CN111363021A

CN111363021A - SiNAC67 protein and coding gene and application thereof

Info

Publication number: CN111363021A
Application number: CN202010401854.6A
Authority: CN
Inventors: 陈明; 孙黛珍; 马有志; 黎毛毛; 张玥玮; 唐文思; 周永斌; 徐兆师; 陈隽
Original assignee: Shanxi Agricultural University; Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Shanxi Agricultural University; Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2020-05-13
Filing date: 2020-05-13
Publication date: 2020-07-03
Anticipated expiration: 2040-05-13
Also published as: CN111363021B

Abstract

The invention discloses a SiNAC67 protein, and a coding gene and application thereof. The invention provides a new gene for rice stress genetic engineering, and simultaneously introduces japonica rice fine varieties through genetic transformation to culture new stress-resistant transgenic varieties, so that the stress resistance of rice can be effectively improved, the influence of stress on rice production is reduced, and important economic and social benefits are achieved.

Description

SiNAC67 protein and coding gene and application thereof

Technical Field

The invention relates to a SiNAC67 protein, and a coding gene and application thereof.

Background

China is one of countries with the lowest grain input and output of unit fertilizers in the world, the utilization rate of nitrogen fertilizers is only 30-35% (45% in developed countries), and the utilization rate of phosphate fertilizers is only 10-20%. According to the current consumption, for example, 10 percent of nitrogen fertilizer and 20 percent of phosphate fertilizer are saved, 241 million yuan of capital can be saved every year. The low-efficiency utilization of nitrogen and phosphorus fertilizers enables agricultural non-point source pollution to become the most important factor for water system eutrophication, soil acidification and heavy metal pollution, and threatens ecological safety and sustainable development. Therefore, our country urgently needs to cultivate new crop varieties with high nutrient utilization efficiency, thereby greatly improving the utilization efficiency of nitrogen and phosphorus fertilizers in our country.

The cultivation of new stress-resistant rice varieties improves the stress resistance of the rice varieties, and is an important measure for improving the yield level of the rice under the conditions of reduced application amount of chemical fertilizers and drought and water shortage.

Disclosure of Invention

The invention aims to provide an SiNAC67 protein, and a coding gene and application thereof.

In a first aspect, the invention firstly protects the application of SiNAC67 protein or its related biomaterials in (a1) and/or (a2) as follows:

(a1) regulating and controlling plant yield-related traits;

(a2) regulating and controlling the stress resistance of the plants;

the related biological material is a nucleic acid molecule capable of expressing the SiNAC67 protein or an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule;

the SiNAC67 protein is any one of the following proteins:

(A1) protein with an amino acid sequence of SEQ ID No. 4;

(A2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.4 and has the same function;

(A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (A1) to (A2) and having the same function;

(A4) a fusion protein obtained by attaching a protein tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

In the above protein, the tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, etc.

The nucleic acid molecule can be specifically a coding gene of SiNAC67 protein. The coding gene of the SiNAC67 protein is a DNA molecule as follows:

(B1) DNA molecule shown in SEQ ID No. 1;

(B2) DNA molecule shown in SEQ ID No. 2;

(B3) a DNA molecule shown as SEQ ID No. 3;

(B4) a DNA molecule which hybridizes with the DNA molecule defined in (B1) or (B2) or (B3) under stringent conditions and encodes the SiNAC67 protein;

(B3) a DNA molecule which has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% of identity with the DNA sequence defined in (B1) or (B2) or (B3) and encodes the SiNAC67 protein.

The stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridizing with 1mM EDTA, rinsing in 2 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridizing with 1mM EDTA, rinsing in 1 × SSC, 0.1% SDS at 50 deg.C, or 7% EDTA at 50 deg.CSDS、0.5M NaPO₄Hybridizing with 1mM EDTA, rinsing in 0.5 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridizing with 1mM EDTA, rinsing in 0.1 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridization with a mixed solution of 1mM EDTA, rinsing in 0.1 × SSC, 0.1% SDS at 65 ℃ or 6 × SSC, 0.5% SDS at 65 ℃ followed by washing once each with 2 × SSC, 0.1% SDS and 1 × SSC, 0.1% SDS.

The expression cassette can be specifically an expression cassette consisting of a ubiquitin constitutive promoter, the coding gene of the SiNAC67 protein and a terminator nos 3'. The expression cassette can be obtained by double enzyme digestion of a recombinant vector by Hind III and EcoRI. The recombinant vector can be specifically a recombinant vector obtained by cloning SEQ ID NO.3 into BamHI and SpeI sites of the vector LP 0471118-Bar-ubi-EDLL.

The recombinant vector can be specifically a recombinant vector obtained by cloning SEQ ID NO.3 into BamHI and SpeI sites of the vector LP 0471118-Bar-ubi-EDLL.

The recombinant strain can be obtained by introducing the expression cassette or the recombinant vector into an agrobacterium strain. The agrobacterium strain may specifically be agrobacterium strain EHA 105.

In said use, said plant yield-related traits comprise ear number, ear length, grain per ear and/or biomass; the biomass comprises the weight of rice straw and/or the weight of rice.

The plant stress resistance is the resistance of a plant to low nitrogen stress.

The modulation is a forward modulation.

In a second aspect, the invention protects the application of the SiNAC67 protein or its related biological materials in plant breeding;

the SiNAC67 protein is as shown above.

In the application, the breeding aims to breed plants with high yield and/or high stress resistance. The high yield can be embodied in particular as a high number of ears and/or a high ear length and/or a high number of grains per ear and/or a high biomass. The biomass comprises the weight of rice straw and/or the weight of rice. The stress tolerance is in particular resistance to low nitrogen stress. The high resistance to low nitrogen stress is reflected by high yield and/or plant height under low nitrogen stress. The high resistance to low nitrogen stress is reflected by a high nitrogen content.

In a third aspect, the invention provides a method for improving plant yield and/or improving plant stress tolerance, comprising the step of improving the expression level and/or activity of SiNAC67 protein in a receptor plant.

The yield is specifically the ear number, ear length, grain number per ear, grain weight and/or biomass.

The biomass comprises the weight of rice straw and/or the weight of rice.

The stress tolerance is in particular resistance to low nitrogen stress.

The improved stress tolerance can be embodied as an increased yield and/or an increased plant height under low nitrogen stress.

The high resistance to low nitrogen stress is reflected by a high nitrogen content.

The SiNAC67 protein is as shown above.

In a fourth aspect, the present invention provides a method of growing a transgenic plant, comprising the steps of: introducing a nucleic acid molecule capable of expressing SiNAC67 protein into a receptor plant to obtain a transgenic plant with the increased expression level of the SiNAC67 protein; the transgenic plant has increased yield and/or stress tolerance as compared to the recipient plant.

The biomass comprises the weight of rice straw and/or the weight of rice.

The stress tolerance is in particular resistance to low nitrogen stress.

The 'introduction of a nucleic acid molecule capable of expressing the SiNAC67 protein' into a recipient plant is carried out by introducing an expression cassette containing a gene encoding the SiNAC67 protein into the recipient plant.

The encoding gene of the SiNAC67 protein is as shown above.

The expression cassette can be obtained by double enzyme digestion of a recombinant vector by Hind III and EcoRI. The recombinant vector can be specifically a recombinant vector obtained by cloning SEQ ID NO.3 into BamHI and SpeI sites of the vector LP 0471118-Bar-ubi-EDLL.

The number of grains per spike is the number of solid grains per spike and/or the total grains per spike.

Any one of the plants is a dicotyledonous plant or a monocotyledonous plant;

further, the monocotyledon is a gramineous plant;

further, the gramineous plant is rice or millet.

The rice can be rice variety Kitaake.

The millet can be Yu Gu I.

The invention provides a new gene for rice stress genetic engineering, and simultaneously introduces japonica rice fine varieties through genetic transformation to culture new stress-resistant transgenic varieties, so that the stress resistance of rice can be effectively improved, the influence of stress on rice production is reduced, and important economic and social benefits are achieved.

Drawings

FIG. 1 shows SSR detection results of stress-resistant rice with SiNAC67 transgenic gene. Marker: DL1000 Marker; negative control: kitaake; positive control: plant expression vector psSiNAC 67.

Fig. 2 shows the statistical result of 18-year field test data.

FIG. 3 is a comparison of transgenic plants with wild type phenotype.

FIG. 4 shows the statistical results of the test data under the condition of normal field treatment for 19 years.

FIG. 5 is a statistical result of detection data under 19-year field low nitrogen stress conditions.

FIG. 6 shows the statistical results of 19 years field straw and rice weight measurement data.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

LP0471118-Bar-ubi-EDLL vector: are described in the literature: ning bud, Wang Shuang, ju Peng Gao, Bai Xin Xuan, Ge Lin Hao, Qixin, Jiangqin, Sun Xijun, Chenming, Sun Dazhen, over-expression millet SiANT1 has influence on rice salt tolerance [ J ]. Chinese agricultural science, 2018,51(10): 1830) 1841.

Yugu I: are described in the literature: ning bud, Wang Shuang, ju Peng lifting, Bai Xin Xuan, Ge Lin Hao, Qixin, Jiangqin, Sun Shi Jun, Chenming, Sun Dazhen, overexpression of millet SiANT1 on rice salt tolerance [ J ]. Chinese agricultural science, 2018,51(10):1830 one 1841.; the public is available from the institute of crop science, academy of agricultural sciences, china.

bar gene expression vector pSBAR: are described in the literature: obtaining drought resistant transgenic wheat [ D ] using an improved minimum expression box technique, university of inner mongolia agriculture, 2012; the public is available from the institute of crop science, academy of agricultural sciences, china.

Agrobacterium strain EHA 105: beijing Ongke New Biotechnology Co.

Rice variety Kitaake: are described in the literature: ning bud, Wang Shuang, ju Peng lifting, Bai Xin Xuan, Ge Lin Hao, Qixin, Jiangqin, Sun Shi Jun, Chenming, Sun Dazhen, overexpression of millet SiANT1 on rice salt tolerance [ J ]. Chinese agricultural science, 2018,51(10):1830 one 1841.; the public is available from the institute of crop science, academy of agricultural sciences, china.

Example 1 obtaining of SiNAC67 protein and Gene encoding the same

A stress resistance related gene is cloned from a first stress resistance millet and named as SiNAC67 gene, the genome sequence of the gene is shown as SEQ ID NO.1, the transcription sequence is shown as SEQ ID NO.2, and the CDS is shown as SEQ ID NO. 3. The protein (SiNAC67 protein) coded by the SiNAC67 gene is shown in SEQ ID No. 4.

Example 2, application of SiNAC67 protein and encoding gene thereof in rice breeding

Preparation of linear minimal expression cassette

1. Obtaining of plant expression vector psSiNAC67

Extracting total RNA of Yugu No. one, and reverse transcribing into cDNA. The cDNA was used as a template, PCR amplification was carried out using a primer F and a primer R, and the CDS sequence (SEQ ID NO.3) of SiNAC67 was cloned into BamHI and SpeI sites of vector LP0471118-Bar-ubi-EDLL using a seamless cloning kit (cat # 639649) from Clotech according to the procedures described in the specification to obtain plant expression vector psSiNAC67 (which was sequence-verified).

And (3) primer F: 5'-AGACCGATCTGGATCATGGGAGTGCCGGTGAG-3', respectively;

and (3) primer R: 5'-CGATCGATCCACTAGTCAGAAGGGGGCCAACCCG-3' are provided.

2. Preparation of Linear minimal expression cassette

And (2) adopting Hind III and EcoRI double enzyme digestion to obtain the plant expression vector psSiNAC67 obtained in the step 1, recovering a fragment of about 3200bp to obtain a SiNAC67 gene linear minimum expression frame, wherein the linear minimum expression frame consists of a ubiquitin constitutive promoter (1800bp), a SiNAC67 gene (951bp) and a terminator nos 3' (300 bp). The minimal expression frame transformation method can remove the vector skeleton sequence, has no ampicillin resistance gene, has no obvious difference between the transgenic rice and the receptor, has no pathogenicity, and reduces the safety risk of inserting the plant genome exogenous fragment.

Preparing a marker gene expression frame by using a bar gene as a marker gene: performing enzyme digestion on the bar gene expression vector pSBAR by using Hind III, and recovering an enzyme digestion product to obtain a marker gene expression frame; the marker gene expression frame consists of a maize ubiquitin promoter, a marker gene bar and a nos terminator.

Second, transformation of Rice

1. And (3) transforming the SiNAC67 gene linear minimum expression frame and the marker gene expression frame prepared in the step one into the agrobacterium tumefaciens strain EHA105 to obtain the recombinant agrobacterium tumefaciens.

2. Soaking immature embryos of a rice variety Kitaake 12-14 days after pollination in 70% ethanol for 1 minute, then disinfecting the immature embryos with 10% sodium hypochlorite for 15 minutes, washing the immature embryos with sterile water for 3-5 times, taking out the immature embryos on an ultra-clean bench, and inoculating the immature embryos to SD (secure digital)₂The young embryo callus is induced on a culture medium (MS basic culture medium (containing no vitamin) +2 mg/L2, 4-D +1mg/LVB1+150mg/LAsn asparagine +30g/L sucrose +2.4g/L plant gel, pH is 5.8) for 7 days, and then the induced callus is transferred to a hypertonic culture medium (MS basic culture medium +5 mg/L2, 4-D +0.4mol/L mannitol +3g/L plant gel) to be subjected to hypertonic treatment for 4-6 hours.

3. After step 2, the callus was infected with Agrobacterium and soaked in OD₆₀₀And oscillating and infecting the recombinant agrobacterium tumefaciens liquid of 0.8 for about 30min at 180 r/min.

4. After the step 3 is finished, continuously culturing the callus on a hypertonic culture medium for 16-18 hours, and then transferring the infected callus to SD₂Dark culture was performed on the medium for two weeks.

5. After the step 4 is completed, transferring the callus onto a selection culture medium containing 2-3mg/L of herbicide Bialaphos (MS basic culture medium (containing no vitamin) +2 mg/L2, 4-D +1mg/LVB1+150mg/LAsn asparagine +30g/L sucrose +2.4g/L plant gel +2-3mg/L herbicide Bialaphos, pH is 5.8) to perform callus screening, differentiation and seedling strengthening, so as to obtain a T0 generation transgenic rice plant.

Identification of transgenic positive rice

Extracting DNA of T0 generation rice leaves to be detected by adopting an SDS method, designing a primer for amplifying a partial sequence according to the SiNAC67 gene sequence by taking the DNA as a template to carry out PCR amplification, carrying out PCR amplification by adopting a primer F and a primer R, detecting a PCR amplification product by 0.8% agarose gel, and carrying out ultraviolet photographing. Replacing T0 generation rice with Kitaake rice variety to carry out the operation as negative control; plant expression vector psSiNAC67 was used as a positive control.

F：5’-AGAAGGGATCGCTCAGGTTG-3’；

R：5’-AGGTTACCGCCGTCGTCCAC-3’。

The PCR reaction system is shown in Table 1. And (3) PCR reaction conditions: denaturation at 94 deg.C for 5 min; 50sec at 94 ℃, 50sec at 62 ℃, 1min at 72 ℃ and 35 cycles; extension at 72 ℃ for 10 min.

TABLE 1

Composition (I)	Dosage (ul)
		(Takara)10xPCRbuffer(Mg²⁺Plus)	2.50
(Takara)25mMMg²⁺	0.05
		(Takara)2.5mMdNTPMixture	2.00
Primer F	0.80
		Primer R	0.80
(Takara)r-TaqDNAPloymerase(5U/ul)	0.25
		Form panel	1.00
ddH₂O	17.6
		Total of	25

The results are shown in FIG. 1. 5 positive plants are obtained through PCR detection, and the positive rate is 2%. After greenhouse generation adding, screening and identification, a transgenic SiNAC67 rice homozygous line is selected and named as OE33 for the following experiments.

Fourth, phenotype detection of transgenic rice

1. 2018 field phenotype detection

And (3) the plant to be detected: rice variety kitaake (wt), transgenic line OE 33.

Test site: transgenic test base of rice institute of agricultural science institute of high-safety Jiangxi province in Jiangxi province.

The seedling bed management is the same as the field production (no nitrogen fertilizer is added), and each test material can grow normally.

8 plants are harvested from each material, and the biological yield and the rice yield of each material are determined in three times.

The N content of the paddy and the N content of the straw of the reference material are respectively measured by a Kjeldahl method. The detection method is specifically described in the references "comparison of total nitrogen in plants by Yangyi, Chua-Shunlin. flow analysis and Kjeldahl method [ J ]. proceedings of the Seiki institute of America, 2016,32(08): 51-54" and "Dahonglin, Wu Xiaojun. determination of nitrogen content in dried samples of plants by Kjeldahl method [ J ]. proceedings of the Jiangsu institute of agriculture, 1995(03): 70").

3 plants of each material are respectively taken for indoor seed test, and the number of the single plant effective spikes (more than 5 single spikes are effective spikes), the solid grains per spike, the total grains per spike, the seed setting rate and the like are inspected.

The results are shown in FIG. 2. In FIG. 2, the nitrogen contents of rice and straw are expressed in g/8, and the nitrogen contents are expressed by the weight of 8 rice/straw. The total nitrogen content of the straws is expressed in percentage (%), which means the weight of the 8 straws per the nitrogen content of the straws.

The results show that the dry grain weight of the transgenic rice line is higher than the control in comparison with the control rice variety Kitaake without nitrogen fertilizer application. The number of the solid grains per ear and the total grains per ear are all higher than the control. The N content of the rice and the N content of the straw are higher than those of the control.

2. 2019 field data

Seedling bed management is the same as field production. Each test material was able to grow normally.

The test sets two treatments of applying 12 kilograms of pure nitrogen and not applying nitrogen fertilizer per mu, and each treatment is set for two times.

Each material is planted in 6 rows with 8 bags in each row and the row spacing of 5 × 6 inches, and the single material is planted.

The test area is 4.0 mu. Other fertilizer and water management in the field is the same as local production.

20 plants of each material are harvested for each treatment, and the weight of the straw and the weight of the paddy are respectively measured for each material after three times of repetition.

Each material was harvested 8 plants per treatment, and the biological yield and rice yield of each material were determined in triplicate.

And 3 plants of each material are respectively taken for indoor seed test in each treatment, and the number of the effective ears of each plant, the solid grains of each ear, the total grains of each ear and the like are inspected.

The phenotypic observations are shown in figure 3.

The statistical results are shown in fig. 4 (normal treatment), fig. 5 (low nitrogen treatment) and fig. 6.

The above results show that under the normal nitrogen fertilizer application condition, the biomass (straw weight, rice weight), ear number, ear length, solid grains per ear and total grains per ear of the transgenic plant are obviously higher than those of the receptor plant. Under the low nitrogen stress, the biomass (the weight of the straws and the weight of the paddy) of the transgenic plants, the plant height, the number of ears, the length of the ears, the solid grains per ear and the total grains per ear are also higher than those of the receptor plants.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

SHANXI AGRICULTURAL University

<120> SiNAC67 protein and coding gene and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1644

<212>DNA

<213> millet (Setaria italica)

<400>1

agccgccgac tcgctttgac gacgcccccc ggccgaagct tccagaccgc cgccgagccc 60

cccgccccct atatatccct cccctgcccg cggttcccag cttcaagaac atcgcagaat 120

ccacaggaca cacccagaga ccgcctcaga gccagcagca gccgccggag ccaaccaaga 180

agagtactgt tgcagagtgt tgcatagtgg gagggagcca gctaaatttg ccgatcaatt 240

ttcagcttcg acctcaccgt accgaccgat cgccatggga gtgccggtga ggagggagag 300

ggacgcggag gcggagctga acctgccgcc ggggttccgg ttccacccga cggacgacga 360

gctggtggag cactacctgt gccggaaggc ggcggggcag cgcctcccgg tgcccatcat 420

cgcggaggtg gacctctaca agttcgaccc atgggacctg ccggagcggg cgctcttcgg 480

caccagggag tggtacttct tcacgcccag ggaccgcaag taccctaacg gctcgcggcc 540

caaccgcgcc gccgggaacg gatactggaa ggcaaccgga gccgacaagc ccgtcgcgcc 600

gcgggggcgc acactcggga tcaagaaggc gctcgtgttc tacgccggca aggcgccgcg 660

aggggtcaag accgactgga tcatgcacga gtacaggctc gccgacgccg gccgtgccgc 720

cgcagccaag aagggatcgc tcagggtaag ccgctgattc ttcctccgaa tgttttcttt 780

cttactttct tctagagatt aaagatcatc gatttgggtt gaacagaaca gagtaactta 840

attctatcct gatccatttc tctgcagttg gatgactggg tgctgtgccg cctgtataac 900

aagaagaacg agtgggagaa gatgcagatg gggaaggggt ccgccctcgc cgccgccacc 960

accaccaagg aggaggcgat ggacatgacc acctcccact cgcactcgca gtcccactcg 1020

cactcgtggg gcgagacgcg cacgccggag tcggagatcg tcgacaacga cccgttcccg 1080

gagctggacg actcgttccc ggcgttccag gaccccgccg ccgcgatgat ggtgcccaag 1140

aaggagcccc aggtggacga cggcggtaac ctcgccgcca agaacagcga cctgttcgtg 1200

gacctcagct acgacgacat ccagagcatg tacagcgggc tcgacatgct gccgccgccc 1260

ggggaggact tctactcgtc gctcttcgcg tcgccgaggg tcaaggggaa ccacaccacc 1320

ggcggcgccg ggttggcccc cttctgaatt tctgaagtga cgcggcatgg gaatgaacca 1380

tgagaggatg gatgaccagg agacggcgcc gcaaggacgc ggcggcctct gtaaatacag 1440

cgtaggaagg agtcggaaga acctgaacct ggtcggggtt acagtgttaa gagtgtcggt 1500

gtagcgtaca aggagccggc ccgggggtgg cgccggctca tttttttttt tcacttttca 1560

cctcagaagg tagatactcg tatatgtgta gctctttcct ctttctccca acagaaccag 1620

acgaaatttt gatgttcctg ttta 1644

<210>2

<211>1522

<212>DNA

<213> millet (Setaria italica)

<400>2

agccgccgac tcgctttgac gacgcccccc ggccgaagct tccagaccgc cgccgagccc 60

cccgccccct atatatccct cccctgcccg cggttcccag cttcaagaac atcgcagaat 120

ccacaggaca cacccagaga ccgcctcaga gccagcagca gccgccggag ccaaccaaga 180

agagtactgt tgcagagtgt tgcatagtgg gagggagcca gctaaatttg ccgatcaatt 240

ttcagcttcg acctcaccgt accgaccgat cgccatggga gtgccggtga ggagggagag 300

ggacgcggag gcggagctga acctgccgcc ggggttccgg ttccacccga cggacgacga 360

gctggtggag cactacctgt gccggaaggc ggcggggcag cgcctcccgg tgcccatcat 420

cgcggaggtg gacctctaca agttcgaccc atgggacctg ccggagcggg cgctcttcgg 480

caccagggag tggtacttct tcacgcccag ggaccgcaag taccctaacg gctcgcggcc 540

caaccgcgcc gccgggaacg gatactggaa ggcaaccgga gccgacaagc ccgtcgcgcc 600

gcgggggcgc acactcggga tcaagaaggc gctcgtgttc tacgccggca aggcgccgcg 660

aggggtcaag accgactgga tcatgcacga gtacaggctc gccgacgccg gccgtgccgc 720

cgcagccaag aagggatcgc tcaggttgga tgactgggtg ctgtgccgcc tgtataacaa 780

gaagaacgag tgggagaaga tgcagatggg gaaggggtcc gccctcgccg ccgccaccac 840

caccaaggag gaggcgatgg acatgaccac ctcccactcg cactcgcagt cccactcgca 900

ctcgtggggc gagacgcgca cgccggagtc ggagatcgtc gacaacgacc cgttcccgga 960

gctggacgac tcgttcccgg cgttccagga ccccgccgcc gcgatgatgg tgcccaagaa 1020

ggagccccag gtggacgacg gcggtaacct cgccgccaag aacagcgacc tgttcgtgga 1080

cctcagctac gacgacatcc agagcatgta cagcgggctc gacatgctgc cgccgcccgg 1140

ggaggacttc tactcgtcgc tcttcgcgtc gccgagggtc aaggggaacc acaccaccgg 1200

cggcgccggg ttggccccct tctgaatttc tgaagtgacg cggcatggga atgaaccatg 1260

agaggatgga tgaccaggag acggcgccgc aaggacgcggcggcctctgt aaatacagcg 1320

taggaaggag tcggaagaac ctgaacctgg tcggggttac agtgttaaga gtgtcggtgt 1380

agcgtacaag gagccggccc gggggtggcg ccggctcatt tttttttttc acttttcacc 1440

tcagaaggta gatactcgta tatgtgtagc tctttcctct ttctcccaac agaaccagac 1500

gaaattttga tgttcctgtt ta 1522

<210>3

<211>951

<212>DNA

<213> millet (Setaria italica)

<400>3

atgggagtgc cggtgaggag ggagagggac gcggaggcgg agctgaacct gccgccgggg 60

ttccggttcc acccgacgga cgacgagctg gtggagcact acctgtgccg gaaggcggcg 120

gggcagcgcc tcccggtgcc catcatcgcg gaggtggacc tctacaagtt cgacccatgg 180

gacctgccgg agcgggcgct cttcggcacc agggagtggt acttcttcac gcccagggac 240

cgcaagtacc ctaacggctc gcggcccaac cgcgccgccg ggaacggata ctggaaggca 300

accggagccg acaagcccgt cgcgccgcgg gggcgcacac tcgggatcaa gaaggcgctc 360

gtgttctacg ccggcaaggc gccgcgaggg gtcaagaccg actggatcat gcacgagtac 420

aggctcgccg acgccggccg tgccgccgca gccaagaagg gatcgctcag gttggatgac 480

tgggtgctgt gccgcctgta taacaagaag aacgagtggg agaagatgca gatggggaag 540

gggtccgccc tcgccgccgc caccaccacc aaggaggagg cgatggacat gaccacctcc 600

cactcgcact cgcagtccca ctcgcactcg tggggcgaga cgcgcacgcc ggagtcggag 660

atcgtcgaca acgacccgtt cccggagctg gacgactcgt tcccggcgtt ccaggacccc 720

gccgccgcga tgatggtgcc caagaaggag ccccaggtgg acgacggcgg taacctcgcc 780

gccaagaaca gcgacctgtt cgtggacctc agctacgacg acatccagag catgtacagc 840

gggctcgaca tgctgccgcc gcccggggag gacttctact cgtcgctctt cgcgtcgccg 900

agggtcaagg ggaaccacac caccggcggc gccgggttgg cccccttctg a 951

<210>4

<211>316

<212>PRT

<213> millet (Setaria italica)

<400>4

Met Gly Val Pro Val Arg Arg Glu Arg Asp Ala Glu Ala Glu Leu Asn

1 5 10 15

Leu Pro Pro Gly Phe Arg Phe His Pro Thr Asp Asp Glu Leu Val Glu

20 25 30

His Tyr Leu Cys Arg Lys Ala Ala Gly Gln Arg Leu Pro Val Pro Ile

35 40 45

Ile Ala Glu Val Asp Leu Tyr Lys Phe Asp Pro Trp Asp Leu Pro Glu

50 55 60

Arg Ala Leu Phe Gly Thr Arg Glu Trp Tyr Phe Phe Thr Pro Arg Asp

65 70 75 80

Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn Arg Ala Ala Gly Asn Gly

85 90 95

Tyr Trp Lys Ala Thr Gly Ala Asp Lys Pro Val Ala Pro Arg Gly Arg

100 105 110

Thr Leu Gly Ile Lys Lys Ala Leu Val Phe Tyr Ala Gly Lys Ala Pro

115 120 125

Arg Gly Val Lys Thr Asp Trp Ile Met His Glu Tyr Arg Leu Ala Asp

130 135 140

Ala Gly Arg Ala Ala Ala Ala Lys Lys Gly Ser Leu Arg Leu Asp Asp

145 150 155 160

Trp Val Leu Cys Arg Leu Tyr Asn Lys Lys Asn Glu Trp Glu Lys Met

165 170 175

Gln Met Gly Lys Gly Ser Ala Leu Ala Ala Ala Thr Thr Thr Lys Glu

180 185 190

Glu Ala Met Asp Met Thr Thr Ser His Ser His Ser Gln Ser His Ser

195 200 205

His Ser Trp Gly Glu Thr Arg Thr Pro Glu Ser Glu Ile Val Asp Asn

210 215 220

Asp Pro Phe Pro Glu Leu Asp Asp Ser Phe Pro Ala Phe Gln Asp Pro

225 230 235 240

Ala Ala Ala Met Met Val Pro Lys Lys Glu Pro Gln Val Asp Asp Gly

245 250 255

Gly AsnLeu Ala Ala Lys Asn Ser Asp Leu Phe Val Asp Leu Ser Tyr

260 265 270

Asp Asp Ile Gln Ser Met Tyr Ser Gly Leu Asp Met Leu Pro Pro Pro

275 280 285

Gly Glu Asp Phe Tyr Ser Ser Leu Phe Ala Ser Pro Arg Val Lys Gly

290 295 300

Asn His Thr Thr Gly Gly Ala Gly Leu Ala Pro Phe

305 310 315

Claims

Use of SiNAC67 protein or a related biomaterial thereof in (a1) and/or (a2) as follows:

(a1) regulating and controlling plant yield-related traits;

(a2) regulating and controlling the stress resistance of the plants;

the related biological material is a nucleic acid molecule capable of expressing the SiNAC67 protein or an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule;

the SiNAC67 protein is any one of the following proteins:

(A1) protein with an amino acid sequence of SEQ ID No. 4;

(A2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.4 and has the same function;

(A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (A1) to (A2) and having the same function;

(A4) a fusion protein obtained by attaching a protein tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).
2. The use of claim 1, wherein:

said plant yield-related traits comprise ear number, ear length, grain per ear number and/or biomass;

the plant stress resistance is the resistance of a plant to low nitrogen stress.
The application of the SiNAC67 protein or related biological materials thereof in plant breeding;

the related biological material is a nucleic acid molecule capable of expressing the SiNAC67 protein or an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule;

the SiNAC67 protein is any one of the following proteins:

(A1) protein with an amino acid sequence of SEQ ID No. 4;

(A2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.4 and has the same function;

(A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (A1) to (A2) and having the same function;

(A4) a fusion protein obtained by attaching a protein tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).
4. Use according to claim 3, characterized in that: the breeding aims to breed plants with high yield and/or high stress resistance.
5. A method for improving plant yield and/or plant stress tolerance, comprising the step of increasing expression level and/or activity of SiNAC67 protein in a recipient plant.
6. A method of breeding a transgenic plant comprising the steps of: introducing a nucleic acid molecule capable of expressing SiNAC67 protein into a receptor plant to obtain a transgenic plant with the increased expression level of the SiNAC67 protein; the transgenic plants have increased yield and/or stress resistance as compared to the recipient plant.
7. The method of claim 6, wherein: the 'introduction of a nucleic acid molecule capable of expressing the SiNAC67 protein' into a recipient plant is carried out by introducing an expression cassette containing a gene encoding the SiNAC67 protein into the recipient plant.
8. The method of claim 7, wherein:

the coding gene of the SiNAC67 protein is a DNA molecule as follows:

(B1) DNA molecule shown in SEQ ID No. 1;

(B2) DNA molecule shown in SEQ ID No. 2;

(B3) a DNA molecule shown as SEQ ID No. 3;

(B4) a DNA molecule which hybridizes with the DNA molecule defined in (B1) or (B2) or (B3) under stringent conditions and encodes the SiNAC67 protein;

(B3) a DNA molecule which has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% of identity with the DNA sequence defined in (B1) or (B2) or (B3) and encodes the SiNAC67 protein.
9. The method of any of claims 5-8, wherein: the stress resistance is the resistance of a plant to low nitrogen stress.
10. Use or method according to any of claims 1-9, wherein: the plant is a dicotyledonous plant or a monocotyledonous plant;

further, the monocotyledon is a gramineous plant;

further, the gramineous plant is rice or millet.