CN111378645A

CN111378645A - Gene synthesis method

Info

Publication number: CN111378645A
Application number: CN201811613214.0A
Authority: CN
Inventors: 李一凡; 邱蔚; 戴晓慧; 吴政宪
Original assignee: Jiangsu Genscript Biotech Co Ltd
Current assignee: Jiangsu Genscript Biotech Co Ltd
Priority date: 2018-12-27
Filing date: 2018-12-27
Publication date: 2020-07-07
Anticipated expiration: 2038-12-27
Also published as: CN111378645B; WO2020135669A1

Abstract

The invention provides a method for gene synthesis, which comprises the steps of dividing a plurality of target genes into a plurality of overlapping oligonucleotide sequences, adding enzyme digestion site sequences and label sequences at the ends of the overlapping oligonucleotide sequences, wherein the label sequences are different due to different target genes; the overlapping oligonucleotide sequence connected with the label sequence is specifically connected with the magnetic bead connected with the reverse complementary sequence of the label sequence in a single-stranded form through a double-stranded structure, then the single-stranded overlapping oligonucleotide is obtained through enzyme digestion in a water-in-oil system, and then the polymerase chain assembly is carried out, so as to obtain a plurality of target gene fragments.

Description

Gene synthesis method

Technical Field

The invention relates to a method for synthesizing genes, in particular to a method for simultaneously synthesizing a plurality of different genes.

Background

Gene synthesis is an important enabling technology for the continuous and rapid development of modern biotechnology, and it is very critical whether genes with lower price can be obtained with lower cost and higher flux. In recent years, chip-based DNA synthesis technology has been rapidly developed, so that researchers can obtain a large number of DNA sequences at a very low price. Meanwhile, some DNA synthesis techniques have been developed to enable the use of these inexpensive DNA libraries for gene synthesis (Large-scale de novo DNA synthesis: technologies and applications, Nat methods.2014May; 11(5): 499-507). However, most of the technologies so far need depoliving, and then target genes are synthesized separately, which results in relatively high downstream processing cost.

In 2018, Sriram Kosuri developed a multiplex gene synthesis method (Multiplexed genes in emulsions for expanding protein functions and polypeptides. science, 2018Jan 19; 359(6373):343-347), which enables synthetic primers of different genes to be adsorbed into different microspheres by magnetic beads through a delicate oligo library design, thereby enabling different genes to be synthesized in the same PCR reaction system. However, the primer design process of the method comprises two enzyme digestion steps, so that the whole process is particularly complicated; meanwhile, the design of a single primer needs to add two enzyme cutting sites twice respectively, so that the utilization rate of the length of the primer is very low; in addition, the method cannot be used for synthesizing a sequence containing the two enzyme sites in the sequence, so that the application of the method is very limited, and the flow of downstream processing is too complex, thereby limiting the wide application of the method.

Disclosure of Invention

The invention provides a method for synthesizing multiple genes, which comprises the following steps:

(1) dividing each target gene segment in a plurality of target gene segments to be synthesized into a plurality of overlapping oligonucleotide sequences, adding a modification sequence at the end of each overlapping oligonucleotide sequence to ensure that the overlapping oligonucleotide sequences can be specifically connected with magnetic beads in a single-stranded form, wherein the modification sequence comprises an enzyme cutting site sequence and a tag sequence, and the tag sequence is different due to different target gene segments;

(2) synthesizing overlapping oligonucleotide sequences with the modified sequences;

(3) specifically linking the overlapping oligonucleotide sequences with the modified sequences to the magnetic beads; the magnetic beads are connected with a reverse complementary sequence of the tag sequence, and the specific connection is that a double-chain structure is formed by the tag sequence and the reverse complementary sequence;

(4) obtaining single-chain overlapping oligonucleotide sequences by enzyme digestion, and then carrying out Polymerase Chain Assembly (PCA) to obtain various target gene fragments;

wherein the enzyme digestion and polymerase chain assembly are carried out in a water-in-oil system.

In some embodiments, only one magnetic bead is included in each of the at least one water-in-oil system.

In some embodiments, the buffers and reagents required for the cleavage and PCA reactions are added prior to cleavage and added to the oily medium, with shaking to form a water-in-oil system.

In some embodiments, each target gene fragment has a universal primer at both ends.

In some embodiments, the cleavage is by an endonuclease, preferably the BspQI enzyme.

In some embodiments, the tag sequence comprises 10 to 100 bases, preferably 15 to 70 bases, more preferably 20 to 40 bases, and most preferably 20 to 30 bases.

In some embodiments, each overlapping oligonucleotide sequence comprises 40-150 bases; preferably 50 to 130 bases; more preferably 60-110 bases; still more preferably 65-90 bases; most preferably 65-80 bases.

In some embodiments, the overlapping oligonucleotide sequences comprise overlapping bases, the number of overlapping bases being 10-100; preferably 10 to 70; more preferably 10 to 50; more preferably 10 to 30; more preferably 10 to 20; most preferably 15-16.

In some embodiments, the magnetic beads are linked to the reverse complement of the tag sequence by streptavidin-biotin.

In some embodiments, the method for multiple gene synthesis further comprises the step of purifying the plurality of target gene fragments after polymerase chain assembly.

In some embodiments, the polygene synthesis method further comprises the step of amplifying the obtained plurality of target gene fragments.

Drawings

The present invention will be more fully understood from the detailed description given below in conjunction with the accompanying drawings.

FIG. 1 is a schematic representation of overlapping oligonucleotide sequences;

FIG. 2 is an electrophoretogram of a target synthetic sequence;

FIG. 3 is the sequencing result of the target synthetic sequence Gene 1;

FIG. 4 is the sequencing result of the target synthetic sequence Gene 2;

FIG. 5 is the sequencing result of the target synthetic sequence Gene 3.

Detailed Description

The invention provides a method for synthesizing multiple genes, which solves the technical problem that the primer design is too complicated in the synthesis of multiple genes in the prior art.

The invention provides a polygene synthesis method, as shown in figure 1, firstly dividing a double-stranded target gene fragment into a plurality of overlapping oligonucleotide sequences, adding a modification sequence to each overlapping oligonucleotide sequence, namely adding a restriction enzyme site sequence and a tag sequence at the end part of each overlapping oligonucleotide sequence; respectively synthesizing an overlapping oligonucleotide sequence added with a modified sequence and a reverse complementary sequence of a tag sequence, and connecting the magnetic beads with the reverse complementary sequence of the tag sequence; allowing the tag sequence and its reverse complement to form a double-stranded structure, thereby allowing the modified overlapping oligonucleotide sequence to be captured by the magnetic bead, wherein the overlapping oligonucleotide sequence is present in single-stranded form; obtaining single-stranded overlapping oligonucleotide sequences by enzyme digestion; then, performing Polymerase Chain Assembly (PCA) to obtain a plurality of target gene fragments; the enzymatic cleavage and Polymerase Chain Assembly (PCA) are carried out in a water-in-oil system.

In the present invention, the overlapping oligonucleotide sequences are segmented from double-stranded target gene fragments based on the principle of Polymerase Chain Assembly (PCA), the oligonucleotide sequence obtained by segmenting one strand is partially reverse-complementary to the oligonucleotide sequence obtained by segmenting the reverse complementary strand thereof, and the reverse-complementary portions are located at both ends of the oligonucleotide sequence, as shown in fig. 1. Specifically, the overlapping oligonucleotide sequence of the present invention is an oligonucleotide sequence which is obtained by dividing a double-stranded target gene fragment and can synthesize the entire target gene fragment by the PCA reaction.

In some embodiments, the overlapping oligonucleotide sequences have a number of bases ranging from 40 to 150 bases or any range thereof; preferably 50 to 130 bases; more preferably 60-110 bases; still more preferably 65-90 bases; most preferably 65-80 bases. The number of bases of the overlapping oligonucleotide sequence may specifically be selected from, but not limited to, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 1200, 125, 130, 135, 140, 145, 150 bases.

In some embodiments, the overlapping oligonucleotide sequences have 65-80 bases.

In some embodiments, the overlapping oligonucleotide sequences comprise overlapping bases, the number of overlapping bases being 10-100; preferably 10 to 70; more preferably 10 to 50; more preferably 10 to 30; most preferably 10-20. In the present invention, "overlapping bases" refers to bases that are complementary to each other and are connected at the ends of two adjacent overlapping oligonucleotide sequences.

In some embodiments, the overlapping oligonucleotide sequences comprise overlapping bases in the number of 15-16.

In the present invention, each overlapping oligonucleotide sequence is added with a modification sequence in order to allow specific attachment to a magnetic bead in a single-stranded form. The modification sequence may be attached to the 5 'end or 3' end of the overlapping oligonucleotide sequence. The modified sequence comprises a restriction enzyme site sequence and a label sequence. For this purpose, a cleavage site sequence and a tag sequence may be added to the 5 'end or 3' end of each overlapping oligonucleotide sequence. Different tag sequences are used for different target gene fragments, so that overlapping oligonucleotide sequences from different target gene fragments are linked with the same tag sequence, overlapping oligonucleotide sequences from the same target gene fragment are linked with different tag sequences, and the overlapping oligonucleotide sequences of different target gene fragments are distinguished according to the tag sequences.

When a plurality of target gene fragments are synthesized simultaneously, each target gene fragment is divided into several overlapping oligonucleotide sequences. Different label sequences are used for different target gene fragments, overlapping oligonucleotide sequences added with the label sequences are synthesized and mixed, then the overlapping oligonucleotide sequences are captured by forming a double-stranded structure by the reverse complementary sequences of the label sequences on the magnetic beads and the label sequences, and the corresponding overlapping oligonucleotide sequences of the different target gene fragments are sorted and distinguished by the label sequences when captured by the magnetic beads.

Only one reverse complementary sequence is connected to one magnetic bead, so that the overlapping oligonucleotide sequences connected to the same magnetic bead have the same tag sequence, i.e., the overlapping oligonucleotide sequences connected to the same magnetic bead are all from the same target gene fragment, thereby separating the overlapping oligonucleotide sequences from different target gene fragments by means of magnetic bead-specific capture for subsequent further synthesis. Multiple identical reverse complement sequences can be attached to a single magnetic bead, thereby allowing multiple overlapping oligonucleotide sequences from the same target gene fragment to be captured on the same magnetic bead. In some embodiments, a sufficient number (e.g., more than 10) of beads can be attached to a single bead³More than 10⁴More than 10 or⁵And) the same reverse complement sequence such that at least one magnetic bead can capture all overlapping oligonucleotide sequences from the same target gene fragment.

Another function of the tag sequence is to link the overlapping oligonucleotide sequences to the magnetic beads. The magnetic beads are connected with the reverse complementary sequence of the tag sequence, and the tag sequence and the reverse complementary sequence can form a double-stranded structure, so that the overlapping oligonucleotide sequence is connected with the magnetic beads, and the overlapping oligonucleotide sequence connected with the magnetic beads is in a single-stranded state.

In some embodiments, the tag sequence has 10-100 bases, more preferably 15-70 bases, even more preferably 20-40 bases, and most preferably 20-30 bases.

In some embodiments, the tag sequence has a number of bases selected from, but not limited to, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30.

In some embodiments, the overlapping oligonucleotide sequences with modified sequences, and/or the reverse complement of the tag sequence, may be synthesized by any suitable means. Methods for synthesizing oligonucleotide sequences are well known in the art and may be, for example, synthesized on a chip, for example, by ink jet printing or photoactivation.

After the overlapping oligonucleotide sequences with modified sequences are synthesized, they can be mixed into a mixture of oligonucleotides. Overlapping oligonucleotide sequences from different target gene fragments can be mixed together and sorted in a subsequent step by magnetic beads with different reverse complementary sequences. For example, the chip synthesis from different target gene fragments with modified sequences of overlapping oligonucleotide sequences, from the chip collection of the sequence, in the collection of different target gene fragments of overlapping oligonucleotide sequences without distinction, can be mixed together, in the subsequent steps with different reverse complementary sequences of magnetic beads for sorting.

The magnetic beads may be linked to the reverse complement of the tag sequence by any possible means. Methods for attaching magnetic beads to sequences are well known in the art and can be attached, for example, by affinity adsorption. In some embodiments, the magnetic beads are linked to the reverse complement of the tag sequence via streptavidin-biotin. In some embodiments, there can be enough streptavidin on a bead (e.g., more than 10)³More than 10⁴More than 10 or⁵One) so that one bead can be ligated with a sufficient number of reverse complement sequences. Magnetic beads with multiple streptavidin can be prepared on their own or obtained commercially.

Methods for forming a double-stranded structure of a tag sequence and its reverse complement are well known in the art, and for example, annealing the tag sequence and its reverse complement can form a double-stranded structure.

After the modified overlapping oligonucleotide sequences are captured on the magnetic beads, the different magnetic beads can be separated and each target gene fragment synthesized separately. Separating the magnetic beads, cutting the overlapping oligonucleotide sequences from the magnetic beads in a separated system to obtain single-stranded overlapping oligonucleotide sequences, and performing polymerase chain assembly to obtain target gene fragments. Each separate system may contain all overlapping oligonucleotide sequences from the same target gene segment, and thus a complete target gene segment may be synthesized in a single separate system. Different systems can contain overlapping oligonucleotide sequences from different target gene fragments, and a plurality of different systems react simultaneously to obtain a plurality of different target gene fragments.

In some embodiments, the partitioned system may be a water-in-oil system. The magnetic beads are separated by a water-in-oil system. Each water-in-oil system contains magnetic beads with overlapping oligonucleotide sequences attached, buffers and reagents required for the enzymatic reaction, and buffers and reagents required for polymerase chain assembly. The double-stranded structure of the tag sequence and the reverse complementary sequence thereof and the single-stranded overlapping oligonucleotide sequence are separated by enzyme digestion in a water-in-oil system to obtain a single-stranded unmodified overlapping oligonucleotide sequence, and then polymerase chain assembly is carried out to obtain a target gene fragment.

Each water-in-oil system may contain all overlapping oligonucleotide sequences from the same target gene fragment, so that a complete target gene fragment may be synthesized in a separate system. Different water-in-oil systems may contain overlapping oligonucleotide sequences derived from different target gene fragments, and a plurality of such water-in-oil systems react simultaneously to obtain a plurality of target gene fragments simultaneously.

In some embodiments, each of the at least one water-in-oil system contains only overlapping oligonucleotide sequences of one target gene fragment, which are assembled in a PCA solution contained in the water-in-oil system, the assembly of which is not affected by overlapping oligonucleotide sequences of other target gene fragments. In some embodiments, each of the at least one water-in-oil system contains only one magnetic bead.

Buffers and reagents required for the enzymatic reaction, and buffers and reagents required for polymerase chain assembly were mixed with the magnetic beads prior to formation of the water-in-oil system. The water-in-oil system can be formed by any suitable method, for example by mixing a buffer with a water-incompatible solvent (e.g., an oily medium) and shaking to form a water-in-oil system. In some embodiments, a buffer can be added prior to the cleavage reaction, and the buffer containing the magnetic beads can be mixed with a water-incompatible solvent (e.g., an oily medium) and shaken to form a water-in-oil system prior to the cleavage reaction and polymerase chain assembly. In some embodiments, the agitation can be performed by adding a buffer to the magnetic beads prior to the enzymatic reaction and adding the buffer containing the magnetic beads to a water-incompatible solvent, such as an oily medium, or adding a water-incompatible solvent, such as an oily medium, to the buffer containing the magnetic beads to form a water-in-oil system.

Shaking a mixture of buffer and water-incompatible solvent (e.g. an oily medium) to minimize the formation of oil droplets (a water-in-oil system is in the form of oil droplets, and a water-in-oil system is one oil droplet), such that each of the at least one water-in-oil system contains only overlapping oligonucleotide sequences of one target gene fragment, or, further, such that each of the at least one water-in-oil system contains only one magnetic bead.

In some embodiments, the volume ratio of water-incompatible solvent (e.g., oily medium) to buffer at the time of mixing may be 3:1 to 10:1, preferably 5: 1. In some embodiments, the rotational speed of the oscillation may be 2000rpm to 4000rpm, preferably 2800 rpm.

In some embodiments, the added buffer may comprise buffers and reagents required for the enzymatic reaction. In some embodiments, the added buffer may comprise buffers and reagents required for polymerase chain assembly.

In some embodiments, the oily medium may comprise an oil and a surfactant. In some embodiments, the oil in the oily medium may be a mineral oil. In some embodiments, the surfactant in the oily medium may be selected from any one or more of Span, Tween and Triton X-100. In some embodiments, the surfactant in the oily medium may be a mixture of Span, Tween and Triton X-100. In some embodiments, the composition of the oily medium may be: span 4.5%, Tween 800.4%, Triton X-1000.05%, and mineral oil in balance, wherein the percentage is volume/volume ratio.

Cleavage of the overlapping oligonucleotide sequences from the magnetic beads can be performed by enzymatic cleavage using the cleavage sites attached to the overlapping oligonucleotide sequences. In some embodiments, the enzyme employed for enzymatic cleavage may be any enzyme capable of cleaving a single strand, selected from, but not limited to, endonucleases selected from, but not limited to, BspQI enzymes.

In some embodiments, the cleavage site sequence and the tag sequence may be linked at the 5 'end or the 3' end of the overlapping oligonucleotide sequence, wherein the cleavage site is located between the tag sequence and the overlapping oligonucleotide sequence.

In the present invention, polymerase chain reaction (PCA) is a technique known in the art, and is a method based on the principle of PCR, in which single-stranded oligonucleotides (see fig. 1 for a schematic diagram) partially overlapping each other and covering the entire target gene are used as primers and templates, and the target gene is finally obtained through multiple cycles of denaturation, annealing, and extension in the presence of polymerase.

In some embodiments, a universal primer can be ligated to both ends of each target gene fragment to allow amplification using the universal primer in subsequent amplification without additional primer design. In some embodiments, the universal primer F used may be CACGACTACAGTGAATAGGCAAGCG and the universal primer R used may be CGTCTGGGTAACATAACTATCTGGGAGG.

In some embodiments, after polymerase chain assembly, a purification step may also be included. In some embodiments, purification may include first breaking an emulsion of the water-in-oil system prior to purification recovery of the nucleic acid. Methods of demulsification are well known in the art and may be performed, for example, by centrifugation and extraction with water-saturated ether to remove oil, leaving an aqueous phase for purification recovery. Methods for purification of recovered nucleic acids are well known in the art and, for example, column recovery can be performed by commercially available kits, such as PCR clean up recovery kit.

In some embodiments, the methods of the invention may further comprise the step of further amplifying the synthesized target gene fragment. In some embodiments, each target gene fragment may be amplified by a universal primer. In some embodiments, a mixture of multiple target gene fragments can be amplified by universal primers. In some embodiments, the mixture of multiple target gene fragments may be amplified in the same amplification reaction.

The "at least one" in the present invention may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 100, at least 1000, or at least 10000.

In some embodiments, the gene synthesis procedure of the present invention can be divided into the following steps:

1. adding universal primer sequences at two ends of the target gene fragment, and dividing into a plurality of small overlapped fragments of 65-80bp by using primer design software;

2. adding a tag sequence and a BspQI restriction enzyme cutting site for a specific gene to the 5' end of each small overlapped fragment to finally form 92-102bp small fragments, synthesizing the small overlapped fragments and mixing the small fragments into an overlapped oligonucleotide mixture (Mix);

3. performing affinity adsorption on the magnetic beads of streptavidin and the reverse complementary sequence of the tag sequence connected with the biotin to form magnetic beads with the reverse complementary sequence of the tag sequence;

4. mixing the magnetic beads with the reverse complementary sequences of the tag sequences with the oligonucleotide mixture obtained in the step 2, and slowly annealing to ensure that the tag sequences on the overlapping oligonucleotide fragments and the reverse complementary sequences of the tag sequences on the magnetic beads form a double-stranded structure, so that 1 magnetic bead has all the overlapping oligonucleotide sequences required by the target gene synthesis;

5. adding the magnetic beads into a Polymerase Chain Assembly (PCA) system, adding BspQI at the same time, slowly adding the PCA system containing the BspQI into a 5-volume oily-medium (oil-surfactant) incompatible with water, and violently shaking (rotating speed of 2800rpm) to form a water-in-oil structure; subpackaging the emulsion into PCR tubes, performing enzyme digestion, and performing polymerase chain reaction (PCA);

emulsion breaking is carried out on the emulsion after the PCA reaction, and then purification and recovery are carried out to obtain a PCA product;

7. and carrying out PCR by using the universal primer to obtain the target gene target fragment.

It will be appreciated by those skilled in the art that some steps in the above-described protocol are not required to be performed sequentially, and thus the order of some steps may be reversed at will, for example, the step of obtaining a mixture of overlapping oligonucleotides (including

steps

1 and 2 above) and the step of obtaining magnetic beads with the reverse complement of the tagged sequence (step 3 above) may be performed in any order.

In a preferred embodiment, the multigene synthesis is carried out by:

1. adding universal primer sequences at two ends of a target gene fragment to be synthesized, and dividing the fragment to be synthesized into a plurality of small fragments of 65-80bp by using primer design software;

in order to synthesize a plurality of target gene fragments in one system, universal primer sequences are added to two ends of the target gene fragment to be synthesized respectively as final sequences; adding a universal primer sequence at the 5' end: CACGACTACAGTGAATAGGCAAGCG, respectively; adding a universal primer sequence at the 3' end: CCTCCCAGATAGTTATGTTACCCAGACG, respectively; putting the gene segment to be synthesized with the universal primer into corresponding design software, setting the length of each overlapping oligonucleotide sequence to be 65-80bp, and the length of overlapping bases (overlap) between the overlapping oligonucleotide sequences to be 15bp, so as to obtain a plurality of disassembled overlapping oligonucleotide sequences. Note: a universal primer F: CACGACTACAGTGAATAGGCAAGCG, respectively; a universal primer R: CGTCTGGGTAACATAACTATCTGGGAGG, respectively;

2. adding specific sequences to both ends of the obtained overlapping oligonucleotide sequence and synthesizing

BspQI locus is added to the 5 'end of all the overlapping oligonucleotide sequences of the same target gene fragment, and then a tag sequence is added to the 5' end of the BspQI locus (the same tag sequence is used for all the overlapping oligonucleotide sequences of the same gene); specifically, BspQI site was added to the 5 'end of all overlapping oligonucleotide sequences of Gene1 and tag sequence 1 was added to the 5' end of BspQI site; BspQI site is added to 5 'end of all primers of gene2, and then tag sequence 2 is added to 5' end of BspQI site; and so on;

the reverse complementary sequence of the tag sequence 1 is defined as D1-R, the reverse complementary sequence of the tag sequence 2 is defined as D2-R, and biotin modification is added at the 3' end of the sequence;

chemically synthesizing the designed oligonucleotides, and mixing the synthesized overlapping oligonucleotides with the enzyme cutting sites and the label sequences into an oligonucleotide mixture (Mix);

3. carrying out affinity adsorption on the magnetic beads with streptavidin and the reverse complementary sequence of the biotin-tag sequence to form magnetic beads with the reverse complementary sequence of the tag sequence;

specifically, biotin-modified D1-R and D2-R, etc. are incubated with streptavidin-containing magnetic beads, respectively, so that the biotin-modified D1-R and D2-R, etc. are adsorbed on the surfaces of the magnetic beads;

4. mixing the magnetic beads with the reverse complementary sequences of the tag sequences and the oligonucleotide mixture together, and slowly annealing to ensure that the tag sequences on the oligonucleotides and the reverse complementary sequences form a partial double-stranded structure, so that 1 magnetic bead has all the oligonucleotides required by the synthesis of one target gene fragment;

because the 5' end of each overlapping oligonucleotide fragment is added with a tag sequence, a plurality of reverse complementary sequences with the tag sequence are combined on the magnetic beads, and the tag sequence and the reverse complementary sequence form right reverse complementarity, all the overlapping oligonucleotide fragments can be combined on the magnetic beads through annealing; the overlapping oligonucleotide fragment required for synthesizing one target gene fragment can only be combined with a specific magnetic bead;

5. adding the magnetic beads combined with the overlapped oligonucleotide fragments into a PCA system, adding BspQI at the same time, slowly adding a PCR system containing BspQI into 5 times of volume of oil-surfactant and violently shaking (the rotating speed is 2800rpm) to form a water-in-oil structure;

the annealed structure contained 1 BspQI cleavage site. All the overlapped oligonucleotide fragments can be cut off from the magnetic beads by enzyme digestion, and the target gene fragments can be assembled into the required target gene fragments by PCA; at least one oil drop exists in the oil drops formed by oscillation and can only contain one magnetic bead, all the overlapping oligonucleotide fragments are assembled in the PCA solution contained in the oil drops, and the assembly of the overlapping oligonucleotide fragments cannot be influenced by the overlapping oligonucleotide fragments of other target gene fragments;

6. demulsifying the emulsion, purifying and recovering to obtain a PCA product;

specifically, removing oil by centrifugation and water saturated ether extraction, and purifying by a column to obtain a PCA product;

7. carrying out PCR by using a universal primer to obtain a target fragment;

specifically, the PCA product obtained in the above step is used as a template, and a universal primer F and a universal primer R are used for PCR to obtain a target product.

In the present invention, the target gene fragment can be divided into several overlapping oligonucleotide sequences using conventional primer design software, such as those readily available to those skilled in the arthttps:// Primerize.stanford.edu/.

The method of the invention is simpler and more convenient in primer design, only one enzyme digestion step is needed for obtaining the primer, the time is saved, the efficiency is high, the reagent is saved, and the gene synthesis efficiency is improved.

The technical solution of the present invention will be described in further detail below by way of examples with reference to the accompanying drawings, but the present invention is not limited to the following examples.

Example 1 segmentation of 3 genes to be synthesized

The 3 DNA sequences to be synthesized were first numbered and named Gene1, Gene2, Gene3, respectively. In order to facilitate the subsequent amplification by using the universal primer, the universal primer sequences are respectively added at two ends of each gene:

adding a universal primer sequence at the 5' end: CACGACTACAGTGAATAGGCAAGCG, respectively;

adding a universal primer sequence at the 3' end: CCTCCCAGATAGTTATGTTACCCAGACG, respectively;

the underlined sections are the added sequences.

Gene1

CACGACTACAGTGAATAGGCAAGCGTGTCGTGATGACCCAGACTCCAGTCTCCGTGGAGGCAGCTGTGGGAGGCACAGTCACCATCAAGTGCCAGGCCAGTCAGAGCATTAATGGTAATTTAGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCCTGATCTACAGGGCATCCACTCTGGAATCTGGAATCCCATCGCGGTTCAAAGGCAGTAGACCTGGGACAGAGTACACTCTCACCATCAGCGACCTGGAGTGTGCCGATGCTGCCACTTACTACTGTCAATGCACTTATGGTAGTAGTAGTAGTAGTAGTTATAGTGGTGCTTTCGGCGGAGGGACCGAGGTGGTGGTCAAAGGCGATCCTGTTGCTCCTACCCTCCCAGATAGTTATGTTACCCAGACG

Gene2

CACGACTACAGTGAATAGGCAAGCGCCAATGAAGACAGAATTCGGTCTCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCAGCATAATCCGCTCCTGGTGAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGTGCACCCTCGCTCACCAAGGTTTAAGAGCTATGCTGAAGTCTTCCCAATCCTCCCAGATAGTTATGTTACCCAGACG

Gene3

CACGACTACAGTGAATAGGCAAGCGCAGTCTTTGGAGGAGTCCGGGGGAGACCTGGTCAAGCCTGGGGCATCCCTGACACTCACCTGCACAGCCTCTGGATTCTCCTTCAGTAGCAATTATTACATGTGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGATCGCGTGCATTGATGGTGGTAGTGCTACTAGTACTTACTACGCGAGCTGGGCGAAAGGCCGATTCACCATCTCCAAGTCCTCGTCGACCACGGTGACTCTGCAAATGACCAGTCTCACAGCCGCGGACACGGCCACCTATTTCTGTGCGAGATCCCCCCTTTATGTTGATTACGGCATGGACCTCTGGGGCCCAGGGACCCTCGTCACCGTCTCTTCAGGACAACCTAAGGCTCCCTCCCTCCCAGATAGTTATGTTACCCAGACG

Inputting the Gene sequence added with the universal primer region in corresponding primer design software, setting the overlap length to be 15-16bp, and the length of a single primer to be 65-80bp, so as to obtain the overlapping oligonucleotide (oligo) sequence required by Gene synthesis, wherein because of more oligos, only 8 oligo sequences designed by the software of Gene1 are shown below:

Gene1_1

CACGACTACAGTGAATAGGCAAGCGTGTCGTGATGACCCAGACTCCAGTCTCCGTGGAGGCAGCTGTGGG

Gene1_2

AATTACCATTAATGCTCTGACTGGCCTGGCACTTGATGGTGACTGTGCCTCCCACAGCTGCCTCC

Gene1_3

CAGTCAGAGCATTAATGGTAATTTAGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCC

Gene1_4

TTTGAACCGCGATGGGATTCCAGATTCCAGAGTGGATGCCCTGTAGATCAGGAGCTTGGGAGGCT

Gene1_5

CCCATCGCGGTTCAAAGGCAGTAGACCTGGGACAGAGTACACTCTCACCATCAGCGACCTGGAGT

Gene1_6

ACTACTACTACCATAAGTGCATTGACAGTAGTAAGTGGCAGCATCGGCACACTCCAGGTCGCTGAT

Gene1_7

ATGCACTTATGGTAGTAGTAGTAGTAGTAGTTATAGTGGTGCTTTCGGCGGAGGGACCGAGGTGG

Gene1_8

CGTCTGGGTAACATAACTATCTGGGAGGGTAGGAGCAACAGGATCGCCTTTGACCACCACCTCGGTCCCTC

example 2 Synthesis of oligo sequences with specific sequences added to both ends

In order to separate all the oligos of one gene independently from the oligo mix synthesized on the chip, it is necessary to add a specific sequence to the 5' ends of all the oligos of the same gene, and a BspQI recognition site between the oligos and the specific sequence: gccttca.

The specific oligo sequences were changed to:

Gene1_1

ATAGATGCCGTCCTgctcttcaCACGACTACAGTGAATAGGCAAGCGTGTCGTGATGACCCAGACTCCAGTCTCCGTGGAGGCAGCTGTGGG

Gene1_2

ATAGATGCCGTCCTgctcttcaAATTACCATTAATGCTCTGACTGGCCTGGCACTTGATGGTGACTGTGCCTCCCACAGCTGCCTCC

Gene1_3

ATAGATGCCGTCCTgctcttcaCAGTCAGAGCATTAATGGTAATTTAGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCC

Gene1_4

ATAGATGCCGTCCTgctcttcaTTTGAACCGCGATGGGATTCCAGATTCCAGAGTGGATGCCCTGTAGATCAGGAGCTTGGGAGGCT

Gene1_5

ATAGATGCCGTCCTgctcttcaCCCATCGCGGTTCAAAGGCAGTAGACCTGGGACAGAGTACACTCTCACCATCAGCGACCTGGAGT

Gene1_6

ATAGATGCCGTCCTgctcttcaACTACTACTACCATAAGTGCATTGACAGTAGTAAGTGGCAGCATCGGCACACTCCAGGTCGCTGAT

Gene1_7

ATAGATGCCGTCCTgctcttcaATGCACTTATGGTAGTAGTAGTAGTAGTAGTTATAGTGGTGCTTTCGGCGGAGGGACCGAGGTGG

Gene1_8

ATAGATGCCGTCCTgctcttcaCGTCTGGGTAACATAACTATCTGGGAGGGTAGGAGCAACAGGATCGCCTTTGACCACCACCTCGGTCCCTC

the final sequence of 8 oligos in Gene1 was shown above, and the underlined sequence was added to the 5' end.

Based on the above oligo sequence, reverse complementary biotin-linked oligo was designed, and the following table 1 shows the sequences added to the 5' ends of 3 genes and their corresponding biotin-modified R sequences.

Sequences added at the' end of Table 15 and the biotin-modified R sequences corresponding thereto

	Sequence of
		Gene1	ATAGATGCCGTCCTgctcttca
Gene2	GTGGGTAAATGGTAgctcttca
		Gene3	CGACGGGGAGTATAgctcttca

		Gene1-R	tgaagagcAGGACGGCATCTAT-Biotin
Gene2-R	tgaagagcTACCATTTACCCAC-Biotin
		Gene3-R	tgaagagcTATACTCCCCGTCG-Biotin

All the sequences designed above were synthesized by chemical synthesis.

Example 3 binding of the Biotin oligo to streptavidin magnetic beads

Mu.l of streptavidin magnetic beads were washed 3 times with washing buffer (10mM Tris-HCl, pH 7.5, 1mM EDTA, 2.0M NaCl), resuspended with 45. mu.l of 1 × HF buffer (buffer from Phusion polymerase from NEB), and 100pmol Gene1-R primer was added to make the final volume 50. mu.l. Shaking (2200rpm) overnight at room temperature 25 ℃ the following day washing with washing buffer removed the biotin oligo not bound to the magnetic beads. In this way, 3 magnetic Beads (Gene-R-Beads) carrying biotin oligo were obtained and named Gene1-R-Beads, Gene2-R-Beads, and Gene3-R-Beads, respectively.

Example 4 annealing

3 magnetic Beads Gene1-R-Beads, Gene2-R-Beads, Gene3-R-Beads, etc. were mixed together in equal proportions and resuspended in 20. mu.l of water, and mixed together with 3 genes of oligo mix. The following 50. mu.l system was prepared: 5 HF Buffer 10. mu.l, 3 kinds of Biotin oligo-linked magnetic bead mixture 2. mu.l, 3 genes oligo mix 0.9pmol (single primer concentration, excess of added primer required), H₂O to 50. mu.l. The following reactions were carried out in a shaker 2200rpm and the annealing program was as follows: incubating at 50 deg.C for 3 hr, cooling to 40 deg.C at 0.1 deg.C/s for 3 hr, cooling to 30 deg.C at 0.1 deg.C/s for 3 hr, cooling to 20 deg.C at 0.1 deg.C/s, and maintainingAfter 2 hours, the temperature is reduced to 10 ℃ at the rate of 0.1 ℃/s and maintained for 2 hours. After the annealing, the product was washed 3-4 times with Elution buffer (Elution buffer) to remove unbound oligos, and finally 20. mu. l H was used₂And O is suspended.

Example 5 cleavage and PCA

The following enzyme digestion and PCA systems were prepared: 5 HF buffer 20. mu.l, dNTPs (10mM each) 2. mu.l, BSA (20mg/ml) 2. mu.l, Phusion (2U/. mu.l polymerase NEB Inc.) 2.5. mu.l, universal primer F (25. mu.M) 2. mu.l, universal primer R (25. mu.M) 2. mu.l, BspQI 4. mu.l, sterile water to 100. mu.l system.

Mu.l of the solution system of example 4 was added dropwise to 500. mu.l of oil-surfactant (Span 4.5%, Tween 800.4%, Triton X-1000.05%, the remainder being Mineral oil, all in volume/volume%) and vortexed at a maximum speed of 2800rpm in a shaker (Vortex-5, Lenbell instruments, Haimen) during the addition to form a water-in-oil structure. Subpackaging the final water-in-oil emulsion system into PCR tubes, and carrying out reaction according to the following procedures: enzyme digestion is carried out for 90min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 40s, 60 cycles, and final extension reaction at 72 ℃ for 5 min.

Example 6 purification

Merging the emulsion in the PCR tubes after the reaction into a 1.5ml centrifuge tube again, firstly centrifuging at 12000rpm for 10min, and removing the upper oil layer after the reaction is finished; adding 1.5ml of water saturated ether, oscillating and mixing uniformly, centrifuging at 1000rpm for 10s, and removing the ether layer on the upper layer; adding 1.5ml of water saturated ether again, oscillating and mixing uniformly, centrifuging at 1000rpm for 10s, removing the ether layer on the upper layer, and removing the ether layer as clean as possible in the step; the remaining aqueous phase was column recovered using a PCR clean up recovery kit and finally eluted with 30. mu.l of sterile water leaving the product to be used.

Example 7 PCR Using Universal primers to obtain fragments of interest

The product obtained by the column purification was used as a template for continuing the PCR according to the following system: 5 HF buffer 10. mu.l, dNTPs (10mM each) 1. mu.l, Phusion (2U/. mu.l, NEB Inc.) 0.5. mu.l, universal primer F (25. mu.M) 1. mu.l, universal primer R (25. mu.M) 1. mu.l, sterile water to 50. mu.l system. The reaction procedure is as follows: pre-denaturation at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 70 ℃ for 15s, extension at 72 ℃ for 45s, 25 cycles; finally, extension reaction is carried out for 5min at 72 ℃. After the reaction, the products were subjected to electrophoresis detection and sanger sequencing, and the results are shown in FIGS. 2 to 5. As can be seen from the sequencing results of FIGS. 3 to 5, the sequencing results were completely consistent with the target gene sequence, and this example successfully completed the simultaneous synthesis of three genes.

The embodiments of the present invention are not limited to the above-described examples, and various changes and modifications in form and detail may be made by those skilled in the art without departing from the spirit and scope of the present invention, and these are considered to fall within the scope of the present invention.

Claims

1. A method of multi-gene synthesis, the method comprising:

(4) obtaining single-chain overlapping oligonucleotide sequences through enzyme digestion, and then carrying out polymerase chain assembly to obtain various target gene fragments;

2. The method of claim 1, wherein at least one water-in-oil system comprises only one magnetic bead per water-in-oil system.

3. The method of claim 1 or 2, wherein a buffer solution and a reagent required by enzyme digestion and PCA reaction are added before enzyme digestion, mixed with an oily medium and vibrated to form a water-in-oil system;

preferably, the volume of liquid mixed with the oily medium to the volume of the oily medium is 1: 5; the rotational speed of the oscillation was 2800 rpm.

4. The method of any one of claims 1-3, wherein each target gene fragment has a universal primer at both ends.

5. The method of any of claims 1-4, wherein the cleavage is by an endonuclease, preferably BspQI enzyme.

6. The method of any one of claims 1-5, wherein the tag sequence comprises 10-100 bases, preferably 15-70 bases, more preferably 20-40 bases, most preferably 20-30 bases.

7. The method of any one of claims 1-6, wherein the overlapping oligonucleotide sequences comprise 40-150 bases; preferably 50 to 130 bases; more preferably 60-110 bases; more preferably 65-90 bases; most preferably 65-80 bases.

8. The method of any one of claims 1-7, wherein the overlapping oligonucleotide sequences comprise overlapping bases, the number of overlapping bases being 10-100; preferably 10 to 70; more preferably 10 to 50; more preferably 10 to 30; more preferably 10 to 20; most preferably 15-16.

9. The method of any one of claims 1-8, wherein the magnetic beads are linked to the reverse complement of the tag sequence by streptavidin-biotin.

10. The method of claims 1-9, further comprising the step of purifying the plurality of target gene fragments after polymerase chain assembly.

11. The method of claims 1-10, further comprising the step of amplifying the obtained plurality of target gene fragments.