CN111378630A - Fusion protein and high-efficiency expression method and application thereof - Google Patents

Fusion protein and high-efficiency expression method and application thereof Download PDF

Info

Publication number
CN111378630A
CN111378630A CN202010274125.9A CN202010274125A CN111378630A CN 111378630 A CN111378630 A CN 111378630A CN 202010274125 A CN202010274125 A CN 202010274125A CN 111378630 A CN111378630 A CN 111378630A
Authority
CN
China
Prior art keywords
fusion protein
atsus1
rsugt72b14
escherichia coli
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010274125.9A
Other languages
Chinese (zh)
Inventor
薛飞燕
马兰青
杨明峰
姜梦嫣
黄丽娜
彭程
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing University of Agriculture
Original Assignee
Beijing University of Agriculture
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing University of Agriculture filed Critical Beijing University of Agriculture
Priority to CN202010274125.9A priority Critical patent/CN111378630A/en
Publication of CN111378630A publication Critical patent/CN111378630A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1062—Sucrose synthase (2.4.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1066—Sucrose phosphate synthase (2.4.1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01013—Sucrose synthase (2.4.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01014—Sucrose-phosphate synthase (2.4.1.14)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Abstract

The invention discloses a fusion protein and a high-efficiency expression method and application thereof. Belongs to the technical field of fusion protein. The fusion protein is AtSUS1-RsUGT72B14 fusion protein, and comprises core fragments of Arabidopsis sucrose synthase AtSUS1 and rhodiola sachalinensis uridine diphosphate glucosyltransferase RsUGT72B 14. According to the codon preference of escherichia coli, the sequence characteristics of AtSUS1 and RsUGT72B14 genes are combined, the sequence of GGSG four amino acid connecting peptides is introduced by designing an enzyme cutting site connection method, the optimized gene sequence of the AtSUS1-RsUGT72B14 fusion protein is obtained, the efficient expression of the AtSUS1-RsUGT72B14 fusion protein is realized, and the fusion protein can be used for catalytically synthesizing salidroside.

Description

Fusion protein and high-efficiency expression method and application thereof
Technical Field
The invention relates to the technical field of fusion proteins, in particular to a fusion protein and a high-efficiency expression method and application thereof.
Background
Sucrose synthase (SUS), one of the key enzymes in sucrose metabolism, can catalyze the reversible reaction of sucrose and UDP to fructose and UDPG, and is biased toward the sucrose cleavage reaction, for example, SUS1 can efficiently catalyze the decomposition of sucrose to UDPG. Uridine diphosphate glucosyltransferase (UGT), a modification that catalyzes the transfer of a glycosyl group from an activated donor molecule to an acceptor molecule. Glycosylation modification is usually the last step in the biosynthesis of natural compounds and can improve the water solubility, stability and bioactivity of natural products. UGT is an important enzyme in the synthetic pathway of secondary metabolites of glycosyl plants, such as UGT72B14 which can catalyze salidroside (and UDP byproduct) synthesized by tyrol and UDPG.
The fusion protein is a multifunctional novel protein obtained by connecting proteins encoded by a plurality of originally independent genes at a molecular level by using a DNA recombination technology. For example, a catalytic system of sucrose synthase (SUS) and uridine diphosphate glucosyltransferase (UGT) can be obtained by using a fusion technique, i.e., a cyclic regeneration system of UDPG is established. The arabidopsis sucrose synthase AtSUS1 can efficiently catalyze sucrose and UDP to generate fructose and UDPG; rhodiola sachalinensis uridine diphosphate glucosyltransferase RsUGT72B14 can efficiently catalyze tyrosol and UDPG to generate salidroside and UDP. Therefore, the regeneration of UDPG can be realized by constructing AtSUS1-RsUGT72B14 fusion protein, salidroside is synthesized by taking sucrose and tyrosol as substrates, and the addition of expensive UDPG as a reactant is avoided.
The AtSUS1 and RsUGT72B14 genes are both derived from plants, and have great difference with the codon usage preference of host escherichia coli, and the high-efficiency expression of the genes is difficult to realize by a conventional method.
In conclusion, the technical personnel in the field need to solve the problem of how to provide the AtSUS1-RsUGT72B14 fusion protein capable of being efficiently expressed.
Disclosure of Invention
In view of the above, the invention provides a fusion protein, and a high-efficiency expression method and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
a fusion protein is AtSUS1-RsUGT72B14 fusion protein, and the gene coding sequence of the fusion protein is shown as SEQ ID NO. 1.
The AtSUS1-RsUGT72B14 fusion protein comprises core fragments of an Arabidopsis sucrose synthase AtSUS1 and rhodiola sachalinensis uridine diphosphate glucosyltransferase RsUGT72B 14. According to the codon preference of escherichia coli, by combining the characteristics of AtSUS1 and RsUGT72B14 gene sequences, GGSG four amino acid connecting peptide sequences are introduced by designing an enzyme cutting site connection method, and an optimized AtSUS1-RsUGT72B14 fusion protein gene sequence is obtained.
The amino acid sequences encoding AtSUS1 and RsUGT72B14 were unchanged before and after optimization compared to the original sequences (GenBank accession numbers: NM-122090.4 and KX 262844.1); the optimized sequence of the AtSUS1 gene has 406 bases replaced, and the G + C content is increased from 45.5% to 49.5%; the optimized sequence of the RsUGT72B14 gene has 278 bases replaced, and the content of G + C is reduced from 56.75% to 51.05%; coli low frequency codon was absent in the optimized sequence.
A high-efficiency expression method of fusion protein comprises the following steps:
(1) synthesizing AtSUS1-RsUGT72B14 fusion protein gene;
(2) the AtSUS1-RsUGT72B14 fusion protein gene is connected with an expression vector to construct a recombinant plasmid;
(3) the recombinant plasmid is transformed into host escherichia coli for expression.
Preferably, the step (2) is to connect the AtSUS1-RsUGT72B14 fusion protein gene to an Escherichia coli expression vector pET-28a to obtain a recombinant vector pET28a-AtSUS1-4a-RsUGT72B 14.
Preferably, after the sequencing verification in the step (3), the recombinant plasmid is transformed into escherichia coli BL21 competent cells by using a heat shock method, and the recombinant escherichia coli E.coli/pET28a-AtSUS1-4a-RsUGT72B14 is obtained for expression.
Preferably, the first and second liquid crystal materials are,the expression conditions in the step (3) are as follows: recombinant Escherichia coli E.coli/pET28a-AtSUS1-4a-RsUGT72B14 was cultured in LB liquid medium to OD6000.6 to 0.8, adding 0.4 to 0.6mM inducer IPTG, and continuously culturing for 6 to 10 hours at the temperature of 16 to 20 ℃.
The fusion protein is applied to the synthesis of salidroside.
According to the technical scheme, compared with the prior art, the invention has the following beneficial effects: (1) the optimized AtSUS1-RsUGT72B14 fusion protein gene can realize high-efficiency expression in escherichia coli, and can construct a UDPG cyclic regeneration system to catalyze and synthesize salidroside; (2) the AtSUS1-RsUGT72B14 fusion protein gene provided by the invention has loose induced expression conditions, can realize high-efficiency expression, and the expression amount accounts for more than 60% of the total protein of the thallus; (3) the expressed AtSUS1-RsUGT72B14 fusion protein can improve the efficiency of catalyzing and synthesizing salidroside: under the same reaction condition, compared with the single use of the RsUGT72B14 protein, the use of the AtSUS1-RsUGT72B14 fusion protein can improve the output of salidroside obtained by in vitro enzymatic reaction by more than 50 percent and the output obtained by whole cell catalysis by 4 times.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 shows the results of agarose gel electrophoresis detection of AtSUS1 gene, RsUGT72B14 gene and AtSUS1-RsUGT72B14 fusion protein gene synthesized in steps (1) and (2) of example 1 of the present invention; wherein, FIG. 1a shows the result of agarose gel electrophoresis detection of AtSUS1 gene; FIG. 1B shows the result of agarose gel electrophoresis detection of RsUGT72B14 gene; FIG. 1c shows the result of agarose gel electrophoresis detection of AtSUS1-RsUGT72B14 fusion protein gene;
FIG. 2 is a schematic structural view of the recombinant vector pET28a-AtSUS1-4a-RsUGT72B14 in step (3) of example 1 of the present invention;
FIG. 3 is an SDS-PAGE result of the recombinant E.coli expression AtSUS1-RsUGT72B14 fusion protein in step (4) in example 1 of the present invention;
FIG. 4 is HPLC detection results in step (6) and example 2 in example 1 of the present invention, wherein FIG. 4a is HPLC detection result of salidroside standard in example 1, with salidroside response peak appearing at-4 min; FIG. 4B shows the HPLC detection result of catalytic product of AtSUS1-RsUGT72B14 fusion protein of example 1, showing a salidroside product response peak at-4 min, FIG. 4c shows the HPLC detection result of recombinant Escherichia coli whole cell catalytic product containing AtSUS1-RsUGT72B14 gene of example 2, showing a salidroside product response peak at-4 min;
FIG. 5 is a graph showing the results of the whole-cell catalytic synthesis of salidroside by recombinant Escherichia coli in example 2 of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The required medicament is a conventional experimental medicament purchased from a market channel; the unrecited experimental method is a conventional experimental method, and is not described in detail herein.
Example 1
The construction, expression and in vitro enzymatic catalysis and detection of fusion protein gene recombinant escherichia coli comprise the following specific implementation steps:
(1) AtSUS1 and RsUGT72B14 gene optimization: the preferred codon of E.coli was used to optimize the sequence without changing the amino acid sequence.
The optimized AtSUS1 nucleotide sequence is shown in SEQ ID NO. 2;
the optimized RsUGT72B14 nucleotide sequence is shown in SEQ ID NO.3, and the GenBank number is KU 523897.1.
(2) Construction of AtSUS1-RsUGT72B14 fusion Gene: between the AtSUS1 and RsUGT72B14 optimized gene sequences, a linker peptide sequence GGTGGATCCGGT containing a restriction site BamH I (GGATCC) and encoding four amino acids of GGSG was designed; SEQ ID NO. 4. The AtSUS1-RsUGT72B14 fusion protein gene was synthesized according to the sequence SEQ ID NO. 1.
Agarose gel electrophoresis detection of the AtSUS1 gene, RsUGT72B14 gene and AtSUS1-RsUGT72B14 fusion protein gene synthesized in the steps (1) and (2) is performed, and the result is shown in FIG. 1. As can be seen from the results in FIG. 1, the agarose gel electrophoresis detection result of the AtSUS1-RsUGT72B14 fusion protein gene is consistent with the theoretical prediction of 3858 bp.
(3) Constructing recombinant escherichia coli: the synthesized AtSUS1-RsUGT72B14 fusion protein gene was ligated between the restriction enzyme sites Nhe I and Xho I of the Escherichia coli expression vector pET-28a using T4DNA ligase to obtain a recombinant vector pET28a-AtSUS1-4a-RsUGT72B 14. The recombinant vector pET28a-AtSUS1-4a-RsUGT72B14 is shown in figure 2. After sequencing verification, the ligation product (i.e., the recombinant vector pET28a-AtSUS1-4a-RsUGT72B14) is transformed into competent cells of Escherichia coli BL21(DE3) by a heat shock method, a positive clone strain is selected and identified by bacteria liquid PCR to obtain recombinant Escherichia coli E.coli/pET28a-AtSUS1-4a-RsUGT72B14, and the recombinant Escherichia coli E.coli/pET28a of the pET-28a empty vector is constructed by the same method and is set as a negative control.
(4) Expression and detection of AtSUS1-RsUGT72B14 fusion protein: culturing the recombinant Escherichia coli in LB liquid culture medium to OD600At 0.6, 0.6mM inducer IPTG was added and the culture was continued at 20 ℃ for 6 hours. The induction culture fluid was collected and subjected to SDS-PAGE, and the results are shown in FIG. 3. As can be seen from FIG. 3, the detection result of E.coli/pET28a-AtSUS1-4a-RsUGT72B14 was that the band of interest was found at 141.4kDa, whereas the negative control E.coli/pET28a was not found. The expression amount of the AtSUS1-RsUGT72B14 fusion protein accounts for more than 60 percent of the total protein of the thallus by analyzing through Bandscan software.
(5) In-vitro catalytic reaction and result detection of AtSUS1-RsUGT72B14 fusion protein: recombinant E.coli/pET28a-AtSUS1-4a-RsUGT72B14 cells were collected and subjected to ultrasonication (400W, 1s intermittent at 5s intervals, 10min total time of disruption, ice bath operation), and the disruption solution was passed through Ni column and different concentrations (100, 2)00. 300, 500 and 1000mM), collecting eluate, dialyzing for 3 times to remove salt, and ultrafiltering and concentrating to OD by using 1MDTT280About 20mg/mL, AtSUS1-RsUGT72B14 fusion protein was obtained.
AtSUS1-RsUGT72B14 fusion protein 2. mu.g, tyrosol 200. mu.M, sucrose 200. mu.M, 10. mu.MUDP, 750. mu.M magnesium chloride and 0.1M potassium phosphate buffer (pH 7) were mixed to obtain a reaction system of 250. mu.L, reacted at 30 ℃ for 1 hour, and then the reaction was terminated by adding an equal volume of methanol to obtain a reaction solution.
(6) And (3) performing HPLC detection on catalytic products: freeze-drying the reaction solution, removing impurities, dissolving with isovolumetric chromatographic pure methanol, and detecting by HPLC: the detection wavelength is 275 nm;
the mobile phase is methanol (A) and water (B), the flow rate is 0.6ml/min, and gradient elution is carried out; gradient elution conditions were 30% (v/v) A5min, 0 → 70% A20min, 80 → 95% A3min, 95% A5 min. The same conditions of HPLC detection of salidroside standard are shown in FIG. 4.
As can be seen from the results in FIG. 4, the salidroside standard peaked at 4min (see FIG. 4 a). The reaction solution also peaked at-4 min (see FIG. 4B), which indicates that the AtSUS1-RsUGT72B14 fusion protein can catalyze tyrosol and sucrose (supplemented by UDP) to synthesize salidroside.
Example 2
The construction, expression, whole cell catalysis and detection of fusion protein gene recombinant escherichia coli comprise the following specific implementation steps:
obtaining recombinant escherichia coli by the same steps as the steps (1) to (3) of the example 1, performing induced expression for 6 hours, adjusting the temperature to 30 ℃ for reaction, adding 200 mu M of tyrosol, 200 mu M of sucrose and 10 mu MUDP, continuing culturing for 8-12 hours, collecting culture solution, performing ultrasonic disruption, performing freeze-drying treatment, extracting freeze-dried powder by using methanol with the same volume, performing HPLC detection by the same step (6) of the example 1 after membrane filtration and impurity removal, and obtaining a peak (shown in figure 4 c) after a result of-4 min, which shows that the AtSUS1-RsUGT72B14 fusion protein can also catalyze and synthesize salidroside in escherichia coli cells. Meanwhile, under the same reaction conditions, recombinant Escherichia coli containing only RsUGT72B14 gene is used alone to synthesize salidroside, and the result is shown in FIG. 5.
As can be seen from the results in FIG. 5, the recombinant Escherichia coli has been catalyzed and synthesized into salidroside in whole cells, and the yield of the recombinant Escherichia coli salidroside containing AtSU 1-RsUGT72B14 gene is 16.65mg/L, which is better than the yield of the recombinant Escherichia coli salidroside containing only RsUGT72B14 gene by 4.15 mg/L. Under the same reaction condition, compared with the single use of the RsUGT72B14 protein, the yield of the recombinant Escherichia coli whole cell catalysis can be improved by 4 times by the AtSUS1-RsUGT72B14 fusion protein.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> Beijing college of agriculture
<120> fusion protein, and high-efficiency expression method and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>3858
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggcaaacg ctgaacgcat gatcactcgt gtacatagcc aacgtgaacg tctgaacgag 60
actctggtta gcgaacgtaa cgaggttctg gcactgctgt ctcgtgtaga agccaaaggc 120
aaaggcatcc tgcaacagaa ccagatcatt gctgagttcg aagctctgcc tgaacagact 180
cgcaagaaac tggaaggtgg tccgttcttc gatctgctga aatccactca agaggcaatc 240
gttctgccac cttgggtagc actggctgtt cgtccacgtc ctggtgtatg ggaatacctg 300
cgtgtcaatc tgcatgcact ggtagtcgaa gaactgcaac cagctgagtt tctgcacttc 360
aaagaagagc tggttgatgg cgttaagaac ggtaacttca ctctggaact ggacttcgaa 420
ccgttcaatg catccattcc gcgtccaact ctgcacaagt acatcggtaa cggtgtagac 480
ttcctgaacc gtcatctgtc tgctaaactg ttccatgaca aagagagcct gcttccactg 540
ttgaagttcc tgcgtctgca ctctcatcag ggcaagaacc tgatgctgtc tgagaagatc 600
cagaacctga acactctgca acacactctg cgcaaagctg aagagtacctcgcagaactg 660
aagtccgaga ctctgtacga agagttcgaa gccaagttcg aagagatcgg tctggaacgt 720
ggttggggtg acaatgcaga acgtgtactg gacatgattc gtctgctctt ggatctgctg 780
gaagcaccgg acccgtgtac tctggagacc tttctgggtc gtgtaccgat ggtattcaac 840
gttgtgatcc tgtctccgca tggctacttc gctcaagaca acgtactggg ttatccggat 900
actggtggtc aggttgtgta cattctggat caagtacgtg ctctggagat cgagatgctg 960
caacgcatca agcagcaagg tctgaacatc aaaccgcgta ttctgatcct gactcgtctt 1020
ctgccagatg cagtaggtac tacctgtggt gaacgtctcg aacgcgttta cgactctgag 1080
tactgtgaca ttctgcgtgt accgttccgt actgagaaag gcatcgttcg caaatggatc 1140
tctcgtttcg aagtatggcc atatctggag acttacaccg aagatgctgc agttgagctg 1200
tccaaagagc tgaatggcaa accggatctg atcattggca actacagcga tggcaatctg 1260
gtagcatctc tgcttgctca caaactgggt gtcactcagt gtaccattgc tcatgcactg 1320
gagaagacca agtatccgga ttctgacatc tactggaaga agctggatga caagtaccat 1380
ttcagctgtc agttcactgc tgatatcttc gcaatgaacc acactgactt catcatcact 1440
agcactttcc aagagatcgc tggtagcaaa gagactgtag gtcagtacga atctcacact 1500
gccttcactc tgccaggtct gtatcgtgtc gttcacggta ttgacgtgtt cgatccgaag 1560
ttcaacatcg tctctcctgg tgctgatatg agcatctact ttccgtacac cgaagagaag 1620
cgtcgtctga ctaagttcca ctctgagatc gaagagctgc tgtacagcga tgtcgagaac 1680
aaagagcatc tgtgtgtact gaaagacaag aagaagccga ttctgttcac catggcacgt 1740
ctggatcgtg tcaagaacct gtctggtctc gttgagtggt acggtaagaa cactcgtctg 1800
cgtgaactgg ctaatctggt agtcgttggt ggtgatcgtc gcaaagagtc caaagacaac 1860
gaagagaaag cagagatgaa gaagatgtac gatctgatcg aagagtacaa gctgaacggt 1920
cagttccgtt ggatctctag ccagatggat cgtgtacgta acggtgaact gtatcgctac 1980
atctgtgaca ccaaaggtgc attcgtccaa ccggctctgt atgaagcctt tggtctgact 2040
gttgtagagg ctatgacttg tggtcttccg actttcgcaa cttgcaaagg tggtccagct 2100
gagatcattg tgcacggtaa atctggtttc cacatcgatc cgtaccatgg tgatcaggca 2160
gctgatactc tggcagactt cttcaccaag tgcaaagaag atccgtctca ctgggatgag 2220
atcagcaaag gtggtctgca acgcatcgaa gagaagtaca cttggcaaat ctactctcag 2280
cgtctgttga ctctgactgg tgtgtatggc ttctggaagc atgtctctaa tctggatcgt 2340
cttgaagctc gtcgctacct ggagatgttc tacgcactga agtatcgtcc actggcacag 2400
gctgtaccac ttgcacaaga cgatggtgga tccggtatgg ctggtagcgg tactggtgca 2460
ccgcatattg cactgctgcc gtctccaggt atgggtcatc tgattccgat ggctgagttc 2520
gctaaacgtc tggttcatca ccacaacttc accgtcacct tcatcattcc gactgacggt 2580
ccaccgtctg ctgcatatcg tcaagtactg gcaagcctgc cgacttccat ttcccacatc 2640
ttcctgccac ctgtcgatct gtccgacgta gttccgtctc atccacgtat cgaaactctg 2700
atctctctga ccgttgtacg ctctctgcca tctctgcaca acactatcgc atctctgctg 2760
gcatctaaaa acctggctgc actgttcgtt gacctgttcg gtactgacgc attcgatcca 2820
gccatcgatc tgggtgtatc tccgtacatc ttcttcccgt ctactgcaat gactctgtct 2880
ctgattctgc acatgccgga actggatcgt tccgttacct gcgaatatcg tcacatgact 2940
gatctggttc gtattccggg ttgcattccg attcgcggtt ctgatctgtt cgatccggta 3000
caagatcgta ccgatgaagc ttacaaacgt atcgtccatc atgccaaacg ttatccgatg 3060
gctgaaggta tcattgagaa cagcttcatg gaactggaac caggtgcact gaaatacctg 3120
cagtctgtag aacctggtcg tccaccggtc tatgcagttc gtccactgat caaaatggat 3180
tacgaagttg actcctctgg ttccaagatt atcgagtggc tggatggtca gccgattggc 3240
tctgtactgt tcatctcctt cggtagcggt ggcactctgt cctttgacca gatgaccgaa 3300
ctggcacatg gtctggaatc tagccagcaa cgtttcctgt gggtagttcg ttctccaagc 3360
ctgattccga atagcgcata cttcagcgct cagagccaga acgatccgct ggcttatctg 3420
ccggatggct ttctgaatcg taccagcgat cgtggtctgg tagttccgaa ttgggcaccg 3480
caagctcaga ttctgtctca tggttctact ggtggcttca tgagccattg cggttggaac 3540
agcattctgg agagcgtagt gtacggtgta ccgatcattg catggccact gtacgctgag 3600
cagaaaacta actccattat cgtcgttgaa gacgttaagg ttgcggtacg tccagcaggt 3660
gttggcgaag gtctggtaaa gcgtctggag gttgcgactg cagtgaaagc actgatggaa 3720
ggtgaagagg gtaagaaagt tcgtaatcgt atgcgtgatc tgaaagacgc tgcagctcgt 3780
gctatttgcg ttgacggtgc atctactaag gctattgctg aactggccaa gaaatggcgt 3840
agctctgtca agcattaa 3858
<210>2
<211>2424
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atggcaaacg ctgaacgcat gatcactcgt gtacatagcc aacgtgaacg tctgaacgag 60
actctggtta gcgaacgtaa cgaggttctg gcactgctgt ctcgtgtaga agccaaaggc 120
aaaggcatcc tgcaacagaa ccagatcatt gctgagttcg aagctctgcc tgaacagact 180
cgcaagaaac tggaaggtgg tccgttcttc gatctgctga aatccactca agaggcaatc 240
gttctgccac cttgggtagc actggctgtt cgtccacgtc ctggtgtatg ggaatacctg 300
cgtgtcaatc tgcatgcact ggtagtcgaa gaactgcaac cagctgagtt tctgcacttc 360
aaagaagagc tggttgatgg cgttaagaac ggtaacttca ctctggaact ggacttcgaa 420
ccgttcaatg catccattcc gcgtccaact ctgcacaagt acatcggtaa cggtgtagac 480
ttcctgaacc gtcatctgtc tgctaaactg ttccatgaca aagagagcct gcttccactg 540
ttgaagttcc tgcgtctgca ctctcatcag ggcaagaacc tgatgctgtc tgagaagatc 600
cagaacctga acactctgca acacactctg cgcaaagctg aagagtacct cgcagaactg 660
aagtccgaga ctctgtacga agagttcgaa gccaagttcg aagagatcgg tctggaacgt 720
ggttggggtg acaatgcaga acgtgtactg gacatgattc gtctgctctt ggatctgctg 780
gaagcaccgg acccgtgtac tctggagacc tttctgggtc gtgtaccgat ggtattcaac 840
gttgtgatcc tgtctccgca tggctacttc gctcaagaca acgtactggg ttatccggat 900
actggtggtc aggttgtgta cattctggat caagtacgtg ctctggagat cgagatgctg 960
caacgcatca agcagcaagg tctgaacatc aaaccgcgta ttctgatcct gactcgtctt 1020
ctgccagatg cagtaggtac tacctgtggt gaacgtctcg aacgcgttta cgactctgag 1080
tactgtgaca ttctgcgtgt accgttccgt actgagaaag gcatcgttcg caaatggatc 1140
tctcgtttcg aagtatggcc atatctggag acttacaccg aagatgctgc agttgagctg 1200
tccaaagagc tgaatggcaa accggatctg atcattggca actacagcga tggcaatctg 1260
gtagcatctc tgcttgctca caaactgggt gtcactcagt gtaccattgc tcatgcactg 1320
gagaagacca agtatccgga ttctgacatc tactggaaga agctggatga caagtaccat 1380
ttcagctgtc agttcactgc tgatatcttc gcaatgaacc acactgactt catcatcact 1440
agcactttcc aagagatcgc tggtagcaaa gagactgtag gtcagtacga atctcacact 1500
gccttcactc tgccaggtct gtatcgtgtc gttcacggta ttgacgtgtt cgatccgaag 1560
ttcaacatcg tctctcctgg tgctgatatg agcatctact ttccgtacac cgaagagaag 1620
cgtcgtctga ctaagttcca ctctgagatc gaagagctgc tgtacagcga tgtcgagaac 1680
aaagagcatc tgtgtgtact gaaagacaag aagaagccga ttctgttcac catggcacgt 1740
ctggatcgtg tcaagaacct gtctggtctc gttgagtggt acggtaagaa cactcgtctg 1800
cgtgaactgg ctaatctggt agtcgttggt ggtgatcgtc gcaaagagtc caaagacaac 1860
gaagagaaag cagagatgaa gaagatgtac gatctgatcg aagagtacaa gctgaacggt 1920
cagttccgtt ggatctctag ccagatggat cgtgtacgta acggtgaact gtatcgctac 1980
atctgtgaca ccaaaggtgc attcgtccaa ccggctctgt atgaagcctt tggtctgact 2040
gttgtagagg ctatgacttg tggtcttccg actttcgcaa cttgcaaagg tggtccagct 2100
gagatcattg tgcacggtaa atctggtttc cacatcgatc cgtaccatgg tgatcaggca 2160
gctgatactc tggcagactt cttcaccaag tgcaaagaag atccgtctca ctgggatgag 2220
atcagcaaag gtggtctgca acgcatcgaa gagaagtaca cttggcaaat ctactctcag 2280
cgtctgttga ctctgactgg tgtgtatggc ttctggaagc atgtctctaa tctggatcgt 2340
cttgaagctc gtcgctacct ggagatgttc tacgcactga agtatcgtcc actggcacag 2400
gctgtaccac ttgcacaaga cgat 2424
<210>3
<211>1422
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atggctggta gcggtactgg tgcaccgcat attgcactgc tgccgtctcc aggtatgggt 60
catctgattc cgatggctga gttcgctaaa cgtctggttc atcaccacaa cttcaccgtc 120
accttcatca ttccgactga cggtccaccg tctgctgcat atcgtcaagt actggcaagc 180
ctgccgactt ccatttccca catcttcctg ccacctgtcg atctgtccga cgtagttccg 240
tctcatccac gtatcgaaac tctgatctct ctgaccgttg tacgctctct gccatctctg 300
cacaacacta tcgcatctct gctggcatct aaaaacctgg ctgcactgtt cgttgacctg 360
ttcggtactg acgcattcga tccagccatc gatctgggtg tatctccgta catcttcttc 420
ccgtctactg caatgactct gtctctgatt ctgcacatgc cggaactgga tcgttccgtt 480
acctgcgaat atcgtcacat gactgatctg gttcgtattc cgggttgcat tccgattcgc 540
ggttctgatc tgttcgatcc ggtacaagat cgtaccgatg aagcttacaa acgtatcgtc 600
catcatgcca aacgttatcc gatggctgaa ggtatcattg agaacagctt catggaactg 660
gaaccaggtg cactgaaata cctgcagtct gtagaacctg gtcgtccacc ggtctatgca 720
gttcgtccac tgatcaaaat ggattacgaa gttgactcct ctggttccaa gattatcgag 780
tggctggatg gtcagccgat tggctctgta ctgttcatct ccttcggtag cggtggcact 840
ctgtcctttg accagatgac cgaactggca catggtctgg aatctagcca gcaacgtttc 900
ctgtgggtag ttcgttctcc aagcctgatt ccgaatagcg catacttcag cgctcagagc 960
cagaacgatc cgctggctta tctgccggat ggctttctga atcgtaccag cgatcgtggt 1020
ctggtagttc cgaattgggc accgcaagct cagattctgt ctcatggttc tactggtggc 1080
ttcatgagcc attgcggttg gaacagcatt ctggagagcg tagtgtacgg tgtaccgatc 1140
attgcatggc cactgtacgc tgagcagaaa actaactcca ttatcgtcgt tgaagacgtt 1200
aaggttgcgg tacgtccagc aggtgttggc gaaggtctgg taaagcgtct ggaggttgcg 1260
actgcagtga aagcactgat ggaaggtgaa gagggtaaga aagttcgtaa tcgtatgcgt 1320
gatctgaaag acgctgcagc tcgtgctatt tgcgttgacg gtgcatctac taaggctatt 1380
gctgaactgg ccaagaaatg gcgtagctct gtcaagcatt aa 1422
<210>4
<211>12
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ggtggatccg gt 12

Claims (6)

1. A fusion protein is characterized in that the fusion protein is AtSUS1-RsUGT72B14 fusion protein, and the gene coding sequence of the fusion protein is shown as SEQ ID NO. 1.
2. The method for expressing the fusion protein of claim 1, comprising the steps of:
(1) synthesizing AtSUS1-RsUGT72B14 fusion protein gene;
(2) the AtSUS1-RsUGT72B14 fusion protein gene is connected with an expression vector to construct a recombinant plasmid;
(3) the recombinant plasmid is transformed into host escherichia coli for expression.
3. The method for expressing a fusion protein of claim 2, wherein the step (2) is performed by ligating the AtSUS1-RsUGT72B14 fusion protein gene to E.coli expression vector pET-28a to obtain recombinant vector pET28a-AtSUS1-4a-RsUGT72B 14.
4. The method for expressing fusion protein of claim 2, wherein the step (3) is that after the sequencing verification, the recombinant plasmid is transformed into competent cells of Escherichia coli BL21 by heat shock method to obtain recombinant Escherichia coli E.coli/pET28a-AtSUS1-4a-RsUGT72B14 for expression.
5. The method for expressing a fusion protein according to claim 4, wherein the expression conditions in step (3) are as follows: recombinant Escherichia coli E.coli/pET28a-AtSUS1-4a-RsUGT72B14 was cultured in LB liquid medium to OD6000.6 to 0.8, adding 0.4 to 0.6mM inducer IPTG, and continuously culturing for 6 to 10 hours at the temperature of 16 to 20 ℃.
6. Use of the fusion protein of claim 1 for the synthesis of salidroside.
CN202010274125.9A 2020-04-09 2020-04-09 Fusion protein and high-efficiency expression method and application thereof Pending CN111378630A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010274125.9A CN111378630A (en) 2020-04-09 2020-04-09 Fusion protein and high-efficiency expression method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010274125.9A CN111378630A (en) 2020-04-09 2020-04-09 Fusion protein and high-efficiency expression method and application thereof

Publications (1)

Publication Number Publication Date
CN111378630A true CN111378630A (en) 2020-07-07

Family

ID=71213989

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010274125.9A Pending CN111378630A (en) 2020-04-09 2020-04-09 Fusion protein and high-efficiency expression method and application thereof

Country Status (1)

Country Link
CN (1) CN111378630A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106536536A (en) * 2014-05-05 2017-03-22 科纳根公司 Non-caloric sweetener

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106536536A (en) * 2014-05-05 2017-03-22 科纳根公司 Non-caloric sweetener

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FEIYAN XUE等: "expression of codon-optimized plant glycosyltransferase UGT72B14 in Escherichia coli enhances salidroside production", 《BIOMED RESEARCH INTERNATIONAL》 *
GENBANK: "KU523897.1", 《GENBANK》 *
GENBANK: "NM_122090.4", 《GENBANK》 *
姜梦嫣: "基于UDPG原位再生体系合成红景天苷的研究", 《中国优秀博硕士学位论文全文数据库（硕士）基础科学辑》 *

Similar Documents

Publication Publication Date Title
CN111712570B (en) Engineering strain for producing psicose and derivatives thereof, construction method and application thereof
JPH0669375B2 (en) Specific cleavage linker
KR101656063B1 (en) Expression system for psicose epimerase and production for psicose using the same
JP6638086B2 (en) Strain producing allose from fructose and method for producing allose using the same
CN107446874B (en) Recombinant escherichia coli and application thereof in synthesizing rebaudioside D
CN113174385B (en) Sucrose isomerase mutant with high activity and high conversion rate and application thereof
CN112662604B (en) Recombinant escherichia coli for synthesizing 3-fucosyllactose and construction method thereof
CN115261365B (en) Tryptophan synthase mutant and application thereof
EP3214176B1 (en) Expression system of psicose epimerase and production of psicose using same
KR101695830B1 (en) Expression system for psicose epimerase and production for psicose using the same
CN111424006B (en) Recombinant cell and application thereof in synthesizing alpha, beta-unsaturated aldehyde
CN108239632B (en) Mutant of D-psicose-3-epimerase with improved thermal stability and application thereof
CN111378630A (en) Fusion protein and high-efficiency expression method and application thereof
CN112746061A (en) Meso-diaminopimelate dehydrogenase mutants and uses thereof
CN110982808A (en) Kex2 enzyme variants and methods for stable expression
CN115287273A (en) 1, 2-fucosyltransferase and fusion protein and encoding gene thereof
EP4344437A1 (en) A genetically engineered bacterium and a preparation method and use thereof
CN111424065B (en) Method for glycosylating stevioside compounds by using glycosyltransferase
CN115612628A (en) Pichia pastoris, preparation method thereof and application of pichia pastoris in catalyzing sucrose to produce fructo-oligosaccharide
CN106119235A (en) A kind of DPE deriving from bulkholderia cepasea and application thereof
CN112941003A (en) Method for synthesizing L-alanine by catalyzing maleic acid through double-enzyme coupling whole cells
CN110066821B (en) Method for constructing random protein expression library based on random expression element multiplication mode
KR101669057B1 (en) Recombinant microoganisms for producing steviolmonoside and method for steviolmonoside using the same
CN117683801A (en) Multi-gene expression vector, D-amino acid and preparation method thereof
CN114958894B (en) Construction method and application of spermidine synthetic multienzyme complex based on CcmK2 fibrous protein

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20200707

RJ01 Rejection of invention patent application after publication