CN111363747A

CN111363747A - Circular RNA has _ circ _000918 and application thereof

Info

Publication number: CN111363747A
Application number: CN202010290248.1A
Authority: CN
Inventors: 陆国军; 张宇
Original assignee: Nanjing Brain Hospital
Current assignee: Nanjing Brain Hospital
Priority date: 2020-04-14
Filing date: 2020-04-14
Publication date: 2020-07-03

Abstract

The invention discloses a circular RNA hsa _ circ _0009618 and application thereof, wherein the nucleotide sequence of the circular RNA hsa _ circ _0009618 gene is shown as SEQ ID NO 1; in the early stage, the expression level of the hsa _ circ _0009618 gene is obviously increased by detecting the expression condition of the hsa _ circ _0009618 gene in lung adenocarcinoma tissues. In the invention, the lung adenocarcinoma cells transfected by the lentivirus with the hsa _ circ _0009618 gene are found to have obviously slower proliferation speed compared with the control lung adenocarcinoma cells. Hsa _ circ _0009618 expression was significantly increased in plasma of lung adenocarcinoma patients compared to healthy controls. The ROC curve shows that plasma hsa _ circ _0009618 has certain sensitivity and specificity for diagnosing lung adenocarcinoma, and provides a new diagnosis and prognosis judgment marker for lung adenocarcinoma.

Description

Circular RNA has _ circ _000918 and application thereof

Technical Field

The invention relates to the field of biological diagnosis, in particular to a circular RNAhsa _ circ _0009618 and application thereof.

Background

Primary lung cancer is a malignant tumor with a leading incidence and mortality worldwide. About 209 million patients are newly diagnosed with lung cancer worldwide each year, while about 180 million patients die of lung cancer. China occupies 30% of new cases every year in the world, and lung cancer becomes the most serious cause of death of malignant tumors in China. Despite the great advances in targeted and immunotherapy in recent years, the 5-year survival rate of lung cancer is still not 20%. Therefore, early diagnosis and search of new lung cancer diagnostic markers remain the research focus in the field of lung cancer at present.

Lung adenocarcinoma is the major pathological type of lung cancer, accounting for about 40%. Early pulmonary nodules can be found by imaging, such as breast CT screening, but the nature of the nodule cannot be judged. The pathology, although a gold standard for diagnosing lung cancer, is not suitable for physical examination screening. Therefore, the early lung cancer diagnosis rate is improved by combining tumor markers clinically. The sensitivity and specificity of the current lung adenocarcinoma diagnosis marker are not strong, for example, the sensitivity of the accepted lung adenocarcinoma diagnosis marker carcinoembryonic antigen (CEA) is only 30 percent, and the sensitivity is not increased in the early stage of lung cancer, so the diagnostic significance is not great. Therefore, there is a clinical need to find new diagnostic markers for lung cancer.

Circular RNA (circular RNA) is a specific class of recently identified non-coding RNA molecules. Unlike linear RNAs such as miRNA and lncRNA, circRNA is formed by reverse alternative splicing of a special site (back splicing) so that exon sequences of a gene are connected in an inverted first position, and a circular structure is formed by covalent bonding, and has no 5 'end and 3' end poly (A). Recent studies have shown that circRNA has the following important features: (1) the expression abundance is high: widely expressed in human cells, mainly in cytoplasm; (2) and (3) expression stabilization: the circRNA is in a closed ring structure, does not contain 5 'and 3' tail ends, is not easy to be degraded by exonuclease RNase R, and is more stable than linear RNA; (3) high conservation: most have highly conserved sequences, only a few are evolutionarily not conserved; (4) has certain tissue, time sequence and disease specificity. The characteristics of circRNA make it possible to be a new clinical diagnostic marker or target for human disease treatment.

Disclosure of Invention

The invention aims to provide annular RNAhsa _ circ _0009618 and application of the annular RNAhsa _ circ _0009618 in auxiliary diagnosis and prognosis judgment of lung adenocarcinoma based on hsa _ circ _ 0009618.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in one aspect, the invention provides a circular RNA hsa _ circ _0009618, wherein the nucleotide sequence of the circular RNA hsa _ circ _0009618 gene is shown as SEQ ID NO. 1. The structure of the circular RNA hsa _ circ _0009618 is a head-to-tail circular RNA structure formed by splicing after a linear nucleotide sequence is transcribed.

The genome of the circular RNA hsa _ circ _0009618 is positioned at chr1:8923293-8928116, the corresponding linear gene is ENO1(NM _001201483), and the circular sequence has 936 bases and comprises the 5 th to 10 th exons of the ENO1 gene. There have not been any reports on the function of hsa _ circ _ 0009618.

In another aspect, the invention also provides a molecular marker of lung adenocarcinoma, and the molecular marker is circular RNAhsa _ circ _ 0009618. The applicant of the invention discovers that hsa _ circ _0009618 is remarkably up-regulated in lung adenocarcinoma tissues through a circular RNA chip and qRT-PCR at earlier stage. The knockdown hsa _ circ _0009618 can inhibit the proliferation of lung adenocarcinoma cells, and the fact that hsa _ circ _0009618 can be a novel molecular marker for auxiliary diagnosis and treatment of lung adenocarcinoma is suggested.

In a third aspect, the invention also provides application of a detection reagent containing the circular RNA hsa _ circ _0009618 in preparing a kit for auxiliary diagnosis and prognosis judgment of lung adenocarcinoma, wherein the detection reagent is a primer capable of amplifying the circular RNA hsa _ circ _ 0009618.

Preferably, the base sequences of the primers are shown as hsa _ circ _0009618 primer pair consisting of DNA sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 and GAPDH primer pair shown in SEQ ID NO. 4 and SEQ ID NO. 5. It should be noted that the primers capable of amplifying the circular RNA hsa _ circ _0009618 in the present invention include, but are not limited to, the primers shown in SEQ ID NOS: 2-5, and further include other primer sequences capable of successfully amplifying the circular RNA hsa _ circ _ 0009618.

In a fourth aspect, the invention also provides a kit for auxiliary diagnosis of lung adenocarcinoma, which comprises a reagent capable of detecting the content of circular RNA hsa _ circ _0009618 in plasma. The detection reagent is a primer capable of amplifying the circular RNA hsa _ circ _ 0009618. The primers are as described above.

The invention provides ROC profiles of plasma circular RNA hsa _ circ _0009618 for diagnosis of lung adenocarcinoma. The AUC value of the plasma hsa _ circ _0009618 for diagnosing lung adenocarcinoma is 0.8099, which indicates that the plasma hsa _ circ _0009618 has auxiliary diagnostic value for lung adenocarcinoma.

The kit of the present invention may further comprise other reagents required for PCR amplification, such as RNA polymerase, buffer, NTP, etc.

In a fifth aspect, the invention also provides a primer pair for amplifying the circular RNA hsa _ circ _0009618, wherein the amplification primers are hsa _ circ _0009618 primer pair comprising DNA sequences shown as SEQ ID NO:2 and SEQ ID NO:3 and GAPDH primer pair shown as SEQ ID NO:4 and SEQ ID NO: 5.

In a sixth aspect, the invention also provides a survival curve for plasma circular RNA hsa _ circ _0009618 for predicting lung adenocarcinoma prognosis. The legend shows that patients with high expression of plasma circular RNA hsa _ circ _0009618 have a poor prognosis and a short expected survival compared to low expression patients.

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention designs specific circular RNA primers to carry out qRT-PCR and RNA tolerance experiments to confirm the objective existence of hsa _ circ _ 0009618;

(2) according to the invention, by detecting the expression condition of hsa _ circ _0009618 in the plasma of a patient with lung adenocarcinoma, the expression level of hsa _ circ _0009618 in the plasma of lung adenocarcinoma is found to be obviously increased for the first time, and the hsa _ circ _0009618 can be used as a plasma marker for diagnosing lung adenocarcinoma, so that the efficiency of diagnosing lung adenocarcinoma can be improved;

(3) the invention divides patients into a high expression group and a low expression group of hsa _ circ _0009618 according to the expression of hsa _ circ _0009618 in the plasma of a lung adenocarcinoma patient, and compares the prognosis of the two groups. As a result, it was found that plasma hsa _ circ _0009618 can be used to determine prognosis in patients with lung adenocarcinoma, and that plasma hsa _ circ _0009618 shows worse prognosis in patients with high expression than in patients with low expression.

(4) The hsa _ circ _0009618 disclosed by the invention has value in diagnosis and prognosis of lung adenocarcinoma, develops a corresponding diagnosis kit, provides a new marker for diagnosis and prognosis judgment of lung adenocarcinoma, and has important significance.

Drawings

FIG. 1 is a sequence diagram of the hsa _ circ _0009618 expression product in example 1 of the present invention.

FIG. 2 is a bar graph showing the effect of RnaseR on hsa _ circ _0009618 and GAPDH in example 2 of the present invention.

FIG. 3 is a schematic diagram showing cell proliferation curves of a lung adenocarcinoma cell line and a control cell line of hsa _ circ _0009618 transfected by lentivirus in example 3 of the present invention, wherein the abscissa is days and the ordinate is 490nm absorbance measured by a microplate reader.

FIG. 4 is a graph showing the comparison of the expression of hsa _ circ _0009618 in the plasma of lung adenocarcinoma patients and the plasma of normal population in qRT-PCR assay in example 1 of the present invention.

FIG. 5 is a ROC plot of plasma hsa _ circ _0009618 in the diagnosis of lung adenocarcinoma in example 3 of the present invention.

FIG. 6 is a survival curve of plasma hsa _ circ _0009618 for predicting lung adenocarcinoma prognosis in example 4 of the present invention.

Detailed Description

The technology involved in the invention is a conventional technical means of molecular biology, and the involved enzymes, primers, reagents and reaction conditions can be reasonably selected according to the experience of the technicians in the field without description, wherein the reagent consumables belong to common products sold in the market, and the involved detection methods, experimental instruments and statistical analysis methods are well known and skilled by the technicians in the field.

Samples in the embodiment of the invention are all collected from Nanjing encephalic hospital department of respiration; the experimental contents were approved by the medical ethics committee of the Nanjing brain Hospital and were informed consent of the patients.

Example 1: the qRT-PCR reaction detected the expression of hsa _ circ _0009618 in the plasma of lung adenocarcinoma patients and healthy control population.

The specific experimental scheme is as follows:

RNA extraction

(1) Plasma treatment: adding about 1ml of blood plasma into 1ml of Trizol, and fully homogenizing by a homogenizer; centrifuge for 15 minutes at 12000g and collect the supernatant.

(2) 200ul of chloroform was added to the supernatant, the mixture was vigorously inverted and mixed for half a minute, and the mixture was allowed to stand at room temperature for 3 minutes.

(3) The centrifuge is set at 4 ℃ and is centrifuged at 12000g for 15 minutes, and the lysate can be divided into three layers: the upper layer is RNA of water phase; the middle layer is DNA, lipid, etc.; the lower layer is cell residue, protein, polysaccharide, etc.

(4) And taking supernatant, namely RNA of the water phase, into a new EP tube, adding isopropanol with the same volume, uniformly mixing, standing at room temperature for 10 minutes, setting a centrifuge at 4 ℃, and centrifuging at 12000g for 10 minutes.

(5) The supernatant was carefully removed, taking care not to lose the underlying RNA pellet, and 1ml of 75% ethanol was added, mixed by inverting upside down and the pellet resuspended.

(6) Centrifuge set 4 ℃, 12000g centrifugation 10 minutes, carefully remove the supernatant, try to dry the tube wall fluid, take care not to lose the RNA pellet, if the pellet is loose can be centrifuged again. Air-dry at room temperature for about 15 minutes until the tube wall is free of liquid.

(7) An appropriate volume (about 20ul) of DEPC was added to dissolve the RNA and placed in a water bath at 58 ℃ for 10 minutes.

(8) 2ul was taken out for quantitative analysis, and buffer was measured in 10mM Tris Cl (pH 7.8), and reverse transcription was performed in the next step based on the quantitative analysis result. (1A260 ═ 40. mu.g/ml, A260/A280 ═ 1.8 to 2.1).

Reverse transcription of cDNA

1) Experimental System

M-MLV Reverse Transcriptase：

3. Primer: the circular RNA primer is a reverse primer, a group of gDNA template control is established during qRT-PCR, and the fact that circRNA comes from post-transcriptional shearing, but not mutation such as gene fusion and the like is verified. The linear gene GAPDH was also detected as a negative control. The primers used are listed below:

SEQ ID NO:2	hsa_circ_0009618_Forward	TGGTGTCTCATCGTTTTCGGG
			SEQ ID NO:3	hsa_circ_0009618_Reverse	TCTGTGACGTTCAGTTTCTGCC
SEQ ID NO:4	hsa-GAPDH_Forward	GGACCTGACCTGCCGTCTAG
			SEQ ID NO:5	hsa-GAPDH_Reverse	GTAGCCCAGGATGCCCTTGA

PCR, taking GAPDH as an internal control, wherein a reaction system of the PCR is as follows, 2 mul 10 × Buffer is respectively added into each reaction tube, 2ul dNTP, 1ul forward primer, 1ul reverse primer, 1ul cDNA template and 0.2ul Taq enzyme are respectively added into each reaction tube, water is added into each reaction tube until 50ul PCR reaction conditions are as follows, the PCR reaction conditions are 94 ℃, 5 minutes of pre-denaturation, 94 ℃, 30 seconds of denaturation, 56 ℃, 30 seconds of annealing, 72 ℃, 30 seconds of extension and 40 cycles, PCR amplification products are detected by agarose gel electrophoresis, the result is shown in figure 1, a group of gDNA template controls are set up during qRT-PCR, the circRNA is proved to be from post-transcriptional shearing instead of mutations such as gene fusion, and the like, and meanwhile, linear gene GAPDH is detected as a negative control.

The calculation formula of the relative expression quantity of the target gene is as follows: Δ Ct ═ Ct (hsa _ circ _0009618) -Ct (gapdh). Where Ct (hsa _ circ _0009618) is the Ct value of normalized hsa _ circ _0009618, and Ct (GAPDH) is the Ct value of normalized GAPDH. Δ Ct ═ Ct (hsa _ circ _0009618) -Ct (gapdh) and represents the relative Ct value of the housekeeping gene of interest in each sample (smaller Δ Ct indicates higher expression level).

The expression of hsa _ circ _0009618 gene in the plasma of lung adenocarcinoma patients and the plasma of normal healthy persons is detected by using a qRT-PCR method, and as can be seen in FIG. 4 (the high Ct value is low expression), the result shows that the expression level of hsa _ circ _0009618 gene in the lung adenocarcinoma plasma is obviously higher than that of the normal healthy persons. Therefore, a kit for detecting the gene expression change in the plasma can be prepared for diagnosing the lung adenocarcinoma.

After the circular RNA of the hsa _ circ _0009618 gene is amplified by PCR, the fact that the hsa _ circ _0009618 gene expresses a circular RNA molecule which consists of 936 nucleotides and has a closed circular structure is determined, and the nucleotide sequence of the circular RNA hsa _ circ _0009618 gene is shown as SEQ ID NO: 1. The structure of the circular RNA hsa _ circ _0009618 is a head-to-tail circular RNA structure formed by splicing after a linear nucleotide sequence is transcribed.

Example 2: RNaseR tests the stability of hsa _ circ _0009618 to RNase.

RNase R is a 3 '-5' exonuclease which cleaves RNA stepwise from the 3 '-5' direction into di-and trinucleotides. RNase R digests almost all linear RNA molecules but has no effect on circular RNA. Total RNA is added with RNase R according to the proportion of 3U/ug for digestion, qRT-PCR detection and the influence of RNase R on hsa _ circ _0009618 and GAPDH are added, the result is shown in figure 2, Total RNA is digested with RNase R and then qRT-PCR detection is carried out, the result shows that compared with the traditional linear RNA, the circRNA molecule has no 5 'end cap and 3' end poly (A) tail, is in a closed ring structure, is not easily degraded by exonuclease RNaseR, is more stable than the linear RNA, the expression of hsa _ circ _0009618 is not obviously influenced by adding RNase R, and hsa _ circ _0009618 is not sensitive to RNase. However, after RNase R digestion, the linear gene GAPDH expression decreased significantly. RNaseR resistance experiments further validated the circular structure of circRNA.

Example 3: MTT experimental procedure:

culturing target cells with good growth state, designing each group of experimental conditions according to the experimental result of lentivirus infection, and carrying out formal infection.

1. After trypsinization of the cells of each experimental group in the logarithmic growth phase, the complete medium was resuspended into a cell suspension and counted.

2. The density of plated cells is determined according to the growth speed of the cells (mostly 2000 cells/well), each group is repeated 3-5 times, and the number of plated cells is determined according to the experimental design (if the cells are detected for 5 days, 5 96-well plates are plated).

3. Uniformly paving, observing the cell density of each experimental group under a microscope after the cells are completely precipitated, fixing one group if the cell density is not uniform, finely adjusting the amount of the cells of other groups, paving again (for example, paving again after the cell amount is reduced if the number of the cells of the Con group is more), and putting into a cell incubator for culture.

4. Starting the day after plating, 20. mu.L of 5mg/mL MTT was added to the wells 4h before termination of the culture without changing the medium.

After 5.4h, the culture was completely aspirated, and the formazan particles were dissolved by adding 100. mu.L of LDMSO, taking care not to aspirate the formazan particles at the bottom of the well plate.

6. The oscillator oscillates for 2-5min, and the OD value is detected by the enzyme-labeling instrument at 490 nm.

7. And (6) carrying out data statistical analysis.

We verified the effect of the hsa _ circ _0009618 gene on cell proliferation by MTT assay. The lentivirus infects lung adenocarcinoma A549 cells, after 5 days of culture, the cells are treated by MTT for 4 hours, and the comparison of the absorption rate change fold of the lung adenocarcinoma cell strain group with the knockdown hsa _ circ _0009618 gene and the control lung adenocarcinoma cell strain in an enzyme labeling instrument to light with the wavelength of 490nm along with the change of time is observed (figure 3). OD490 here reflects the number of viable cells. The results showed that the proliferation rate of the lung adenocarcinoma cell line with the hsa _ circ _0009618 gene knocked-down was significantly lower than that of the control lung adenocarcinoma cell line (fig. 3). Therefore, the hsa _ circ _0009618 gene can be used as a potential target for treating lung adenocarcinoma.

Example 3: ROC curve analysis the value of plasma hsa _ circ _0009618 in diagnosing lung adenocarcinoma.

In the embodiment, 62 lung adenocarcinoma patients are taken as research subjects, 60 healthy examiners are taken as a control group, and samples of the lung adenocarcinoma patients are all collected from respiratory department of Nanjing encephalic hospital; the experimental contents were approved by the medical ethics committee of the Nanjing brain Hospital and were informed consent of the patients.

The ROC curve shows that the sensitivity and specificity of hsa _ circ _0009618 are 90.0% and 66.1% respectively, and the AUC value is 0.8099.

The specific experimental scheme is as follows:

1. opening the Graph prism 7.0 software, and selecting a Column option in the left New Table Graph;

2. clicking selects the option of Enter replay values, stackedinto columns in the right Enter/import data entry. Selecting Create;

3. inputting a Group in a title below the Group, and correspondingly inputting all sample data of each Group below the Group;

4. clicking anlyze, clicking ROC curve and clicking OK to generate an ROC curve graph;

5. and (4) self-defining the chart. Editing the lines, line colors, etc. of the chart.

Plasma hsa _ circ _0009618 was analyzed for diagnostic efficacy of lung adenocarcinoma by the ROC curve shown in figure 5. The ROC curve is also called a receiver operating characteristic curve, and the area value under the ROC curve is between 1.0 and 0.5. In the case of AUC > 0.5, the closer the AUC is to 1, the better the diagnostic effect. AUC has lower accuracy when being 0.5-0.7, AUC has certain accuracy when being 0.7-0.9, and AUC has higher accuracy when being more than 0.9. When AUC is 0.5, the diagnostic method is completely ineffective and is not valuable. The AUC value of the plasma hsa _ circ _0009618 for diagnosing lung adenocarcinoma is 0.8099, which indicates that the plasma hsa _ circ _0009618 has auxiliary diagnostic value for lung adenocarcinoma.

Example 4: plasma hsa _ circ _0009618 predicts survival curves for lung adenocarcinoma prognosis.

The specific experimental scheme is as follows:

1. opening the Graph prism 7.0 software, and selecting a survivval option in the left New Table Graph;

2. clicking on selects the Enter elapsed time as number of days option in the right Enter/import data entry. Selecting Create;

3. inputting a Group in a title below the Group, and correspondingly inputting all sample data (survival time and two groups of survival states) of each Group below the Group;

4. clicking anlyze, clicking survivval and clicking OK to generate a Survival curve graph;

The results are shown in FIG. 6, where the plasma circular RNA hsa _ circ _0009618 was highly expressed in patients with a poor prognosis and a short expected survival compared to those with low expression.

Sequence listing

<110> Nanjing brain hospital

<120> circular RNA has _ circ _000918 and use thereof

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>936

<212>DNA

<213> human (human)

<400>1

aaactgaacg tcacagaaca agagaagatt gacaaactga tgatcgagat ggatggaaca 60

gaaaataaat ctaagtttgg tgcgaacgcc attctggggg tgtcccttgc cgtctgcaaa 120

gctggtgccg ttgagaaggg ggtccccctg taccgccaca tcgctgactt ggctggcaac 180

tctgaagtca tcctgccagt cccggcgttc aatgtcatca atggcggttc tcatgctggc 240

aacaagctgg ccatgcagga gttcatgatc ctcccagtcg gtgcagcaaa cttcagggaa 300

gccatgcgca ttggagcaga ggtttaccac aacctgaaga atgtcatcaa ggagaaatat 360

gggaaagatg ccaccaatgt gggggatgaa ggcgggtttg ctcccaacat cctggagaat 420

aaagaaggcc tggagctgct gaagactgct attgggaaag ctggctacac tgataaggtg 480

gtcatcggca tggacgtagc ggcctccgag ttcttcaggt ctgggaagta tgacctggac 540

ttcaagtctc ccgatgaccc cagcaggtac atctcgcctg accagctggc tgacctgtac 600

aagtccttca tcaaggacta cccagtggtg tctatcgaag atccctttga ccaggatgac 660

tggggagctt ggcagaagtt cacagccagt gcaggaatcc aggtagtggg ggatgatctc 720

acagtgacca acccaaagag gatcgccaag gccgtgaacg agaagtcctg caactgcctc 780

ctgctcaaag tcaaccagat tggctccgtg accgagtctc ttcaggcgtg caagctggcc 840

caggccaatg gttggggcgt catggtgtct catcgttcgg gggagactga agataccttc 900

atcgctgacc tggttgtggg gctgtgcact gggcag 936

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gagaagtcct gcaactgcct 20

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cagcttgttg ccagcatgag 20

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggacctgacc tgccgtctag 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gtagcccagg atgcccttga 20

Claims

1. A circular RNA hsa _ circ _0009618, wherein the nucleotide sequence of the circular RNA is shown in SEQ ID NO. 1.

2. A molecular marker for lung adenocarcinoma, which is the circular RNA hsa _ circ _0009618 of claim 1.

3. Use of the circular RNA hsa _ circ _ 0009618-containing detection reagent of claim 1 in the preparation of a kit for the aided diagnosis and prognosis of lung adenocarcinoma, wherein the detection reagent is a primer that can amplify the circular RNA hsa _ circ _0009618 of claim 1.

4. The use according to claim 3, wherein the primers have the base sequences shown in SEQ ID NO 2 and SEQ ID NO 3, and the hsa _ circ _0009618 primer pair and the GAPDH primer pair shown in SEQ ID NO 4 and SEQ ID NO 5.

5. A kit for the auxiliary diagnosis or prognosis of lung adenocarcinoma, said kit comprising reagents capable of detecting the amount of the circular RNA hsa _ circ _0009618 according to claim 1 in plasma.

6. The kit of claim 5, wherein the detection reagent is a primer that can amplify the circular RNA hsa _ circ _0009618 of claim 1; the base sequence of the primer is shown as hsa _ circ _0009618 primer pair consisting of DNA sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 and GAPDH primer pair shown in SEQ ID NO. 4 and SEQ ID NO. 5.

7. The kit of claim 6, wherein the kit further comprises an RNA polymerase, a buffer, and NTP.

8. The primer set for amplifying the circular RNAhsa _ circ _0009618 of claim 1, wherein the amplification primers are an hsa _ circ _0009618 primer set comprising DNA sequences shown in SEQ ID NO 2 and SEQ ID NO 3 and a GAPDH primer set shown in SEQ ID NO 4 and SEQ ID NO 5.