CN111363744B

CN111363744B - Berberine-mediated UHRF1 gene inhibition and application thereof in preparation of medicines for treating multiple myeloma

Info

Publication number: CN111363744B
Application number: CN202010119970.9A
Authority: CN
Inventors: 费嘉; 古春明; 刘燕君
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2020-02-26
Filing date: 2020-02-26
Publication date: 2021-08-24
Anticipated expiration: 2040-02-26
Also published as: CN111363744A

Abstract

The invention discloses berberine-mediated UHRF1 gene inhibition and application thereof in preparing a medicine for treating multiple myeloma, wherein a UHRF1-siRNA sequence is as follows: sense strand: gagagcgagagaaggagaacagcaatt, respectively; antisense strand: uugcuguucuccuucucucgcucuctt are provided. The UHRF1-siRNA and/or the biological material related to the UHRF1-siRNA can be used for preparing a medicine for treating multiple myeloma. The invention discloses an action mechanism of berberine for resisting multiple myeloma in vitro and in vivo, and a potential target UHRF1 of berberine in multiple myeloma is screened by using new technologies such as SPR-LC-MS/MS, molecular simulation docking and the like; corresponding siRNA is designed according to the method, and the treatment purpose of inhibiting the proliferation capacity and the clonogenic capacity of multiple myeloma cells is achieved.

Description

Berberine-mediated UHRF1 gene inhibition and application thereof in preparation of medicines for treating multiple myeloma

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to berberine-mediated UHRF1 gene inhibition and application thereof in preparation of a medicine for treating multiple myeloma.

Background

Multiple Myeloma (MM) is a malignant tumor of the hematopoietic system that is manifested by clonal proliferation of plasma cells in the bone marrow with production of immunoglobulin M protein. With the elucidation of the molecular biological properties of MM and the intensive study on signal transduction in myeloma cells and myeloma microenvironment, more and more novel drugs targeting myeloma cells and microenvironment are gradually used in clinical drug therapy, such as proteasome inhibitors, immunomodulators, monoclonal antibody drugs, etc., so that MM therapy has made great progress. However, most available drugs are easy to generate toxic and side effects and drug resistance, and MM is still an incurable malignant tumor, so that development of new drugs for treating MM is needed.

The syndrome of heat-toxicity in the course of onset of MM can be treated by heat-clearing and detoxifying method. The coptis detoxifying decoction (Huang Lian Jie Du Tang, HLJDT) contains four medicaments of coptis, scutellaria, phellodendron and gardenia, has the efficacy of purging fire and detoxifying, and is a classic prescription of a traditional Chinese medicine heat-clearing and detoxifying prescription. The HLJDT anti-inflammatory mechanism is that IL-6 plays an important role in the development of MM by inhibiting the secretion of Interleukin-6 (Interleukin 6, IL-6), and the HLJDT achieves certain curative effect in the clinical treatment of MM patients.

Berberine (BBR) is the main component of HLJDT monarch drug (Coptidis rhizoma), and can be separated from the rhizome of plants such as Coptidis rhizoma, cortex Phellodendri, and radix Berberidis haemoglobin to obtain natural alkaloid. BBR has a broad antibacterial spectrum, and is clinically used for treating dysentery and enteritis.

The BBR can effectively inhibit the proliferation of MM cells in vitro and can inhibit the secretion of a cytokine IL-6. This suggests that BBR has anti-MM effects, but its molecular mechanism of action and specific target proteins of action have not been elucidated.

Disclosure of Invention

The invention provides an siRNA for inhibiting UHRF1 gene expression, named UHRF1-siRNA, on the basis of researching the molecular action mechanism of berberine for treating multiple myeloma and determining the specific action target protein of berberine for treating multiple myeloma.

The invention also aims to provide the application of the UHRF1-siRNA in preparing a medicine for treating multiple myeloma.

The present invention is based on the discovery and recognition by the inventors of the following facts and problems:

81 potential target proteins of berberine in MM cells (RPMI-8266 and MM.1S) are screened by using an SPR-LC-MS/MS (surface plasmon resonance, liquid chromatography and protein mass spectrometry) technology, UHRF1 in the protein is found to be an important target of BBR anti-MM by molecular simulation docking, and three potential binding sites are provided, wherein 3 binding sites are all positioned on a TTD-PHD domain of UHRF 1; the SPR experiment proves that BBR interacts with UHRF1 protein via the third binding site.

Then the invention purifies UHRF1 and related domains, and performs SPR experiment to verify that BBR can interact with TTD-PHD domain of UHRF 1.

Meanwhile, UHRF1 is highly expressed in MM primary cells and MM cells, and is lowly expressed in normal hPBMCs (human peripheral blood mononuclear cells); and high expression of UHRF1 suggests a poor prognosis for MM patients; after BBR treatment, the protein expression level of UHRF1 can be remarkably reduced, but the expression level of UHRF1-mRNA is not influenced; BBR induces degradation of UHRF1 protein via the ubiquitin-proteasome pathway.

UHRF1 plays a role of oncogene in MM, after UHRF1-siRNA target inhibits UHRF1 expression, MM cell proliferation ability, clonogenic ability and BBR drug sensitivity are reduced, and the UHRF1-siRNA is suggested to be used for preparing drugs for treating multiple myeloma.

The purpose of the invention is realized by the following technical scheme:

a UHRF1-siRNA is an siRNA for inhibiting the expression of UHRF1 gene, and the sequence is shown as follows:

sense strand (5 'to 3', the same applies below): gagagcgagagaaggagaacagcaa (SEQ. ID. NO. 1);

antisense strand: uugcuguucuccuucucucgcucuc (SEQ. ID. NO. 2).

The biological material related to the UHRF1-siRNA is any one of the following:

(ii) DNA encoding UHRF 1-siRNA;

② an expression cassette containing the DNA;

③ a recombinant vector containing said DNA;

a recombinant vector containing the expression cassette;

a recombinant microorganism containing the DNA of (i);

sixthly, recombinant microorganism containing the expression cassette;

seventhly, recombinant microorganisms containing the recombinant vector;

the recombinant microorganism contains the recombinant vector;

the biological materials related to the UHRF1-siRNA can also achieve the aim of inhibiting the expression of UHRF1 genes.

The UHRF1-siRNA and/or the biological material related to the UHRF1-siRNA are/is used for preparing a medicine for treating multiple myeloma;

the multiple myeloma especially refers to multiple myeloma cells RPMI-8266, MM.1S and U266;

the treatment of multiple myeloma is characterized by inhibiting the proliferation capacity and the clonogenic capacity of multiple myeloma cells;

the dosage form of the medicine for treating multiple myeloma is aerosol, tablets, capsules, dripping pills, powder, solutions, suspensions, emulsions, granules, lipidic agents, transdermal agents, buccal agents, suppositories or freeze-dried powder injections.

Compared with the prior art, the invention has the following advantages and effects:

the invention discloses an action mechanism of in-vivo and in-vitro anti-multiple myeloma of traditional Chinese medicine monomer berberine, and screens a potential target UHRF1 of the berberine in multiple myeloma by using new technologies such as SPR-LC-MS/MS, molecular simulation docking and the like; corresponding siRNA is designed according to the method, the purpose of inhibiting UHRF1 gene expression is achieved, the treatment purpose of inhibiting the proliferation capability and the clonogenic capability of multiple myeloma cells is also achieved, and a new thought and scheme are provided for treating multiple myeloma.

Drawings

FIG. 1 is a schematic diagram of molecular simulation docking of berberine with UHRF 1.

FIG. 2 is a parameter interface and related parameter settings for molecular simulation docking.

FIG. 3 is three potential binding sites for the BBR to dock with UHRF1 molecules; wherein, (A) No.1 mimics a binding site; (B) simulated binding site No. 2; (C) simulated binding site No. 3; (D) the spatial composition of epitope No. 1; (E) the spatial composition of epitope No. 1; (F) the spatial structure of epitope No. 1.

FIG. 4 is SPR verification of binding site of berberine to UHRF 1; wherein, (A, B, C) the signal curve of berberine with polypeptide 1, polypeptide 2, polypeptide 3, mouse-derived IgG, rabbit-IgG; (D) the mean Kd value of berberine combined with polypeptide 1, polypeptide 2, and polypeptide 3.

FIG. 5 shows the results of protein expression and Coomassie blue staining.

FIG. 6 is the result of an experiment in which the binding strength of UHRF1 and its related domains to berberine was verified by SPR experiment; wherein, (A, B, D) the signal curves of berberine and UHRF1 and related domains in SPR experiments; (C, E) mean Kd values of berberine with UHRF1 and its related domains in SPR experiments.

FIG. 7 is a graph of UHRF1 expression levels in different cells and UHRF1 mRNA expression levels as a function of MM patient prognosis; western blot verifies the expression level of UHRF1 in MM primary cells, human MM cell strains and normal human PBMCs; prognostic value of uhrf1 mRNA expression levels on overall survival in 414 newly diagnosed MM patients.

FIG. 8 is the effect of berberine on the expression level of UHRF1 protein; wherein (A) after treating MM.1S, U266 and RPMI-8266 cells with berberine (25 mu M) for 0, 4, 8, 12, 24 and 48 hours, western blotting detects the expression level of UHRF1 protein; (B) after MM.1S, U266 and RPMI-8266 cells were treated with berberine (0,15,25,40,60,75 μ M) for 24h, western blotting detected the expression level of UHRF1 protein.

FIG. 9 is the effect of berberine on the expression level of cancer suppressor genes; wherein, (A-B) after 5 mu M berberine treats MM cell for 48h, qRT-PCR detects mRNA expression level of cancer suppressor gene; (C) after the MM cells are treated by 5 mu M berberine for 48 hours, western blotting detects the protein expression level of the cancer suppressor gene.

FIG. 10 is a graph of the effect of berberine on UHRF1 mRNA expression levels.

FIG. 11 is a graph showing the effect of berberine in combination with other agents on the expression level of UHRF1 protein; wherein, A: berberine is combined with CHX; b: berberine is combined with chloroquine and 3-MA; c: berberine is used in combination with MG 132.

FIG. 12 is the results of an immunoprecipitation experiment; wherein, A is IP: ub-beads; b is IP: UHRF 1.

FIG. 13 is the difference in the expression levels of UHRF1 mRNA and UHRF1 protein in multiple myeloma cells following transfection with different UHRF 1-siRNAs; wherein (A) qRT-PCR detects the expression level of UHRF1 mRNA 48h after UHRF1-siRNA transfects multiple myeloma cells; (B) and detecting the expression level of UHRF1 protein 48h after UHRF1-siRNA transfects multiple myeloma cells by Western blot.

FIG. 14 is a graph of the effect on the proliferative capacity of multiple myeloma cells following transfection with UHRF 1-siRNA.

FIG. 15 is a graph of the effect on clonogenic capacity of multiple myeloma cells following UHRF1-siRNA transfection; wherein (A) colony diagram (10 ×); (B) relative colony numbers (. P <0.05, berberine treated group compared to blank control group).

FIG. 16 is a graph of the effect of UHRF1-siRNA #2 targeting inhibition of UHRF1 on berberine drug sensitivity in multiple myeloma cells; wherein, (A) RPMI-8266; (B) 1S.

FIG. 17 is a schematic diagram of the structure of UHRF1 lentiviral vector.

FIG. 18 is a graph of the effect of overexpression of UHRF1 on MM cell proliferation potency and drug sensitivity; wherein, (A) the effect of transfection of UHRF1 lentiviral particles on the expression level of UHRF1 protein; (B) the effect of overexpression of UHRF1 on the proliferative capacity of MM cells; (C) effect of overexpression of UHRF1 on MM cell drug sensitivity.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The multiple myeloma cells RPMI-8266, MM.1S and U266 involved in the following examples were purchased from Shanghai cell Bank, Chinese academy of sciences.

Example 1: surface plasma resonance, liquid chromatography, protein mass spectrometry and other technologies are combined to screen target protein with berberine anti-multiple myeloma effect

In order to research the direct action target and molecular mechanism of berberine for inhibiting multiple myeloma, the patent initially screens target proteins of berberine in multiple myeloma cells by utilizing a Surface Plasmon Resonance (SPR) -LC-MS/MS (liquid chromatography-mass spectrometry) technology.

Using Biodot^TMThe AD1520 chip array printer prints the printing work (berberine) on a 3D photo-cross-linking chip, the berberine is used as a stationary phase, and RPMI-8266and MM.1S cell lysate are used as a mobile phase to capture potential proteins in the cell lysate. Then, the chip is subjected to in-situ enzymolysis in monitoring equipment, and the protein species enriched on the surface of the chip are identified by HPLC-MS.

By collating the protein data obtained by the SPR-LC-MS/MS technology, 87 potential target proteins are preliminarily screened in RPMI-8266 cells, 88 potential target proteins are preliminarily screened in MM.1S cells, and the scores (score) and relative peptide fragment abundance (PSMs) of the potential target proteins are shown in Table 1. Among them, MM.1S cells were screened to have 32 potential target proteins with scores greater than 1000, and RPMI-8266 cells were screened to have 29 potential target proteins with scores greater than 1000, as shown in Table 2.

7 specific proteins are screened from MM.1S cell lysate, 6 specific proteins are screened from RPMI-8266 cell lysate, and correlation analysis between groups of potential target proteins finds that berberine has high conservation of the target proteins in MM.1S and RPMI8266 of multiple myeloma cells and has 81 common potential targets.

TABLE 1 score of berberine potential target proteins in SPR-LC-MS/MS experiments by RPMI-8266and MM.1S

TABLE 2 summary of scores of berberine potential target proteins in SPR-LC-MS/MS experiments by RPMI-8266and MM.1S

Target Type	MM.1S	RPMI-8266
			Score∈(1000,∞)	32	29
Score∈(200,1000)	38	37
			Score∈(100,200)	7	9
Score∈(0,100)	11	12
			Total Target：	88	87

Example 2: integration analysis potential target captured by SPR-LC-MS/MS in order to further narrow the selection range of berberine target proteins, the patent compares the group relationship of targets with overall score of >700 and relative abundance of >60, and finds that three proteins, HIF1A, UHRF1 and JAK2, are the most probable targets of berberine. Wherein UHRF1 is the only protein related to ubiquitin-proteasome system, in order to explore the role of berberine in ubiquitin-proteasome system, UHRF1 was selected as the follow-up study object.

Example 3: molecular simulation docking and SPR experiments verify the binding and site of BBR and UHRF1

In order to study whether berberine can bind to UHRF1 protein, the patent finds a plurality of UHRF1 domains (PDB ID: 4gy5, 2pb7, 2faz, 3fl2) in a PDB database, and after amino acid gaps between the domains are automatically modeled by a homologous recombination method, the amino acid gaps are subjected to molecular simulation docking with berberine (shown in figure 1), and UHRF1 is found to be docked with berberine and has 3 potential binding sites.

The molecular simulation docking method comprises the following steps:

(1) sequence acquisition: UHRF1 protein sequence, reference sequence human (Homo sapiens) Q96T88(seq. id No.3), Homology Modeling was performed using the Homology Modeling set-up of Maestro software. Selecting Structure Prediction Wizard, introducing the protein sequence, and obtaining the sequence with homology relationship by adopting NCBI _ PDB _ BLAST in a matching mode. And then selecting a protein model with the closest homologous relation as an alternative modeling basis, introducing and splicing the fragment proteins for multiple times according to the sequence, and performing calculation modeling by using a ClustalW algorithm and default other settings.

(2) Modeling of protein spatial structure: as the sequence of the target protein is not completely recorded in a protein structure database (PDB), the test adopts a homologous modeling method to construct a protein model. Selecting a homology modeling sequence by sequence PRIME search analysis as in step (3):

(3) UHRF1 protein modeling structure

1aa-74aa:2faz Ubiquitin-Like Domain of Human Nuclear Zinc Finger Protein NP95

130aa-364aa:4gy5 Crystal structure of the tandem tudor domain and plant homeodomain of UHRF1 with Histone H3K9me3

406aa-642aa:2pb7 Crystal Structure of the SRA domain of the human UHRF1 protein

671aa-793aa:3fl2 Crystal structure of the ring domain of the E3 ubiquitin-protein ligase UHRF1

Amino acid gaps filled by Home-building program automatically.

(4) Model optimization: and after the homologous modeling is completed, optimizing the basic model by using a Protein Preparation Wizard default setting to reach the most stable state. The parameters of the four modules are shown in fig. 2.

(5) Simulation butt joint: mae, molecular structure of compound was first introduced, and homology modeling was performed by using ligandpacking component, algorithm Standard Precision, other settings used default values. Through calculation, the possible binding sites divided into the first three are obtained.

According to the results of the simulated docking, the active sites for binding to small molecules of drugs by forming hydrogen bonds, large pi bonds and small pi bonds are indicated in the reference sequence, as shown in fig. 3, where the binding site-1 is Aspartic acid (Aspartic acid 216, D216), the binding site-2 is Lysine (Lysine 297, K297) and the binding site-3 is Arginine (argine 235, R235) are active sites for binding berberine to UHRF 1.

To further verify the binding site of berberine and UHRF1, 3 polypeptides (25 amino acids obtained by extending the sequence from the active site to 12 amino acids) containing the above binding site were designed, and the design sequence of the polypeptide was:

Peptide-1:VRARARTIIKWQDLEVGQVVMLNYN(SEQ.ID.NO.4)

Peptide-2:EGSPMVDNPMRRKSGPSCKHCKDDV(SEQ.ID.NO.5)

Peptide-3:VMLNYNPDNPKERGFWYDAEISRKR(SEQ.ID.NO.6)

the polypeptide sequence is chemically synthesized, the synthesis method is Solid Phase Peptide Synthesis (SPPS), the amino acid is selected from general D-type amino acid, and the synthetic method is used for purifying by liquid chromatography to respectively obtain 3 target polypeptides with the purity of 98%.

The SPR experiment of these 3 polypeptides and berberine was performed to verify that berberine was used as the stationary phase, 3 polypeptides with concentration gradient (800nM, 1600nM, 3200nM) were flowed, the interaction concentration gradient specific binding curve of berberine and target protein is shown in fig. 4, there is strong interaction (KD ═ 3.68E-04) in Peptide3, Peptide1/2(KD ═ 2.54E-01/1.01E-01) is very weak (or no) interaction, and the kinetic and affinity data for binding of 3 polypeptides and berberine are shown in table 3.

SPR data indicated that berberine binds in the UHRF 1229-240 region and the active site is arginine (R).

TABLE 3 analysis of BBR affinity data for 3 polypeptides by SPR

As the amino acid 229-240 interval is positioned on the UHRF1 TTD-PHD structural domain, in order to further verify that berberine can be combined with UHRF1, the UHRF1 protein, the UHRF1-R235A protein and related structural domains thereof, such as NIRF, PHD, SRA, RING, TTD-PHD and TTD-PHD-R235A protein, are purified to carry out SPR experimental verification. UHRF1, UHRF1-R235A, NIRF, PHD, SRA, RING, TTD-PHD-R235A protein expression, supernatant was induced at 22 ℃, Coomassie brilliant blue staining was performed after nickel column purification, the packing type was Smart-NI, and elution was performed with a gradient of 2mM/20mM/50mM/250mM imidizole.

The protein purification results are shown in FIG. 5, and from the Coomassie blue staining results, UHRF1, UHRF1-R235A, NIRF, PHD, SRA, RING, TTD-PHD-R235A were all successfully purified, and the purity of the recombinant protein was > 85%.

The 8 proteins and berberine are subjected to SPR verification, the berberine is used as a stationary phase, 8 proteins with concentration gradients of (200nM, 400nM, 800nM, 1600nM and 3200nM) are circulated in an experiment, the interaction concentration gradient specific binding curve of the berberine and the target protein is shown in figure 6, 2 strong interaction pairs (KD is 1.27E-06 and 2.96E-06 respectively) of UHRF1 and berberine, UHRF1 TTD-PHD and berberine exist, 1 interaction pair (KD is 9.61E-04) of UHRF1-R235A and berberine exist, and other proteins show extremely weak (or no) interaction pairs with the berberine.

The SPR experiment further verifies that berberine interacts with UHRF1 TTD-PHD structure domain, amino acid No. 235 is a combined active center, R is mutated into A by using a point mutation technology, so that the equilibrium dissociation constant of UHRF1 protein and berberine is increased from 1.27E-06 to 9.61E-04, and the equilibrium dissociation constant of TTD-PHD protein and berberine is increased from 2.96E-06 to 2.25E-03.

It has been shown that hemimethylated DNA (hm-DNA) can open the tightly folded structure of UHRF1 to promote the binding of UHRF1 and H3K9me2/3, and in order to further verify the binding of berberine and UHRF1, this patent synthesizes hm-DNA (12-bp, upper strand5 '-GAGGCCXGCCTGC-3' and lower strand 5'-GCAGGCGGCCTC-3', X: 5-methyleoxyethylene), uniformly mixes UHRF1 and hm-DNA at a molar ratio of UHRF1/hm-DNA of 1:2, and verifies the SPR experiment after the complex is incubated at 4 ℃ for 10 min.

The result shows that hmDNA can promote the combination of UHRF1 and BBR, and the KD value of BBR-UHRF1-hmDNA is 4.60E-07, which indicates that the KD values of berberine and UHRF1 are true.

Example 4: UHRF1 is highly expressed in MM and suggests poor prognosis

In order to investigate the expression level of a target protein UHRF1 of berberine in MM, the method firstly uses lymphocyte separating liquid to separate 3 groups of hPBMCs from 3 normal human peripheral blood, extracts CD138 positive cells from a bone marrow specimen of 3 MM patients, and then uses western blotting to detect the expression level of UHRF1 protein in the CD138 positive cells, the normal human PBMCs and the MM cell strain protein of the MM patients.

Results as shown in fig. 7A and B, UHRF1 exhibited high level expression in MM patient CD138 positive cells and MM cell lines, whereas UHRF1 was underexpressed in normal human PBMCs.

To investigate the prognostic role of UHRF1 Expression levels in MM patients, this patent analyzed the relationship of UHRF1 mRNA Expression levels to MM patient prognosis by the Gene Expression Omnibus (GEO) database (GSE4581) Gene chip set.

The results are shown in FIG. 7C, where 414 MM patients were divided into two groups based on UHRF1 mRNA expression levels, 52 in the UHRF1high group and 362 in the UHRF1low group, and a high level of UHRF1 mRNA expression indicated poor prognosis. Indicating that UHRF1 may play an oncogene role in MM.

Example 5: berberine promotes UHRF1 degradation

In order to study the effect of berberine on the target protein UHRF1, the patent examined whether berberine can cause UHRF1 to degrade after 25 mu M berberine is used to treat RPMI-8266, MM.1S and U266 cells (0,1, 2, 4, 8, 12 and 24 h). As a result, as shown in FIG. 8A, the expression level of UHRF1 protein decreased with the increase of berberine treatment time.

After RPMI-8266, MM.1S and U266 cells are treated by berberine with different concentrations for 24h, protein extraction detects the expression level of UHRF1 protein, and the result is shown in FIG. 8B, wherein the expression level of UHRF1 protein is reduced along with the increase of the berberine treatment concentration.

DNMT1(DNA methyltransferase 1) is an important downstream molecule for UHRF1 to achieve methylation of DNA and histones, and the expression level of DNMT1 gradually decreases with increasing berberine treatment concentration, and the results are shown in FIG. 8A.

To examine whether tumor suppressor genes (P16. sup. INK4A, P53, P73) regulated by the expression level of UHRF1 were also regulated by berberine, the present patent examined the expression levels of these genes.

As shown in FIG. 9, 25 μ M berberine activated the expression levels of P16INK4A, P53, P73 in MM1.S cells, and P16INK4A and P73 in RPMI-8266 cells. These results suggest that berberine exerts anti-MM effects by inducing UHRF1 protein degradation and activating the expression of several tumor suppressor genes.

In order to investigate whether berberine can also inhibit the expression level of UHRF1 mRNA, 25 mu M berberine is used for treating RPMI-8266and MM.1S cells for 24h, then RNA is extracted, and qPCR technology is used for detecting the change of the expression level of UHRF1 mRNA before and after berberine treatment of MM cells.

The results are shown in fig. 10, the expression level of UHRF1 mRNA in the berberine treated group is not significantly reduced, and has no statistical significance (mean ±. SD, n ═ 3), which indicates that berberine induces UHRF1 protein degradation at the posttranslational level.

Example 6: berberine promotes UHRF1 ubiquitination degradation

Cycloheximide (CHX) inhibits protein synthesis in eukaryotes but not prokaryotes. To further investigate the effect of berberine on the stability of UHRF1 protein, this patent used CHX as an inhibitor of protein synthesis to observe the effect on the stability of UHRF1 protein before and after berberine treatment.

The experimental groups were DMSO, berberine, DMSO + CHX and BBR + CHX. Cell lysates were collected and expression levels of UHRF1 and GAPDH were determined.

FIG. 11A shows DMSO, BBR (25. mu.M 24h), or RPMI-8266and MM.1S cells treated with DMSO solutions or with BBR pre-treatment (25. mu.M, 12, 16, 20h) followed by addition of CHX (50. mu.g, 4, 8, 12 h). Cell lysates were collected and expression levels of UHRF1 and GAPDH were determined. The results showed that UHRF1 expression level was significantly higher in the CHX-alone treated group than in the CHX + berberine treated group.

To investigate the degradation pathway by berberine leading to UHRF1, the patent was initiated by lysosomal inhibitors: chloroquine, autophagy inhibitor: 3-MA, proteasome inhibitor: MG132, combined with berberine, western blot assay, found that only proteasome inhibitor MG132 promoted an increase in UHRF1 protein levels (fig. 11B and C).

The above results indicate that the protein degradation of UHRF1 by berberine is most likely achieved by the proteasome-ubiquitination pathway.

Next, this patent verified that berberine caused the UHRF1 degradation phenomenon by two immunoprecipitation experiments (IP: Ub-beads, IP: UHRF 1).

After treating RPMI-8266 cells with 25 μ M berberine for 24h, proteins ubiquitinated were purified with antibody Ub magnetic beads, and the level of UHRF1 ubiquitination was detected by western blotting.

HA-Ub vector is transiently transferred to RPMI-8266, after 25 mu M berberine is used for treating RPMI-8266 cells for 24h, endogenous UHRF1 is subjected to immunoprecipitation by using UHRF1 antibody, and the UHRF1 ubiquitination level is detected by western blotting.

The results are shown in FIG. 12.

IP: ub-beads showed (FIG. 12A) that UHRF1 with ubiquitination modification in berberine treated group was significantly higher than control group, and the same phenomenon occurred in IP: flag beads experiment (fig. 12B).

Combining the above experimental results, it can be concluded that berberine promotes ubiquitination degradation of UHRF 1.

The primers involved in the specific embodiment are shown in table 4:

TABLE 4 primer sequences

Example 7: screening effective UHRF1-siRNA and MTT method for detecting influence of UHRF1-siRNA on RPMI-8266 cells

In order to screen the most efficient UHRF1-siRNA sequences, three siRNA sequences were synthesized in this patent, UHRF1-siRNA- #1/- #2/- #3, respectively, and the sequences are shown in Table 5:

TABLE 5 siRNA sequences

3 100nM UHRF1-siRNA sequences were transfected with lipofectamine 3000 into RPMI-8266, MM.1S cells and tested 48h later for UHRF1 mRNA and protein expression levels.

Results are shown in fig. 13, and results of detecting UHRF1 mRNA by qPCR show that 3 UHRF 1-sirnas can inhibit the expression of UHRF1 mRNA with significant difference (fig. 13A), but UHRF1-siRNA- #2 can significantly reduce the expression level of UHRF1 protein in two cells (fig. 13B).

In order to study the effect of targeted inhibition on the proliferation capacity of MM cells after UHRF1 expression, UHRF1-siRNA is transfected into RPMI-8266and MM.1S cells, and the relative cell activity is detected by an MTT method after 48 h.

As shown in FIG. 14, after 100nM UHRF1-siRNA acted on RPMI-8266and MM.1S cells for 48h, the cell activity of UHRF1-siRNA #2 treated group was significantly inhibited compared with NC-siRNA by MTT assay. These results indicate that inhibition of UHRF1 expression inhibits the proliferation of MM cells.

Example 8: colony experiment to examine the effect of UHRF1-siRNA on the Colony formation of RPMI-8266 cells

To further study the effect of siRNA targeting inhibition of UHRF1 expression level on clonogenic capacity of MM cells, this patent examined colony formation after treating RPMI-8266, MM.1S cells with 100nM UHRF1-siRNA # 2.

The results are shown in FIG. 15 below. Compared with the NC-siRNA treated group, the UHRF1-siRNA treated group has obviously fewer clones formed by RPMI-8266and MM.1S cells, and the sizes of the formed clones are also obviously smaller and have obvious difference (P < 0.05).

Example 9: MTT method for detecting influence of UHRF1-siRNA #2 on berberine effect RPMI-8266 cell drug sensitivity

In order to further study the influence of RPMI-8266and MM.1S cells on berberine drug sensitivity after siRNA targeted inhibition of UHRF1, UHRF1-siRNA #2 with the concentration of 100nM is respectively combined with 25 and 50 mu M berberine to act on the RPMI-8266 cells, and after 48h, the activity of the RPMI-8266 cells under the action of 25 and 50 mu M berberine is found to be inhibited through detection and calculation, and compared with a random control group under the action of berberine, a significant difference (P <0.05) is shown (figure 16), which shows that the influence of berberine on the activity of the RPMI-8266 cells is partially dependent on the intracellular expression level of UHRF1, and the drug sensitivity of the RPMI-8266and MM.1S cells on berberine is weakened after UHRF1-siRNA #2 targeted inhibition of UHRF 1.

Example 10: MTT method for detecting influence of over-expression of UHRF1 on drug sensitivity of berberine acting RPMI-8266 cells

In order to research the effect of UHRF1 overexpression on RPMI-8266and MM.1S cell proliferation capacity, UHRF1 lentiviral vectors (the structure is shown in figure 17) purchased from Guangzhou Funeng Gene Co., Ltd and empty vector lentiviral particles are utilized to construct RPMI-8266and MM.1S cells for stably expressing UHRF1, puromycin screening is carried out, and cell extraction proteins are collected to detect the expression level of UHRF1 proteins.

The method for constructing RPMI-8266and MM.1S cell strains stably expressing UHRF1 by using the UHRF1 lentiviral vector specifically comprises the following steps:

1) infecting RPMI-8266and MM.1S cell strains by using UHRF1 lentivirus expression vector

a) Taking MM cells RPMI-8266/MM.1S in logarithmic growth phase, centrifuging the cells in a 1.5mL EP tube, collecting the cells, diluting the cell precipitate with 100-200uL of serum-free culture medium according to the amount of the cell precipitate, and taking the serum-free culture medium as a standard for completely immersing the cells;

b) the amount of virus particles was converted to MOI, the virus solution was aspirated and added to the cells, and a 1.5mL EP tube was placed at 37 ℃ and CO₂Incubating for 30 minutes in a cell culture box with the volume fraction of 5%;

c) sucking out the mixed solution in the tube and adding the mixed solution into a 24-hole culture plate;

d) adding a sufficient amount of fresh culture fluid;

e) changing the liquid after 12 hours;

f) after 96 hours, the GFP positivity of the cells was observed under a fluorescent microscope.

2) Puromycin screening of RPMI-8266 cell line stably expressing UHRF1

After RPMI-8266/MM.1S cells are successfully infected by the UHRF1 lentivirus expression vector, puromycin is added into a culture system, so that the final concentration of puromycin in the culture system is 2 mu g/mL (the optimal drug concentration determined by a pre-experiment), and a cell culture solution is replaced every 2-3 days.

As shown in fig. 18A, the UHRF1 protein expression level was significantly increased in the UHRF1 lentiviral Vector group (UHRF1) compared to the empty lentiviral Vector group (Vector).

Next, this patent compared the effect of UHRF1 overexpression on cell proliferation potency by MTT method, and as a result, it is shown in fig. 18B that overexpression of UHRF1 significantly enhanced MM cell proliferation potency.

In order to study whether overexpression of UHRF1 can improve drug sensitivity of berberine to MM cell proliferation, after 25 and 50 mu M berberine acts on RPMI-8266, MM.1S cell (Vector) of empty viral Vector, RPMI-8266and MM.1S cell (UHRF1) of UHRF1 viral Vector group, cell activity is inhibited, and relative activity is gradually reduced along with increase of drug concentration. The relative activity of UHRF1 group was significantly higher than that of NEG group, with statistical significance (P <0.05) (fig. 18C).

It is further speculated that RPMI-8266 cells overexpressing UHRF1 have drug resistance responses to berberine. These results indicate that the expression level of UHRF1 plays an important role in maintaining the pharmacological effects of berberine on MM cell lines.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> river-south university

<120> berberine-mediated UHRF1 gene inhibition and application thereof in preparation of medicines for treating multiple myeloma

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> UHRF1-siRNA #2 sense strand

<400> 1

gagagcgaga gaaggagaac agcaa 25

<210> 2

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> UHRF1-siRNA #2 antisense strand

<400> 2

uugcuguucu ccuucucucg cucuc 25

<210> 3

<211> 793

<212> PRT

<213> Homo sapiens

<220>

<223> UHRF1 protein sequence Q96T88

<400> 3

Met Trp Ile Gln Val Arg Thr Met Asp Gly Arg Gln Thr His Thr Val

1 5 10 15

Asp Ser Leu Ser Arg Leu Thr Lys Val Glu Glu Leu Arg Arg Lys Ile

20 25 30

Gln Glu Leu Phe His Val Glu Pro Gly Leu Gln Arg Leu Phe Tyr Arg

35 40 45

Gly Lys Gln Met Glu Asp Gly His Thr Leu Phe Asp Tyr Glu Val Arg

50 55 60

Leu Asn Asp Thr Ile Gln Leu Leu Val Arg Gln Ser Leu Val Leu Pro

65 70 75 80

His Ser Thr Lys Glu Arg Asp Ser Glu Leu Ser Asp Thr Asp Ser Gly

85 90 95

Cys Cys Leu Gly Gln Ser Glu Ser Asp Lys Ser Ser Thr His Gly Glu

100 105 110

Ala Ala Ala Glu Thr Asp Ser Arg Pro Ala Asp Glu Asp Met Trp Asp

115 120 125

Glu Thr Glu Leu Gly Leu Tyr Lys Val Asn Glu Tyr Val Asp Ala Arg

130 135 140

Asp Thr Asn Met Gly Ala Trp Phe Glu Ala Gln Val Val Arg Val Thr

145 150 155 160

Arg Lys Ala Pro Ser Arg Asp Glu Pro Cys Ser Ser Thr Ser Arg Pro

165 170 175

Ala Leu Glu Glu Asp Val Ile Tyr His Val Lys Tyr Asp Asp Tyr Pro

180 185 190

Glu Asn Gly Val Val Gln Met Asn Ser Arg Asp Val Arg Ala Arg Ala

195 200 205

Arg Thr Ile Ile Lys Trp Gln Asp Leu Glu Val Gly Gln Val Val Met

210 215 220

Leu Asn Tyr Asn Pro Asp Asn Pro Lys Glu Arg Gly Phe Trp Tyr Asp

225 230 235 240

Ala Glu Ile Ser Arg Lys Arg Glu Thr Arg Thr Ala Arg Glu Leu Tyr

245 250 255

Ala Asn Val Val Leu Gly Asp Asp Ser Leu Asn Asp Cys Arg Ile Ile

260 265 270

Phe Val Asp Glu Val Phe Lys Ile Glu Arg Pro Gly Glu Gly Ser Pro

275 280 285

Met Val Asp Asn Pro Met Arg Arg Lys Ser Gly Pro Ser Cys Lys His

290 295 300

Cys Lys Asp Asp Val Asn Arg Leu Cys Arg Val Cys Ala Cys His Leu

305 310 315 320

Cys Gly Gly Arg Gln Asp Pro Asp Lys Gln Leu Met Cys Asp Glu Cys

325 330 335

Asp Met Ala Phe His Ile Tyr Cys Leu Asp Pro Pro Leu Ser Ser Val

340 345 350

Pro Ser Glu Asp Glu Trp Tyr Cys Pro Glu Cys Arg Asn Asp Ala Ser

355 360 365

Glu Val Val Leu Ala Gly Glu Arg Leu Arg Glu Ser Lys Lys Lys Ala

370 375 380

Lys Met Ala Ser Ala Thr Ser Ser Ser Gln Arg Asp Trp Gly Lys Gly

385 390 395 400

Met Ala Cys Val Gly Arg Thr Lys Glu Cys Thr Ile Val Pro Ser Asn

405 410 415

His Tyr Gly Pro Ile Pro Gly Ile Pro Val Gly Thr Met Trp Arg Phe

420 425 430

Arg Val Gln Val Ser Glu Ser Gly Val His Arg Pro His Val Ala Gly

435 440 445

Ile His Gly Arg Ser Asn Asp Gly Ala Tyr Ser Leu Val Leu Ala Gly

450 455 460

Gly Tyr Glu Asp Asp Val Asp His Gly Asn Phe Phe Thr Tyr Thr Gly

465 470 475 480

Ser Gly Gly Arg Asp Leu Ser Gly Asn Lys Arg Thr Ala Glu Gln Ser

485 490 495

Cys Asp Gln Lys Leu Thr Asn Thr Asn Arg Ala Leu Ala Leu Asn Cys

500 505 510

Phe Ala Pro Ile Asn Asp Gln Glu Gly Ala Glu Ala Lys Asp Trp Arg

515 520 525

Ser Gly Lys Pro Val Arg Val Val Arg Asn Val Lys Gly Gly Lys Asn

530 535 540

Ser Lys Tyr Ala Pro Ala Glu Gly Asn Arg Tyr Asp Gly Ile Tyr Lys

545 550 555 560

Val Val Lys Tyr Trp Pro Glu Lys Gly Lys Ser Gly Phe Leu Val Trp

565 570 575

Arg Tyr Leu Leu Arg Arg Asp Asp Asp Glu Pro Gly Pro Trp Thr Lys

580 585 590

Glu Gly Lys Asp Arg Ile Lys Lys Leu Gly Leu Thr Met Gln Tyr Pro

595 600 605

Glu Gly Tyr Leu Glu Ala Leu Ala Asn Arg Glu Arg Glu Lys Glu Asn

610 615 620

Ser Lys Arg Glu Glu Glu Glu Gln Gln Glu Gly Gly Phe Ala Ser Pro

625 630 635 640

Arg Thr Gly Lys Gly Lys Trp Lys Arg Lys Ser Ala Gly Gly Gly Pro

645 650 655

Ser Arg Ala Gly Ser Pro Arg Arg Thr Ser Lys Lys Thr Lys Val Glu

660 665 670

Pro Tyr Ser Leu Thr Ala Gln Gln Ser Ser Leu Ile Arg Glu Asp Lys

675 680 685

Ser Asn Ala Lys Leu Trp Asn Glu Val Leu Ala Ser Leu Lys Asp Arg

690 695 700

Pro Ala Ser Gly Ser Pro Phe Gln Leu Phe Leu Ser Lys Val Glu Glu

705 710 715 720

Thr Phe Gln Cys Ile Cys Cys Gln Glu Leu Val Phe Arg Pro Ile Thr

725 730 735

Thr Val Cys Gln His Asn Val Cys Lys Asp Cys Leu Asp Arg Ser Phe

740 745 750

Arg Ala Gln Val Phe Ser Cys Pro Ala Cys Arg Tyr Asp Leu Gly Arg

755 760 765

Ser Tyr Ala Met Gln Val Asn Gln Pro Leu Gln Thr Val Leu Asn Gln

770 775 780

Leu Phe Pro Gly Tyr Gly Asn Gly Arg

785 790

<210> 4

<211> 25

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Peptide-1

<400> 4

Val Arg Ala Arg Ala Arg Thr Ile Ile Lys Trp Gln Asp Leu Glu Val

1 5 10 15

Gly Gln Val Val Met Leu Asn Tyr Asn

20 25

<210> 5

<211> 25

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Peptide-2

<400> 5

Glu Gly Ser Pro Met Val Asp Asn Pro Met Arg Arg Lys Ser Gly Pro

1 5 10 15

Ser Cys Lys His Cys Lys Asp Asp Val

20 25

<210> 6

<211> 25

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Peptide-3

<400> 6

Val Met Leu Asn Tyr Asn Pro Asp Asn Pro Lys Glu Arg Gly Phe Trp

1 5 10 15

Tyr Asp Ala Glu Ile Ser Arg Lys Arg

20 25

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> GAPDH primer Forward

<400> 7

caacggattt ggtcgtatt 19

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> GAPDH primer reverse

<400> 8

cacagtcttc tgggtggc 18

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> forward direction of UHRF1 primer

<400> 9

ggcaagtgga agcggaagtc g 21

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer reverse UHRF1

<400> 10

cttggcgttg ctcttgtcct ctc 23

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> forward direction of P53 primer

<400> 11

ccaacaacac cagctcctct 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P53 primer reverse

<400> 12

caaggcctca ttcagctctc 20

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P16 primer

<400> 13

tcatgatgat gggcagcg 18

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P16 primer reverse

<400> 14

catctatgcg ggcatggtta 20

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> forward direction of P73 primer

<400> 15

ccttggtgcc ggtgtgaaga ag 22

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> P73 primer reverse

<400> 16

gctgctgctg ctgccgatag 20

<210> 17

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> UHRF1-siRNA #1 sense strand

<400> 17

cgagagcgag agaaggagaa cagca 25

<210> 18

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> UHRF1-siRNA #1 antisense strand

<400> 18

ugcuguucuc cuucucucgc ucucg 25

<210> 19

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> UHRF1-siRNA #3 sense strand

<400> 19

gagcgagaga aggagaacag caaga 25

<210> 20

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> UHRF1-siRNA #3 antisense strand

<400> 20

ucuugcuguu cuccuucucu cgcuc 25

<210> 21

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Negative Control siRNA sense strand

<400> 21

gagagaaaga ggaaggacac cgaga 25

<210> 22

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Negative Control siRNA antisense strand

<400> 22

ucucgguguc cuuccucuuu cucuc 25

Claims

Use of UHRF1-siRNA and/or UHRF1-siRNA biomaterial in the manufacture of a medicament for the treatment of multiple myeloma, characterized in that:

the UHRF1-siRNA is siRNA for inhibiting UHRF1 gene expression, and the sequence of the siRNA is shown as follows:

sense strand: gagagcgagagaaggagaacagcaatt (SEQ. ID. number 1);

antisense strand: uugcuguucuccuucucucgcucuctt (SEQ. ID. number 2).
2. Use according to claim 1, characterized in that: the UHRF1-siRNA biomaterial is any one of the following:

(ii) DNA encoding UHRF 1-siRNA;

② an expression cassette containing the DNA;

③ a recombinant vector containing said DNA;

a recombinant vector containing the expression cassette;

a recombinant microorganism containing the DNA of (i);

sixthly, recombinant microorganism containing the expression cassette;

seventhly, recombinant microorganisms containing the recombinant vector;

the recombinant microorganism contains the recombinant vector.
3. Use according to claim 1, characterized in that: the treatment of multiple myeloma aims at multiple myeloma cells RPMI-8266, MM.1S and U266.
4. Use according to claim 1, characterized in that: the treatment of multiple myeloma is embodied in inhibiting the proliferation capacity and the clonogenic capacity of multiple myeloma cells.
5. Use according to claim 1, characterized in that: the dosage form of the medicine for treating multiple myeloma is aerosol, tablets, capsules, dripping pills, powder, solutions, suspensions, emulsions, granules, lipidic agents, transdermal agents, buccal agents, suppositories or freeze-dried powder injections.