various parameters, particularly age, weight and sex of the subject. Toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining LD₅₀(dose lethal to 50% of the population) and ED₅₀(in the quantitative response, the dose which causes 50% of the maximal response intensity, and in the qualitative response, the dose which causes 50% of the subjects to develop positive response). The range of human doses can be derived based on data obtained from cell culture analysis and animal studies.

In administering the siRNA and/or pharmaceutical composition of the present disclosure, for example, for male or female C57BL/6J mice aged 6-12 weeks and weighing 18-25g, the ratio of the amount of siRNA: for pharmaceutical compositions of siRNA with a pharmaceutically acceptable carrier, the amount of siRNA may be from 0.001 to 50mg/kg body weight, in further embodiments from 0.01 to 10mg/kg body weight, in further embodiments from 0.05 to 5mg/kg body weight, and in still further embodiments from 0.1 to 3mg/kg body weight.

In some embodiments, the present disclosure provides a method of inhibiting expression of COL1a1 gene in a cell, the method comprising contacting the cell with an effective amount of an siRNA and/or pharmaceutical composition of the present disclosure, introducing the siRNA and/or pharmaceutical composition of the present disclosure into the cell, and achieving the purpose of inhibiting expression of COL1a1 gene in the cell by a mechanism of RNA interference. The cell may be selected from a hepatic stellate cell, a renal stellate cell, or a pulmonary stellate cell. In some embodiments, the cell is a hepatic stellate cell.

The modified siRNA and/or pharmaceutical composition provided herein generally have an amount of siRNA that is such that, using the methods provided herein to inhibit expression of the COL1a1 gene in a cell: it is sufficient to reduce the expression of the target gene and result in an extracellular concentration at the surface of the target cell of 1pM to 1 μ M, or 0.01nM to 100nM, or 0.05nM to 50nM or to about 5 nM. The amount required to achieve this local concentration will vary depending on a variety of factors including the method of delivery, the site of delivery, the number of cell layers between the delivery site and the target cell or tissue, whether the delivery is local or systemic, and the like. The concentration at the delivery site may be significantly higher than the concentration at the surface of the target cell or tissue.

Reagent kit

The present disclosure provides a kit comprising an effective amount of at least one of a modified siRNA of the present disclosure and a pharmaceutical composition.

In some embodiments, the kits described herein can provide modified siRNA in one container. In some embodiments, a kit described herein may comprise one container providing a pharmaceutically acceptable excipient. In some embodiments, the kit may further comprise other ingredients, such as stabilizers or preservatives and the like. In some embodiments, the kits described herein can comprise at least one additional therapeutic agent in a container other than the container providing the modified siRNA described herein. In some embodiments, the kit may comprise instructions for mixing the modified siRNA with a pharmaceutically acceptable carrier and/or adjuvant or other ingredients (if any).

In the kits of the present disclosure, the modified siRNA and the pharmaceutically acceptable carrier and/or adjuvant and the pharmaceutical composition and/or pharmaceutically acceptable adjuvant may be provided in any form, such as a liquid form, a dried form, or a lyophilized form. In some embodiments, the modified siRNA and pharmaceutically acceptable carrier and/or adjuvant and the pharmaceutical composition and optional pharmaceutically acceptable adjuvant are substantially pure and/or sterile. In some embodiments, sterile water may be provided in the kits of the present disclosure.

The present disclosure is further illustrated by the following examples, but is not to be construed as being limited thereby.

Examples

Unless otherwise specified, reagents and media used in the following examples are commercially available, and the procedures for nucleic acid electrophoresis, real-time PCR and the like used therein are performed by the method described in Molecular Cloning (Cold Spring Harbor laboratory Press (1989)).

Hela cells were obtained from the nucleic acid technology laboratory of the institute of molecular medicine, university of Beijing, and cultured in a DMEM complete medium (Hyclone) containing 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of the double antibody to Streptomycin (Penicillin-Streptomyces, Gibco, Invitrogen) at 37 ℃ in the presence of 5% CO₂Culture in 95% air incubator.

Unless otherwise stated, the reagent ratios provided below are calculated as volume ratios (v/v).

Preparation example 1 Synthesis of siRNA sequences

In the synthesis of siRNA, the nucleoside monomer (nucleoside monomers) refers to modified nucleoside phosphoramidite monomers (modified RNA phosphoramides) used in solid phase synthesis of phosphoramidites, depending on the kind and order of nucleotides in the siRNA to be prepared, unless otherwise specified. Solid phase phosphoramidite synthesis is a method used in RNA synthesis well known to those skilled in the art. Unless otherwise specified, nucleoside monomers used are commercially available.

(1-a) solid phase phosphoramidite method

The siRNA sequences listed in Table 2 were obtained by the solid phase phosphoramidite method.

For the sense strand, a universal solid phase support (UnyLinker) was used^TMloaded

HL SolidSupports, Kinovate Life Sciences Co.) starts a cycle, and nucleoside monomers are connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each attachment of a nucleoside monomer involves a four-step reaction of deprotection, coupling, capping, oxidation or sulfurization. When two nucleotides are connected by adopting phosphate ester, and the next nucleoside monomer is connected, four-step reactions including deprotection, coupling, capping and oxidation are carried out. When two nucleotides are connected by phosphorothioate, and the latter nucleoside monomer is connected, the four-step reaction of protection, coupling, capping and sulfuration is included.

The synthesis conditions are given as follows:

the nucleoside monomer was supplied as a 0.1M acetonitrile solution, the deprotection conditions were the same for each step, i.e., temperature was 25 deg.C, reaction time was 70 seconds, the deprotection reagent was dichloroacetic acid in dichloromethane (3% v/v), and the molar ratio of dichloroacetic acid to 4,4' -dimethoxytrityl protecting group on the solid support was 5: 1.

The coupling reaction conditions in each step are the same, and the coupling reaction conditions comprise that the temperature is 25 ℃, the molar ratio of the nucleic acid sequence connected on the solid phase carrier to the nucleoside monomer is 1:10, the molar ratio of the nucleic acid sequence connected on the solid phase carrier to the coupling reagent is 1:65, the reaction time is 600 seconds, and the coupling reagent is 0.5M acetonitrile solution of 5-ethylthio-1H-tetrazole.

The capping conditions were the same for each step, including a temperature of 25 ℃ and a reaction time of 15 seconds. The capping reagent solution is a mixed solution of CapA and CapB with a molar ratio of 1:1, wherein the CapA is a pyridine/acetonitrile mixed solution of 20 volume percent N-methylimidazole, and the volume ratio of the pyridine to the acetonitrile is 3: 5; CapB is 20% acetic anhydride in acetonitrile. The molar ratio of the capping reagent to the nucleic acid sequence attached to the solid phase carrier is acetic anhydride, N-methylimidazole and the nucleic acid sequence attached to the solid phase carrier is 1:1: 1.

The oxidation reaction conditions in each step are the same, including the temperature of 25 ℃, the reaction time of 15 seconds, and the oxidizing agent of 0.05M iodine water. The molar ratio of iodine to nucleic acid sequence attached to the solid support in the coupling step is 30: 1. The reaction was carried out in a mixed solvent of tetrahydrofuran, water and pyridine in a ratio of 3:1: 1.

The conditions of each step of sulfuration reaction are the same, including the temperature of 25 ℃, the reaction time of 300 seconds, and the sulfuration reagent of hydrogenated flavonol. The molar ratio of the sulfurizing reagent to the nucleic acid sequence attached to the solid support in the coupling step is 120: 1. The reaction was carried out in a mixed solvent of acetonitrile and pyridine in a ratio of 1: 1.

Cleavage and deprotection conditions were as follows: the synthesized nucleotide sequence with the attached carrier was added to 25 wt% ammonia water in an amount of 0.5ml/μmol, reacted at 55 ℃ for 16 hours, the liquid was removed, and concentrated to dryness in vacuo.

Purification and desalting: purification of nucleic acids was accomplished by gradient elution of NaCl using a preparative ion chromatography purification column (Source 15Q). Specifically, the method comprises the following steps: eluent A: 20mM sodium phosphate (pH 8.1) in water/acetonitrile 9:1 (volume ratio); eluent B: 1.5M sodium chloride, 20mM sodium phosphate (pH 8.1) and solvent water/acetonitrile 9:1 (volume ratio); elution gradient: eluting with eluent A and eluent B in gradient of 100:0-50: 50. Collecting product eluates, mixing, desalting with reverse phase chromatography purification column, specifically desalting with Sephadex column as filler (Sephadex G25), and eluting with deionized water.

And (3) detection: purity was checked using ion exchange chromatography (IEX-HPLC) and molecular weight was analyzed using liquid chromatography-mass spectrometry (LC-MS). The observed value is in agreement with the theoretical value, indicating that the sense strand S was synthesized.

For the antisense strand, the synthesis conditions are the same as for the sense strand, except that the corresponding nucleoside monomers are used in the nucleotide order of the antisense strand.

(1-b) introduction of 5' -VP modification

For siRNA 2, the first nucleotide at the 5' -terminus of the antisense strand had a 5' -VP modification introduced by modifying the uridine monomer (VP-Um) with a vinyl phosphate-modified 2' -methoxy group in the above solid phase phosphoramidite synthesis method, said VP-Um nucleoside monomer being synthesized according to the following method:

(1-b-1) Synthesis of VP-U-2

The VP-U-2 molecule was synthesized as follows:

2 '-methoxy-modified uridine (2' -OMe-U, 51.30g, 91.6mmol), tert-butyldiphenylchlorosilane (TBDPSCl, 50.35g, 183.2mmol), and imidazole (12.47g, 183.2mmol) were mixed and dissolved in 450ml of N, N-Dimethylformamide (DMF), and the reaction was stirred at room temperature for 20 hours. DMF was evaporated, taken up in 600ml dichloromethane and washed with 300ml saturated sodium bicarbonate, the aqueous phase was extracted 3 times with 300ml each time of Dichloromethane (DCM), the organic phases were combined, washed with 5% oxalic acid until the pH of the aqueous phase was <5, and the crude VP-U-1 was obtained after evaporation of the solvent to dryness and used directly for the subsequent synthesis of VP-U-2.

After dissolving the VP-U-1 crude product with 100ml dichloromethane, stirring in an ice bath for 10 minutes, adding 450ml of 2% p-toluenesulfonic acid solution (the solvent is a methanol-dichloromethane mixed solvent with the volume ratio of 3: 7) refrigerated in a refrigerator at 4 ℃ in advance, and reacting for 10 minutes. The reaction was quenched with an additional 200ml of saturated sodium bicarbonate solution, and the organic phase was washed with a saturated aqueous solution of sodium bicarbonate to pH 8. The aqueous phases are combined, extracted 2 times with 200ml of dichloromethane each time, the organic phases are combined, washed once more with 200ml of saturated brine and the solvent is evaporated to dryness. Purifying by a 200-mesh 300-mesh normal-phase silica gel column, loading petroleum ether into the column, performing gradient elution by using petroleum ether, ethyl acetate, dichloromethane and methanol in a ratio of 1:1:1:0.05-1:1:1:0.25, collecting product eluent, evaporating the solvent to dryness under reduced pressure, and performing foaming drying by using a vacuum oil pump to obtain 40.00g of a pure product VP-U-2.¹H NMR(400MHz,DMSO-d6)δ7.96(d,J＝7.8Hz,1H),7.64(dtd,J＝5.1,4.0,2.2Hz,4H),7.41–7.30(m,6H),6.79(d,J＝4.7Hz,1H),5.73(d,J＝7.6Hz,1H),4.94(t,J＝7.0Hz,1H),4.12(td,J＝4.6,3.9Hz,1H),4.05(dd,J＝4.8,4.0Hz,1H),3.96(t,J＝4.7Hz,1H),3.68(ddd,J＝11.8,7.0,4.6Hz,1H),3.57–3.46(m,1H),3.39(s,3H),1.05(s,8H).MS m/z：C₂₆H₃₃N₂O₆Si，[M+H]⁺Theory: 497.21, actually measuring: 497.45.

(1-b-2) Synthesis of VP-U-4:

VP-U-2(19.84g, 40.0mmol), dicyclohexylcarbodiimide (DCC, 16.48g, 80.0mmol), pyridine (4.20g, 53.2mmol), and trifluoroacetic acid (6.61g, 53.2mmol) were mixed and dissolved in 200ml of dimethyl sulfoxide (DMSO), and the mixture was stirred at room temperature for 20 hours to obtain a reaction solution. And dissolving tetraethyl methylenediphosphonate (21.44g, 74.4mmol) in 120ml of THF, cooling in an ice bath, adding t-BuOK (11.36g, 101.2mmol) at the ice bath temperature, reacting at the ice bath temperature for 10min, heating to room temperature, reacting for 0.5h, adding into the reaction solution, adding for about 1h, reacting for 1h at the ice bath temperature, and heating to room temperature to react for 18 h. The reaction was quenched with water and the aqueous phase was extracted 3 times with 200ml of dichloromethane each time. The organic phases are combined, washed once with 200ml of saturated brine and the solvent is evaporated to dryness. Purifying with 200-mesh 300-mesh normal phase silica gel column, loading petroleum ether into column, gradient eluting with petroleum ether and ethyl acetate at ratio of 1:1-1:4, collecting product eluate, evaporating solvent under reduced pressure, and foaming and drying with vacuum oil pump to obtain pure product VP-U-4(14.00 g).¹H NMR(400MHz,DMSO-d6)δ7.96(d,J＝7.8Hz,1H),7.64(dtd,J＝5.1,4.0,2.2Hz,4H),7.41–7.30(m,6H),6.82–6.71(m,2H),5.90(ddd,J＝25.9,15.0,1.0Hz,1H),5.73(d,J＝7.6Hz,1H),4.36–4.21(m,3H),4.18(t,J＝4.9Hz,1H),4.05(ddq,J＝9.7,8.5,6.9Hz,2H),3.87(t,J＝4.8Hz,1H),3.39(s,3H),1.32(td,J＝6.9,0.7Hz,6H),1.05(s,8H).MS m/z：C₃₁H₄₂N₂O₈PSi，[M+H]⁺Theory: 629.24, actually measuring: 629.51.

(1-b-3) Synthesis of VP-U-5:

VP-U-4(14.00g, 22.29mmol) was dissolved in 100ml tetrahydrofuran, triethylamine trihydrofluoric acid (17.96g, 111.45mmol) was added, and the reaction was stirred at room temperature for 20h to complete the reaction. The solvent was evaporated directly to dryness, dissolved in dichloromethane and evaporated to dryness 2 times using 50ml of dichloromethane each time to give the crude product. Purifying with 200-mesh 300-mesh normal phase silica gel column, loading petroleum ether into the column, performing gradient elution with petroleum ether, ethyl acetate, dichloromethane and methanol at a ratio of 1:1:1:0.05-1:1:1:0.25, collecting product eluent, evaporating the solvent under reduced pressure, and performing vacuum oil pump foaming and drying to obtain 6.70g of pure product VP-U-5.¹H NMR(400MHz,DMSO-d6)δ7.96(d,J＝7.8Hz,1H),6.77(dd,J＝15.0,6.2Hz,1H),5.99–5.82(m,2H),5.73(d,J＝7.6Hz,1H),5.27(d,J＝5.1Hz,1H),5.10(dd,J＝5.3,4.7Hz,1H),4.29(ddq,J＝9.8,8.6,7.0Hz,2H),4.17(ddd,J＝6.2,5.2,1.0Hz,1H),4.12–3.98(m,3H),3.39(s,2H),1.32(td,J＝6.9,0.6Hz,6H).MS m/z：C₁₅H₂₄N₂O₈P，[M+H]⁺Theory: 391.13, actually measuring: 391.38.

(1-b-4) Synthesis of VP-U-6:

VP-U-5(391mg, 1.0mmol), pyridinium trifluoroacetate (0.232g, 1.2mmol), N-methylimidazole (0.099g, 1.2mmol), bis (diisopropylamino) (2-cyanoethoxy) phosphine (0.452g, 1.5mmol) and the reaction mixture was added to 10ml of anhydrous dichloromethane under protection of argon, and the mixture was stirred at room temperature for 5 hours. The solvent was evaporated to dryness, purified by column chromatography (200-300 mesh normal phase silica gel, dichloromethane: acetonitrile (containing 0.5 wt% triethylamine) ═ 3:1-1:3 gradient elution), and the product eluate was collected and concentrated to remove the solvent, yielding a total of 508mg of the desired product, VP-U-6.³¹P NMR(161MHz,DMSO-d6)δ150.34,150.29,17.07,15.50.MS m/z：C₂₄H₄₁N₄O₉P₂，[M+H]⁺Theory: 591.23, actually measuring: 591.55. it shows that VP-U-6 is a target product VP-Um and participates in RNA strand synthesis as a nucleoside monomer.

(1-c) introduction of 5' -P modification

In the preparation of the antisense strand by the solid phase phosphoramidite method, after the last nucleoside monomer of the antisense strand is connected, a CPR-I monomer (Cat #13-2601-XX, Jima, Suzhou) is connected to the 5' end of the antisense strand to form a 5' -phosphate modification (5' -P modification) after four steps of deprotection, coupling, capping and oxidation.

The conditions and reagents for the deprotection, coupling, capping, oxidation reactions are the same as for the corresponding reactions in the solid phase phosphoramidite method described previously.

After introduction of the above-mentioned 5' -P modification, the antisense strand AS is obtained by performing the cleavage-deprotection step AS described above.

(1-d) annealing to form double-stranded siRNA

Equimolar amounts of the sense and antisense strands were dissolved in DEPC water (available from Amresco under the trade designation E174) to prepare the desired concentrations, heated to 70-95 deg.C, and then cooled at room temperature to allow formation of double-stranded structures by hydrogen bonding.

And detecting the molecular weight of the obtained double-stranded siRNA by LC-MS, and confirming that the product structure is consistent with that of the target siRNA, thereby indicating that the obtained double-stranded siRNA has a target sequence.

TABLE 2siRNA sequences

dT represents thymine deoxyribonucleotide.

Experimental example 1siRNA was examined for the inhibitory efficiency of COL1A1mRNA expression level in Hela cells.

Using Lipofectamine^TM2000 the siRNA obtained in preparation example 1 was transfected into Hela cells, respectively, to a final siRNA concentration of 50 nM. Each siRNA was transfected into 3 replicate wells. Cells without any siRNA treatment served as blank control.

The expression level of COL1A1mRNA in Hela cells transfected with each siRNA was determined by Real-Time Quantitative PCR (Quantitative Real-Time PCR). The specific procedures were that after culturing the transfected cells for 24 hours, total RNA in the cells was extracted using Trizol (Thermo Fisher Co.) according to the standard procedures for total RNA extraction, 1. mu.g of total RNA was separately extracted and reverse-transcribed using a reverse transcription kit (Promega Co., Ltd., product No. A3500) according to the procedures described therein to obtain cDNA, and the expression level of COL1A1mRNA was determined using 2 × Ultra SYBR mix (with ROX) (Beijing Kangkang, century Biotech Co., Ltd., product No. CW0956) kit using cDNA as a template according to the procedures described therein, wherein PCR primers for amplifying COL1A1 and GAPDH as an internal reference gene are shown in Table 3.

TABLE 3 primer information

The expression level of COL1A1mRNA was calculated by the following formula, i.e., the expression level of COL1A1mRNA was × 100% (expression level of test COL1A1 mRNA/expression level of test GAPDH mRNA)/(expression level of control COL1A1 mRNA/expression level of control GAPDH mRNA) at 100%.

The mRNA inhibition rate (1-COL1a 1mRNA expression amount) was × 100%. here, the test groups were Hela cells treated with each siRNA, and the control group was Hela cells not treated with siRNA, respectively, the results are shown in table 4.

TABLE 4 siRNA in vitro Activity assay

siRNA	Numbering	mRNA inhibition (%)
			siRNA N1	siCOL1	81
siRNA 1	siCOLa1M1SP	80
			siRNA 2	siCOLa1M1SVP	82
siRNA 3	siCOLa1M2SP	70
			siRNA 4	siCOLa1M3SP	55
siRNA N2	siCOL2	88
			siRNA 5	siCOLb1M1SP	86
siRNA 6	siCOLb1M1S	85
			siRNA 7	siCOLb1M3S	53
siRNA N3	siCOL3	80
			siRNA 8	siCOLc1M1SP	80
siRNA 9	siCOLc1M1	78
			siRNA 10	siCOLc1M2	69
siRNA 11	siCOLc1M3	52

The mRNA inhibition rate is the average value of the inhibition rate of COL1A1mRNA by siRNA in 3 multiple wells.

As can be seen from table 4, the modified sirnas provided by the present disclosure have higher inhibitory activity in Hela cell lines.

Experimental example 2 stability assay of siRNA in lysosomes

Preparation of test samples treated with lysosome lysis solution 6. mu.l each of siRNA (20. mu.M) of preparation example 1 was mixed with 27.2. mu.L of an aqueous sodium citrate solution (pH5.0), 4.08. mu.L of deionized water and 2.72. mu.L of a murine lysosome lysis solution (Rat LiverTritosomes, Xenotech, Inc., cat # R0610.LT, lot # 1610069), and the final concentration of acid phosphatase was 0.2 mU/. mu.L.37 ℃ and incubated at a constant temperature, 5. mu.l of the mixed solution was taken out each at 0, 2, 6 and 24 hours, and the mixed solution was denatured by adding 15. mu.L of 9M urea solution, followed by adding 4. mu.l of 6 × loading buffer (Solebao Co., cat # 20160830), immediately freezing the mixture in a refrigerator at-80 ℃ to terminate the reaction, and the time of taking out the test sample immediately after mixing the lysosome of siRNA with the lysosome lysis solution.

A reference sample was prepared without treatment with lysosomal lysis solution by mixing equimolar amounts of siRNA (20. mu.M) 1.5. mu.l each with 7.5. mu.L of aqueous sodium citrate (pH5.0) and 1. mu.L of deionized water, denaturing with 30. mu.L of 9M urea solution, adding 8. mu.L of 6 × loading buffer, mixing, and immediately freezing at-80 ℃ to terminate the reaction, labeled M.

Preparing 16 wt% non-denatured polyacrylamide gel, loading 20 μ l of each of the test sample and the reference sample to the gel, performing electrophoresis under a constant current of 20mA for 10min, and performing electrophoresis under a constant current of 40mA for 30 min. After the electrophoresis was completed, the gel was placed on a shaker and stained with Gelred dye (BioTium Co., Ltd., cat. No. 13G1203) for 10 min. And (5) observing and photographing gel imaging, and performing gray scale analysis on the electrophoresis strip. Table 5 shows the results of the stability semi-quantitative assay of the test sirnas listed in table 2 in vitro lysosomal lysates. The results are expressed as the Ratio (RL) of the longest fragment remaining after incubation of the test siRNA with Tritosomes to the longest fragment of siRNA without Tritosome treatment.

TABLE 5 Tritosome stability semi-quantitative results for siRNA

As can be seen from table 5, the modified sirnas provided by the present disclosure are stable in murine lysosomes for at least 24 hours.

Some embodiments of the present disclosure are described in detail above, however, the present disclosure is not limited to the specific details in the above embodiments, and many simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.

It should be noted that, in some embodiments, the various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various combinations that are possible in the present disclosure are not further described.

Sequence listing

<110> Sa Ribo Biotechnology Ltd

<120> siRNA inhibiting COL1A1 gene expression, pharmaceutical composition containing the same and use thereof

<130>12674RIBO

<160>122

<170>SIPOSequenceListing 1.0

<210>1

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(1)

<223> n is A

<220>

<221>misc_feature

<222>(19)..(19)

<223>n is a, c, g, t or u

<400>1

gaauggagau gauggggan 19

<210>2

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(1)

<223> n is U

<400>2

nuccccauca ucuccauuc 19

<210>3

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(19)..(19)

<223> n is U

<400>3

aggcuggugu gaugggaun 19

<210>4

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(1)

<223> n is U

<400>4

naucccauca caccagccu 19

<210>5

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(19)..(19)

<223> n is U

<400>5

ggguguuccu ggagaccun 19

<210>6

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(1)

<223> n is A

<400>6

naggucucca ggaacaccc 19

<210>7

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gaauggagau gauggggan 19

<210>8

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

nuccccauca ucuccauuc 19

<210>9

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

aggcuggugu gaugggaun 19

<210>10

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

naucccauca caccagccu 19

<210>11

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggguguuccu ggagaccun 19

<210>12

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

naggucucca ggaacaccc 19

<210>13

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gaauggagau gauggggan 19

<210>14

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

nuccccauca ucuccauucu u 21

<210>15

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

aagaauggag augaugggga n 21

<210>16

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

nuccccauca ucuccauucu uuc 23

<210>17

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

aggcuggugu gaugggaun 19

<210>18

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

naucccauca caccagccug a 21

<210>19

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

ucaggcuggu gugaugggau n 21

<210>20

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

naucccauca caccagccug acc 23

<210>21

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ggguguuccu ggagaccun 19

<210>22

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

naggucucca ggaacacccu g 21

<210>23

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

caggguguuc cuggagaccu n 21

<210>24

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

naggucucca ggaacacccu guu 23

<210>25

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

gaauggagau gauggggaa 19

<210>26

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

uuccccauca ucuccauucu u 21

<210>27

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

aagaauggag augaugggga a 21

<210>28

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

uuccccauca ucuccauucu uuc 23

<210>29

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

aggcuggugu gaugggauu 19

<210>30

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

aaucccauca caccagccug a 21

<210>31

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

ucaggcuggu gugaugggau u 21

<210>32

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

aaucccauca caccagccug acc 23

<210>33

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

ggguguuccu ggagaccuu 19

<210>34

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

aaggucuccaggaacacccu g 21

<210>35

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

caggguguuc cuggagaccu u 21

<210>36

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

aaggucucca ggaacacccu guu 23

<210>37

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

gaauggagau gauggggaa 19

<210>38

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

uuccccauca ucuccauucu u 21

<210>39

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

aggcuggugu gaugggauu 19

<210>40

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

aaucccauca caccagccug a 21

<210>41

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

ggguguuccu ggagaccuu 19

<210>42

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

aaggucucca ggaacacccu g 21

<210>43

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

gaauggagau gauggggaa 19

<210>44

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

uuccccauca ucuccauucu u 21

<210>45

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

aagaauggag augaugggga a 21

<210>46

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

uuccccauca ucuccauucu uuc 23

<210>47

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

gaauggagau gauggggaa 19

<210>48

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

uuccccauca ucuccauucu u 21

<210>49

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

aagaauggag augaugggga a 21

<210>50

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

uuccccauca ucuccauucu uuc 23

<210>51

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

gaauggagau gauggggaa 19

<210>52

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

uuccccauca ucuccauucu u 21

<210>53

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

aagaauggag augaugggga a 21

<210>54

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

uuccccauca ucuccauucu uuc 23

<210>55

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>55

gaauggagau gauggggaa 19

<210>56

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>56

uuccccauca ucuccauucu u 21

<210>57

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>57

aagaauggag augaugggga a 21

<210>58

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>58

uuccccauca ucuccauucu uuc 23

<210>59

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>59

aggcuggugu gaugggauu 19

<210>60

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>60

aaucccauca caccagccug a 21

<210>61

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>61

ucaggcuggu gugaugggau u 21

<210>62

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>62

aaucccauca caccagccug acc 23

<210>63

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>63

aggcuggugu gaugggauu 19

<210>64

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>64

aaucccauca caccagccug a 21

<210>65

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>65

ucaggcuggu gugaugggau u 21

<210>66

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>66

aaucccauca caccagccug acc 23

<210>67

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>67

aggcuggugu gaugggauu 19

<210>68

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>68

aaucccauca caccagccug a 21

<210>69

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>69

ucaggcuggu gugaugggau u 21

<210>70

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>70

aaucccauca caccagccug acc 23

<210>71

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>71

aggcuggugu gaugggauu 19

<210>72

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>72

aaucccauca caccagccug a 21

<210>73

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>73

ucaggcuggu gugaugggau u 21

<210>74

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>74

aaucccauca caccagccug acc 23

<210>75

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>75

ggguguuccu ggagaccuu 19

<210>76

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>76

aaggucucca ggaacacccu g 21

<210>77

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>77

caggguguuc cuggagaccu u 21

<210>78

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>78

aaggucucca ggaacacccu guu 23

<210>79

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>79

ggguguuccu ggagaccuu 19

<210>80

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>80

aaggucucca ggaacacccu g 21

<210>81

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>81

caggguguuc cuggagaccu u 21

<210>82

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>82

aaggucucca ggaacacccu guu 23

<210>83

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>83

ggguguuccu ggagaccuu 19

<210>84

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>84

aaggucucca ggaacacccu g 21

<210>85

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>85

caggguguuc cuggagaccu u 21

<210>86

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>86

aaggucucca ggaacacccu guu 23

<210>87

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>87

ggguguuccu ggagaccuu 19

<210>88

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>88

aaggucucca ggaacacccu g 21

<210>89

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>89

caggguguuc cuggagaccu u 21

<210>90

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>90

aaggucucca ggaacacccu guu 23

<210>91

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>91

gaauggagau gauggggaa 19

<210>92

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>92

uuccccauca ucuccauucu u 21

<210>93

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>93

gaauggagau gauggggaa 19

<210>94

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>94

uuccccauca ucuccauucu u 21

<210>95

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>95

gaauggagau gauggggaa 19

<210>96

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>96

uuccccauca ucuccauucu u 21

<210>97

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>97

gaauggagau gauggggaa 19

<210>98

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>98

uuccccauca ucuccauucu u 21

<210>99

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>99

aggcuggugu gaugggauu 19

<210>100

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>100

aaucccauca caccagccug a 21

<210>101

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>101

aggcuggugu gaugggauu 19

<210>102

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>102

aaucccauca caccagccug a 21

<210>103

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>103

aggcuggugu gaugggauu 19

<210>104

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>104

aaucccauca caccagccug a 21

<210>105

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>105

ggguguuccu ggagaccuu 19

<210>106

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>106

aaggucucca ggaacacccu g 21

<210>107

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>107

ggguguuccu ggagaccuu 19

<210>108

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>108

aaggucucca ggaacacccu g 21

<210>109

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>109

ggguguuccu ggagaccuu 19

<210>110

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>110

aaggucucca ggaacacccu g 21

<210>111

<211>19

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>111

ggguguuccu ggagaccuu 19

<210>112

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>112

aaggucucca ggaacacccu g 21

<210>113

<211>21

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>113

gaauggagau gauggggaat t 21

<210>114

<211>21

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>114

uuccccauca ucuccauuct t 21

<210>115

<211>21

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>115

aggcuggugu gaugggauut t 21

<210>116

<211>21

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>116

aaucccauca caccagccut t 21

<210>117

<211>21

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>117

ggguguuccu ggagaccuut t 21

<210>118

<211>21

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>118

aaggucucca ggaacaccct t 21

<210>119

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>119

aggttcccct ggacgagac 19

<210>120

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>120

ccacggtgac cctttatgc 19

<210>121

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>121

ggtcggagtc aacggattt 19

<210>122

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>122

ccagcatcgc cccacttga 19

Claims

1. An siRNA capable of inhibiting expression of COL1A1 gene, said siRNA comprising a sense strand and an antisense strand, each nucleotide of said sense strand and said antisense strand being independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide, wherein said sense strand comprises a nucleotide sequence I and said antisense strand comprises a nucleotide sequence II, said nucleotide sequence I and said nucleotide sequence II both being 19 nucleotides in length, said nucleotide sequence I and said nucleotide sequence II being at least partially reverse complementary to form a duplex region, said nucleotide sequence II being at least partially reverse complementary to a first nucleotide sequence selected from the group consisting of sequences of 19 consecutive nucleotides in length in the 800-2200 region of COL1A1 mRNA; the nucleotides at the 7 th, 8 th and 9 th positions of the nucleotide sequence I are fluorine-modified nucleotides according to the direction from the 5 'end to the 3' end; the first nucleotide at the 5 'end of the nucleotide sequence II is the first nucleotide at the 5' end of the antisense strand, and the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence II are fluoro-modified nucleotides.

2. The siRNA of claim 1, wherein nucleotides at positions 7, 8 and 9 of the nucleotide sequence I are fluoro-modified nucleotides, and nucleotides at the remaining positions in the sense strand are non-fluoro-modified nucleotides in the direction from 5 'end to 3' end; the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the nucleotide sequence II are fluorinated modified nucleotides, and the nucleotides at the rest positions in the antisense strand are non-fluorinated modified nucleotides.

Preferably, each of the non-fluorinated modified nucleotides is a methoxy-modified nucleotide, which refers to a nucleotide in which the 2' -hydroxyl group of the ribosyl group is substituted with a methoxy group.

3. The siRNA of claim 1, wherein nucleotide sequence II is substantially reverse complementary, or fully reverse complementary to the first nucleotide sequence;

preferably, at least the nucleotides at positions 2-19 of the nucleotide sequence II are complementary to the first stretch of nucleotide sequence in the 5 'to 3' direction.

4. The siRNA of any one of claims 1-3, wherein,

the length of the nucleotide sequence I is equal to that of the nucleotide sequence shown in SEQ ID NO. 1 and is not more than 3 nucleotide differences, the length of the nucleotide sequence II is equal to that of the nucleotide sequence shown in SEQ ID NO. 2 and is not more than 3 nucleotide differences:

5'-GAAUGGAGAUGAUGGGGAZa₁-3'(SEQ IDNO:1)；

5'-Zb₁UCCCCAUCAUCUCCAUUC-3'(SEQ ID NO:2)，

wherein, Za₁Is A, Zb₁Is a group of U, and the number of U,

the nucleotide sequence I comprises a position corresponding to Za₁Of nucleotide ZA₁The nucleotide sequence II comprises a position corresponding to Zb₁Nucleotide of (A) ZB₁Said ZB₁Is the first nucleotide at the 5' end of the antisense strand; or

The length of the nucleotide sequence I is equal to that of the nucleotide sequence shown in SEQ ID NO. 3 and is not more than 3 nucleotide differences, the length of the nucleotide sequence II is equal to that of the nucleotide sequence shown in SEQ ID NO. 4 and is not more than 3 nucleotide differences:

5'-AGGCUGGUGUGAUGGGAUZa₂-3'(SEQ ID NO:3)；

5'-Zb₂AUCCCAUCACACCAGCCU-3'(SEQ ID NO:4)，

wherein, Za₂Is U, Zb₂The content of the compound is A,

the nucleotide sequence I comprises a position corresponding to Za₂Of nucleotide ZA₂The nucleotide sequence II comprises a position corresponding to Zb₂Nucleotide of (A) ZB₂Said ZB₂Is the first nucleotide at the 5' end of the antisense strand; or

The length of the nucleotide sequence I is equal to that of the nucleotide sequence shown in SEQ ID NO. 5 and is not more than 3 nucleotide differences, the length of the nucleotide sequence II is equal to that of the nucleotide sequence shown in SEQ ID NO. 6 and is not more than 3 nucleotide differences:

5'-GGGUGUUCCUGGAGACCUZa₃-3'(SEQ ID NO:5)；

5'-Zb₃AGGUCUCCAGGAACACCC-3'(SEQ ID NO:6)，

wherein, Za₃Is U, Zb₃The content of the compound is A,

the nucleotide sequence I comprises a position corresponding to Za₃Of nucleotide ZA₃The nucleotide sequence II comprises a position corresponding to Zb₃Nucleotide of (A) ZB₃Said ZB₃Is the first nucleotide at the 5' end of the antisense strand;

preferably, the nucleotide sequence I is not more than 1 nucleotide different from the nucleotide sequence shown in SEQ ID NO. 1, and/or the nucleotide sequence II is not more than 1 nucleotide different from the nucleotide sequence shown in SEQ ID NO. 2; or

The nucleotide sequence I is not more than 1 nucleotide difference with the nucleotide sequence shown in SEQ ID NO. 3, and/or the nucleotide sequence II is not more than 1 nucleotide difference with the nucleotide sequence shown in SEQ ID NO. 4; or

The nucleotide sequence I is not more than 1 nucleotide difference from the nucleotide sequence shown in SEQ ID NO. 5, and/or the nucleotide sequence II is not more than 1 nucleotide difference from the nucleotide sequence shown in SEQ ID NO. 6;

preferably, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO. 2 comprises ZB₁A difference in position, and ZB₁Selected from A, C or G, preferably, ZA₁Is with ZB₁A complementary nucleotide; or

The nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO. 4 comprises ZB₂A difference in position, and ZB₂Selected from U, C or G, preferably, ZA₂Is with ZB₂A complementary nucleotide; or

The nucleotide sequenceThe nucleotide difference between II and the nucleotide sequence shown in SEQ ID NO. 6 includes ZB₃A difference in position, and ZB₃Selected from U, C or G, preferably, ZA₃Is with ZB₃A complementary nucleotide.

5. The siRNA of any one of claims 1-4, wherein said nucleotide sequence I and said nucleotide sequence II are substantially reverse complementary, or fully reverse complementary.

6. The siRNA of claim 5, wherein the nucleotide sequence I is the sequence shown in SEQ ID NO. 7, and the nucleotide sequence II is the sequence shown in SEQ ID NO. 8; or

The nucleotide sequence I is a sequence shown as SEQ ID NO. 9, and the nucleotide sequence II is a sequence shown as SEQ ID NO. 10; or

The nucleotide sequence I is a sequence shown as SEQ ID NO. 11, and the nucleotide sequence II is a sequence shown as SEQ ID NO. 12;

5'-GAAUGGAGAUGAUGGGGAZA₁-3'(SEQ ID NO:7)

5'-ZB₁UCCCCAUCAUCUCCAUUC-3'(SEQ ID NO:8)

5'-AGGCUGGUGUGAUGGGAUZA₂-3'(SEQ ID NO:9)

5'-ZB₂AUCCCAUCACACCAGCCU-3'(SEQ ID NO:10)

5'-GGGUGUUCCUGGAGACCUZA₃-3'(SEQ ID NO:11)

5'-ZB₃AGGUCUCCAGGAACACCC-3'(SEQ ID NO:12)

wherein the content of the first and second substances,

ZB₁is the first nucleotide at the 5' end of the antisense strand, ZA₁Selected from A, U, G or C, and ZB₁Is and ZA₁A complementary nucleotide;

ZB₂is the first nucleotide at the 5' end of the antisense strand, ZA₂Selected from A, U, G or C, and ZB₂Is and ZA₂A complementary nucleotide;

ZB₃is the first nucleotide at the 5' end of the antisense strand, ZA₃Selected from A, U, G or C, and ZB₃Is and ZA₃A complementary nucleotide;

preferably, ZA₁Is U, ZB₁Is A; ZA₂Is U, ZB₂Is A; ZA₃Is U, ZB₃Is A.

7. The siRNA of any one of claims 1-6, wherein said sense strand further comprises a nucleotide sequence III, said antisense strand further comprises a nucleotide sequence IV, each nucleotide of nucleotide sequence III and nucleotide sequence IV being independently one of a non-fluorinated modified nucleotide, said nucleotide sequence III and said nucleotide sequence IV each being 1-4 nucleotides in length, said nucleotide sequence III and said nucleotide sequence IV being equal in length and being substantially reverse complementary or fully reverse complementary, said nucleotide sequence III being linked at the 5 'end of said nucleotide sequence I and said nucleotide sequence IV being linked at the 3' end of said nucleotide sequence II, said nucleotide sequence IV being substantially reverse complementary or fully reverse complementary to a second nucleotide sequence that is adjacent to a first nucleotide sequence in a target mRNA, And a nucleotide sequence with the same length as the nucleotide sequence IV.

8. The siRNA of claim 7, wherein said siRNA is one of the following siRNAs:

1) the nucleotide sequence I is shown as SEQ ID NO. 7, the nucleotide sequence II is shown as SEQ ID NO. 8, the length of the nucleotide sequences III and IV is 1 nucleotide, and the base of the nucleotide sequence III is A; or, the length of the nucleotide sequences III and IV is 2 nucleotides, and the bases of the nucleotide sequence III are A and A in sequence according to the direction from the 5 'end to the 3' end; or, the length of the nucleotide sequences III and IV is 3 nucleotides, and the bases of the nucleotide sequence III are A, A and A in sequence from the 5 'end to the 3' end; or, the length of the nucleotide sequences III and IV is 4 nucleotides, and the bases of the nucleotide sequence III are G, A, A and A in sequence from the 5 'end to the 3' end;

2) the nucleotide sequence I is a sequence shown as SEQ ID NO. 9, the nucleotide sequence II is a sequence shown as SEQ ID NO. 10, the length of each of the nucleotide sequences III and IV is 1 nucleotide, and the base of the nucleotide sequence III is C; or, the length of the nucleotide sequences III and IV is 2 nucleotides, and the bases of the nucleotide sequence III are U and C in sequence according to the direction from the 5 'end to the 3' end; or, the length of the nucleotide sequences III and IV is 3 nucleotides, and the bases of the nucleotide sequence III are G, U and C in sequence from the 5 'end to the 3' end; or, the length of the nucleotide sequences III and IV is 4 nucleotides, and the bases of the nucleotide sequence III are G, G, U and C in sequence from the 5 'end to the 3' end;

3) the nucleotide sequence I is a sequence shown as SEQ ID NO. 11, the nucleotide sequence II is a sequence shown as SEQ ID NO. 12, the length of each of the nucleotide sequences III and IV is 1 nucleotide, and the base of the nucleotide sequence III is A; or, the length of the nucleotide sequences III and IV is 2 nucleotides, and the bases of the nucleotide sequence III are C and A in sequence according to the direction from the 5 'end to the 3' end; or, the length of the nucleotide sequences III and IV is 3 nucleotides, and the bases of the nucleotide sequence III are A, C and A in sequence from the 5 'end to the 3' end; or, the length of the nucleotide sequences III and IV is 4 nucleotides, and the bases of the nucleotide sequence III are A, A, C and A in sequence from the 5 'end to the 3' end.

9. The siRNA of any one of claims 1 to 8, wherein the siRNA further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V being independently one of non-fluorinated modified nucleotides; the nucleotide sequence V is 1 to 3 nucleotides in length, and is connected to the 3 'end of the antisense strand to form a 3' overhang of the antisense strand;

preferably, the nucleotide sequence V is 2 nucleotides in length; the nucleotide sequence V is a sequence of 2 consecutive thymine deoxyribonucleotides, a sequence of 2 consecutive uracil ribonucleotides, or is completely reverse complementary to the third nucleotide sequence in the direction from the 5 'end to the 3' end; the third nucleotide sequence is a nucleotide sequence which is adjacent to the first nucleotide sequence or the second nucleotide sequence in the target mRNA and has the length equal to the nucleotide sequence V.

10. The siRNA of any one of claims 1 to 9, wherein the siRNA is one of:

the sense strand of the siRNA contains a nucleotide sequence shown as SEQ ID NO. 13, and the antisense strand contains a nucleotide sequence shown as SEQ ID NO. 14:

5'-GAAUGGAGAUGAUGGGGAZA₁-3'(SEQ ID NO:13)；

5'-ZB₁UCCCCAUCAUCUCCAUUCUU-3'(SEQ ID NO:14)；

or, the sense strand of the siRNA contains a nucleotide sequence shown as SEQ ID NO. 15, and the antisense strand contains a nucleotide sequence shown as SEQ ID NO. 16:

5'-AAGAAUGGAGAUGAUGGGGAZA₁-3'(SEQ ID NO:15)；

5'-ZB₁UCCCCAUCAUCUCCAUUCUUUC-3'(SEQ ID NO:16)；

wherein the ZB₁Is the first nucleotide at the 5' end of the antisense strand, ZA₁Selected from A, U, G or C, and ZB₁Is and ZA₁A complementary nucleotide; or

The sense strand of the siRNA contains a nucleotide sequence shown as SEQ ID NO. 17, and the antisense strand of the siRNA contains a nucleotide sequence shown as SEQ ID NO. 18:

5'-AGGCUGGUGUGAUGGGAUZA₂-3'(SEQ ID NO:17)；

5'-ZB₂AUCCCAUCACACCAGCCUGA-3'(SEQ ID NO:18)；

5'-UCAGGCUGGUGUGAUGGGAUZA₂-3'(SEQ ID NO:19)；

5'-ZB₂AUCCCAUCACACCAGCCUGACC-3'(SEQ ID NO:20)；

wherein the ZB₂Is the first nucleotide at the 5' end of the antisense strand, ZA₂Selected from A, U, G or C, and ZB₂Is and ZA₂A complementary nucleotide; or

The sense strand of the siRNA contains a nucleotide sequence shown as SEQ ID NO. 21, and the antisense strand of the siRNA contains a nucleotide sequence shown as SEQ ID NO. 22:

5'-GGGUGUUCCUGGAGACCUZA₃-3'(SEQ ID NO:21)；

5'-ZB₃AGGUCUCCAGGAACACCCUG-3'(SEQ ID NO:22)；

5'-CAGGGUGUUCCUGGAGACCUZA₃-3'(SEQ ID NO:23)；

5'-ZB₃AGGUCUCCAGGAACACCCUGUU-3'(SEQ ID NO:24)；

11. The siRNA of claim 10, wherein the siRNA is one of:

siCOLa1

sense strand: 5'-GAAUGGAGAUGAUGGGGAA-3' (SEQ ID NO:25)

Antisense strand: 5'-UUCCCCAUCAUCUCCAUUCUU-3' (SEQ ID NO:26)

siCOLa2

Sense strand: 5'-AAGAAUGGAGAUGAUGGGGAA-3' (SEQ ID NO:27)

Antisense strand: 5'-UUCCCCAUCAUCUCCAUUCUUUC-3' (SEQ ID NO:28)

siCOLb1

Sense strand: 5'-AGGCUGGUGUGAUGGGAUU-3' (SEQ ID NO:29)

Antisense strand: 5'-AAUCCCAUCACACCAGCCUGA-3' (SEQ ID NO:30)

siCOLb2

Sense strand: 5'-UCAGGCUGGUGUGAUGGGAUU-3' (SEQ ID NO:31)

Antisense strand: 5'-AAUCCCAUCACACCAGCCUGACC-3' (SEQ ID NO:32)

siCOLc1

Sense strand: 5'-GGGUGUUCCUGGAGACCUU-3' (SEQ ID NO:33)

Antisense strand: 5'-AAGGUCUCCAGGAACACCCUG-3' (SEQ ID NO:34)

siCOLc2

Sense strand: 5'-CAGGGUGUUCCUGGAGACCUU-3' (SEQ ID NO:35)

Antisense strand: 5'-AAGGUCUCCAGGAACACCCUGUU-3' (SEQ ID NO:36)

12. The siRNA of any of claims 1 to 11, wherein at least 1 of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate group with a modifying group, and/or the 5' terminal nucleotide of the antisense strand is a 5' -phosphonucleotide or a 5' -phosphoanalogue modified nucleotide.

13. The siRNA according to claim 12, wherein the phosphate group having the modification group is a phosphorothioate group in which at least one oxygen atom in a phosphodiester bond in the phosphate group is substituted with a sulfur atom, and the phosphorothioate group linkage is present at least one position in the group consisting of:

14. The siRNA of claim 12, wherein the nucleotide 5 '-phosphate or nucleotide 5' -phosphate analogue modified is a nucleotide represented by one of formula (2) -formula (6):

wherein R represents a group selected from the group consisting of H, OH, F and methoxy; base represents a Base selected from A, U, C, G or T.

15. The siRNA of claim 1, wherein said siRNA is any one of the siRNAs shown in Table 1A, Table 1B and Table 1C.

16. A pharmaceutical composition comprising the siRNA of any one of claims 1 to 15 and a pharmaceutically acceptable carrier.

17. The pharmaceutical composition of claim 16, wherein the weight ratio of the siRNA to the pharmaceutically acceptable carrier is 1 (1-500),

preferably, the weight ratio of the siRNA to the pharmaceutically acceptable carrier is 1 (1-50).

18. Use of the siRNA of any one of claims 1 to 15 and/or the pharmaceutical composition of any one of claims 16 to 17 for the preparation of a medicament for treating or ameliorating a disease associated with COL1a1 gene expression;

preferably, the disease is selected from fibrotic disorders and/or fibrillogenic diseases;

more preferably, the disease is liver fibrosis, kidney fibrosis, lung fibrosis, peritoneal fibrosis, vocal cord fibrosis, intestinal fibrosis, bone marrow fibrosis, cardiac fibrosis, fibrosis associated with cerebral infarction, abnormal scarring associated with all possible types of accidental or iatrogenic skin injury, scleroderma, glaucoma filtration failure, intestinal adhesions, cirrhosis or chronic liver injury.

19. A kit comprising the siRNA of any one of claims 1 to 15 and/or the pharmaceutical composition of any one of claims 16 to 17.