CN111363008A

CN111363008A - Fallopian tube cancer target antigen combination, CTL cell cultured by fallopian tube cancer target antigen combination stimulation and application of CTL cell

Info

Publication number: CN111363008A
Application number: CN202010190785.9A
Authority: CN
Inventors: 焦顺昌; 张嵘; 王海燕
Original assignee: Beijing Dingcheng Taiyuan Biotechnology Co ltd
Current assignee: Beijing Dingcheng Taiyuan Biotechnology Co ltd
Priority date: 2020-03-18
Filing date: 2020-03-18
Publication date: 2020-07-03
Anticipated expiration: 2040-03-18
Also published as: CN113461797B; CN114315964A; CN114315964B; CN113429473A; CN113388023A; CN114249806B; CN113461798A; CN113461797A; CN113461799A; CN111363008B; CN113388022A; CN113429473B; CN113388024A; CN114249806A

Abstract

The invention provides a salpingemphraxis cancer target antigen combination, CTL cells cultured by stimulating salpingemphraxis cancer target antigens and application thereof, belonging to the technical field of tumor treatment. The salpingemphraxis target antigen combination comprises one or more antigens with amino acid sequences shown as SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.16, SEQ ID No.23, SEQ ID No.31 and SEQ ID No. 45; the salpingemphraxis target antigen is an effective tumor antigen obtained by prediction analysis and screening based on the detection result of the whole exon of the tumor tissue of a patient, and CTL cells obtained by culturing the salpingemphraxis target antigen have a specific killing effect on tumors; the fallopian tube cancer target antigen provided by the invention can be applied to the treatment of fallopian tube cancer.

Description

Fallopian tube cancer target antigen combination, CTL cell cultured by fallopian tube cancer target antigen combination stimulation and application of CTL cell

Technical Field

The invention belongs to the technical field of tumor treatment, and particularly relates to a salpingemphraxis target antigen combination, CTL cells cultured by stimulating the salpingemphraxis target antigen combination and application thereof.

Background

Primary fallopian tube cancer is a rare malignancy of the female reproductive tract. The incidence rate of the gynecological malignant tumor accounts for 0.5 percent. It is common in women after menopause, in the age of 40-65 years. The current therapeutic principle for fallopian tube cancer is the comprehensive treatment of operation as the main and auxiliary radiotherapy and chemotherapy.

With the popularization of precise treatment, the individuation and the variability of tumors cannot be met by conventional chemotherapy, radiotherapy and targeting, so that the search for the individualized tumor neoantigen and the culture and identification of CTL (cytotoxic T lymphocyte) of the individualized tumor neoantigen are effective methods for thoroughly eliminating the tumors.

Disclosure of Invention

In view of the above, the present invention aims to provide a target antigen combination for salpingemphraxis, CTL cells cultured by stimulating the target antigen combination for salpingemphraxis, and applications thereof; the salpingemphraxis target antigen combination provided by the invention is an effective tumor antigen obtained by prediction analysis and screening based on the detection result of the whole exon of the tumor tissue of a patient, and CTL cells obtained by culturing the salpingemphraxis target antigen combination have a specific killing effect on tumors; the specific target antigen of the fallopian tube cancer provided by the invention aims at the fallopian tube cancer of the same HLA type, and the personalized treatment is realized.

The invention provides a salpingemphraxis target antigen combination which comprises one or more antigens with amino acid sequences shown as SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.16, SEQ ID No.23, SEQ ID No.31 and SEQ ID No. 45.

The invention provides application of the salpingemphraxis target antigen combination in preparing a medicament for treating salpingemphraxis.

The invention provides application of the salpingemphraxis target antigen combination in preparing CTL cells for treating salpingemphraxis.

The invention provides a CTL cell, which is cultured by stimulating the combination of the target antigens of the fallopian tube cancer.

The invention provides a preparation method of the CTL cell, which comprises the following steps:

1) adjusting the concentration of CTL cells to 2-3 × 10⁵cells/mL；

2) Mixing the CTL cell after adjusting the cell concentration, IL-2 and the salpingemphraxis target antigen combination to obtain a culture system;

3) and culturing the culture system to obtain the CTL cells cultured by the oviduct cancer target antigen combination stimulation.

Preferably, the final concentration of the IL-2 in the culture system is 150-250U/mL.

Preferably, the final concentration of each of the salpingcarcinoma target antigens in the salpingcarcinoma target antigen combination in a culture system is 40-60 ng/mL.

Preferably, the temperature of the culture in the step 3) is 36-38 ℃, and the time of the culture is 22-26 h.

Preferably, the CTL cells described in step 1) are obtained by co-culturing PBMC cells and APC cells.

The invention provides application of the CTL cell in preparation of a medicament for treating salpingemphraxis.

The invention has the beneficial effects that: the salpingemphraxis target antigen combination provided by the invention is based on the sequencing result of the whole exon of the tumor tissue of a patient, the effective tumor antigen is obtained through prediction analysis and screening, and CTL cells obtained by stimulating and culturing the salpingemphraxis target antigen combination have specific killing effect on tumors; after culturing the CTL cells, the cell phenotype was analyzed by flow analysis, and the result showed NKT (CD 56)⁺CD3⁺) The ratio was 29.31%, CD8⁺The proportion of T cells was 50.93%.

Drawings

FIG. 1 shows the results of screening fallopian tube cancer target antigens No. 1-26;

FIG. 2 shows the results of 27-50 screening for salpingemphraxis target antigen

FIG. 3 is a graph showing the comparison of the killing efficiency of CTL cultured with combinations of salpingcarcinoma target antigens No.9 and No.16 against antigen polypeptide-loaded target cells and HLA-only target cells;

FIG. 4 is a graph showing the comparison of the killing efficiency of CTL cultured with salpingcarcinoma target antigen combination Nos. 31 and 45 against antigen polypeptide-loaded target cells and HLA-only target cells;

FIG. 5 is a graph showing the comparison of the killing efficiency of CTL stimulated and cultured in the combinations of salpingcarcinoma target antigens No.7, No.8 and No.23 against target cells loaded with antigen polypeptides and target cells loaded with HLA alone;

FIG. 6 shows the results of CTL flow analysis of cell phenotype cultured by the combined stimulation of salpingcarcinoma target antigens.

Detailed Description

The invention provides a salpingemphraxis target antigen combination, which comprises one or more antigens with amino acid sequences shown as SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.16, SEQ ID No.23, SEQ ID No.31 and SEQ ID No. 45; the details are as follows:

polypeptide numbering		HLAAllele	MTEpitopeSeq
				7	NDUFS1	HLA-B*15:01	RLSVAGNCRMY(SEQIDNo.7)
8	C17orf97	HLA-B*15:01	RYQCLALKGF(SEQIDNo.8)
				9	RAP2C	HLA-A*26:01	YHKEIEVD(SEQIDNo.9)
16	PARP10	HLA-A*26:01	TVYGTGVYF(SEQIDNo.16)
				23	C17orf97	HLA-B*15:01	QCLALKGF(SEQIDNo.23)
31	GPNMB	HLA-A*02:01	VDVEEMCLLTV(SEQIDNo.31)
				45	TRGC2	HLA-A*02:01	LLGRTAFC(SEQIDNo.45)

In the invention, the salpingempfering target antigen combination is preferably an effective tumor antigen obtained by sequencing all exons of tumor tissues of patients, analyzing sequencing results and screening. The exon sequencing method is not particularly limited in the invention, and a conventional exon sequencing method in the field can be adopted. According to the invention, after the exon sequencing result is obtained, the exon sequencing result is preferably analyzed by adopting a tumor neoantigen analysis technology, in the invention, the analysis is preferably carried out by adopting Immunoming tumor individualized neoantigen analysis prediction software, and the copyright of the software has the registration number of 2019SR 0130720.

The invention provides application of the salpingemphraxis target antigen combination in preparing a medicament for treating salpingemphraxis. In the invention, the salpingemphraxis target antigen combination realizes the treatment of salpingemphraxis by stimulating and culturing CTL cells.

The invention also provides application of the salpingemphraxis target antigen combination in preparing CTL cells for treating salpingemphraxis. In the invention, CTL cells are stimulated and cultured by using the salpingcarcinoma target antigen combination, so that the obtained CTL cells have specific killing effect on the cells loaded with the salpingcarcinoma target antigen combination.

The invention also provides a preparation method of the CTL cell, which comprises the following steps of 1) adjusting the concentration of the CTL cell to 2-3 × 10⁵cells/mL; 2) mixing the CTL cell after adjusting the cell concentration, IL-2 and the salpingemphraxis target antigen combination to obtain a culture system; 3) and culturing the culture system to obtain the CTL cells cultured by the oviduct cancer target antigen combination stimulation.

In the invention, the culture step of the APC cells is preferably that after the recovery culture of the PBMC cells, the PBMC cells are subjected to resuscitative culture by using a fallopian tube cancer target antigen solution, and then the cells are subjected to resuspensive culture, the culture medium of the resuscitative culture is preferably 1640+ 10% (v/v) FBS, the time of the resuscitative culture is preferably 22-26 h, more preferably 24h, the temperature of the resuscitative culture is preferably 37 ℃, the environmental carbon dioxide concentration of the resuscitative culture is preferably 5%, and the concentration of the PBMC cells before the resuscitative culture is preferably 1 × 10⁶cells/mL; the concentration of PBMC cells before the resuscitation culture is preferably adjusted by dilution with resuscitation medium. According to the invention, after the recovery culture, cells are preferably collected by centrifugation, the rotation speed of the centrifugation is preferably 1400-1600 rpm, more preferably 1500rpm, and the time of the centrifugation is preferably 4-6 min, more preferably 5 min.

In the present invention, the salpingcarcinoma target antigen solution preferably comprises the following components: 1640+ 10% FBS + 150-250U/mL IL-2+ 1500-1700U/mL GM-CSF + 40-60 ng/mL salpingcarcinoma target antigen (concentration of each salpingcarcinoma target antigen), more preferably 1640+ 10% FBS +200U/mL IL-2+1600U/mL GM-CSF +50ng/mL salpingcarcinoma target antigen. In the invention, the IL-2 is a cell growth factor, which can enable T cells to survive for a long time and stimulate the T cells to enter a human cell division cycle; the GM-CSF stimulates the colony formation of neutrophils and macrophages in vitro; the source of the IL-2 and GM-CSF in the present invention is not particularly limited, and IL-2 and GM-CSF conventionally used in the art may be used.

In the present invention, the cells collected by centrifugation are resuspended in the salpingcarcinoma target antigen solution, and the cell density after resuspension is preferably 1 × 10⁶cells/mL, wherein the time for heavy suspension culture is preferably 22-26 h, and more preferably 24 h; the temperature of the resuspension culture is preferably 37 ℃, and the ambient carbon dioxide concentration of the resuscitation culture is preferably 5%. The present invention obtains APC cells after the resuspension culture.

In the present invention, CTL cells are obtained by co-culturing the APC cells and PBMC cells obtained by the above-mentioned culture. In the invention, the number ratio of the APC cells to the PBMC cells is preferably 1 (90-110), and more preferably 1: 100. In the present invention, the co-cultivation time is preferably 20 to 22 days, and more preferably 21 days. In the invention, after the co-culture is carried out for 48 hours, the IL-2 is added into the co-culture system every day, so that the final concentration of the IL-2 is 400-600U/mL, and more preferably 500U/mL.

In the invention, after the CTL cells are obtained, the concentration of the CTL cells is adjusted to 2-3 × 10⁵cells/mL, more preferably 2.5 × 10⁵cells/mL。

In the present invention, a culture system is obtained by mixing the CTL cells after adjusting the cell concentration, IL-2 and the target antigen of salpingemphraxis. In the invention, the final concentration of the IL-2 in the culture system is preferably 150-250U/mL, and more preferably 200U/mL; the final concentration of each salpingemphraxis target antigen in the salpingemphraxis target antigen combination in a culture system is preferably 40-60 ng/mL, and more preferably 50 ng/mL.

In the invention, the culture system is cultured to obtain the CTL cells cultured by stimulating the fallopian tube cancer target antigen combination. In the invention, the temperature of the culture is preferably 36-38 ℃, more preferably 37 ℃, and the time of the culture is preferably 22-26 h, more preferably 24 h. After the culturing, the cultured CTL cells stimulated by the fallopian tube cancer target antigen combination are preferably collected; the collection is preferably performed by a centrifugation method, the rotation speed of the centrifugation is preferably 1000-1500 rpm, and the time of the centrifugation is preferably 5-10 min.

The invention provides application of the CTL cell in preparation of a medicament for treating salpingemphraxis. In the invention, the CTL cell can kill tumor cells specifically, and the killing power of the tumor cells loaded with the salpingcarcinoma target antigen combination is far greater than that of the tumor cells not loaded with the salpingcarcinoma target antigen. The dosage form of the medicament is not particularly limited, and the cell medicament dosage form which is conventional in the field can be adopted.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

The sequencing result of the whole exon of the tumor tissue adopts Immunoming tumor individualized new antigen analysis prediction software to analyze the tumor new antigen, and the copyright of the software has the registration number of 2019SR 0130720. Obtaining 50 prediction antigens by ancient cooking vessel peptide source biological information technology limited company; the predicted 50 antigens were synthesized (synthesized by Nanjing Kinsley polypeptide Synthesis part).

TABLE 1 polypeptide sequences and corresponding numbering

1. Co-culture for APC preparation:

1) the PBMC are thawed and frozen (2.5 × 10)⁷cells), dilute the frozen stock solution with 1640+ 10% FBS, centrifuge at 1500rpm for 5min, resuspend in 10mL 1640+ 10% FBS, 1 × 10⁶cells/mL，37℃、 5％CO₂Resuscitating and culturing for 24 h;

2) respectively preparing antigen polypeptide solutions, namely 1640+ 10% FBS +200U/mL IL-2+1600U/mL GM-CSF, wherein the final concentration of each antigen polypeptide is 50ng/mL, and uniformly mixing for later use;

3) centrifuging at 1500rpm for 5min, collecting cells, resuspending the cells with polypeptide solution, and adjusting the density to 1 × 10⁶cells/mL；

4)37℃、5％CO₂After 24h of culture, the cells are APC, and the cells are lightly blown and uniformly mixed for later use.

2. Co-cultivation

1) PBMC were collected by centrifugation, resuspended in 1640+ 10% FBS, and count adjusted to 1 × 10⁶cells/mL；

2) According to PBMC: adding APC in the proportion of 100:1, mixing uniformly, and marking as Day 0;

3)37℃、5％CO₂after culturing for 48h, supplementing IL-2 according to the total volume every day, and ensuring that the final concentration of IL-2 is 200U/mL;

4) when the cells are cultured to Day 21, collecting the cells to be CTL;

3. screening of tumor neoantigens:

1) CTL cells obtained by the above culture were collected, resuspended in 1640+ 10% FBS, and the count was adjusted to 2 × 10⁶cells/mL；

2)10mL CTL cells +10mL 1640+ 10% FBS cells adjusted to 1 × 10⁶cells/mL, then adding 8 μ L of 500U/μ L IL-2, the final concentration of IL-2 is 200U/mL, and then dividing into 96-well plates (flat bottom) with 200 μ L/well;

5) adding different antigens, namely the No. 1-50 antigens, into each hole, wherein the volume is 5 mu L, and the concentration is 2 mu g/mL of polypeptide; setting positive control OKT 3167 ng/mL, medium control and CTL;

6)37℃5％CO₂after 24h of culture, centrifugation is carried out at 1500rpm for 10min, and 170 mu L of supernatant is transferred to a new 96-well plate;

7) in order to avoid sucking cells, the new 96-well plate in the step 6) is centrifuged at 1500rpm for 10min, and 110 μ L of supernatant is transferred to the new 96-well plate;

8) and (3) detecting the release amount of IFN-gamma in the cell supernatant by using an R & D ELISA kit so as to screen the antigen.

As shown in FIGS. 1 and 2, the released water level of IFN-. gamma.exceeds that of the control, and the antigen is considered to be a new effective antigen, i.e., a new effective antigen, wherein the polypeptides No.7, No.8, No.9, No.16, No.23, No.31 and No.45 are new effective antigens specific to fallopian tube cancer obtained by screening.

4. Construction of target cells

1) The synthesis of HLA-A2601 gene, HLA-A0201 gene and HLA-B1501 gene (trusted Jinweizhi Biotechnology Co., Ltd.) was carried out by artificial synthesis method, and the synthesized HLA-A2601 gene, HLA-A0201 gene and HLA-B1501 gene were constructed between Nhe I and BamHI enzyme cleavage sites on pCDH expression vector.

HLA-A2601(SEQ ID No.51)：

atggccgtcatggcgccccgaaccctcgtcctgctactctcgggggccctggccctgacccagacctgggc gggctcccactccatgaggtatttctacacctccgtgtcccggcccggccgcggggagccccgcttcatcgccgtg ggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagccagaggatggagccgcgggcgc cgtggatagagcaggaggggccggagtattgggaccggaacacacggaatgtgaaggcccactcacagactgaccgagcgaacctggggaccctgcgcggctactacaaccagagcgaggacggttctcacaccatccagaggatgt atggctgcgacgtggggccggacgggcgcttcctccgcgggtaccagcaggacgcttacgacggcaaggattac atcgccctgaacgaggacctgcgctcttggaccgcggcggacatggcggctcagatcacccagcgcaagtggga gacggcccatgaggcggagcagtggagagcctacctggagggccggtgcgtggagtggctccgcagatacctg gagaacgggaaggagacgctgcagcgcacggacgcccccaagacgcatatgactcaccacgctgtctctgacca tgaggccaccctgaggtgctgggccctgagcttctaccctgcggagatcacactgacctggcagcgggatgggga ggaccagacccaggacacggagctcgtggagaccaggcctgcaggggatgggaccttccagaagtgggcgtct gtggtggtgccttctggacaggagcagagatacacctgccatgtgcagcatgagggtctgcccaagcccctcaccc tgagatgggagccgtcttcccagcccaccatccccatcgtgggcatcattgctggcctggttctctttggagctgtgat cgctggagctgtggtcgctgctgtgatgtggaggaggaagagctcagatagaaaaggagggagctactctcaggc tgcaagcagtgacagtgcccagggctctgatatgtctctcacagcttgtaaagtgtga

HLA-A0201(SEQ ID No.52)：

atggccgtcatggcgccccgaaccctcgtcctgctactctcgggggctctggccctgacccagacctgggc gggctctcactccatgaggtatttcttcacatccgtgtcccggcccggccgcggggagccccgcttcatcgcagtgg gctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagccagaggatggagccgcgggcgcc gtggatagagcaggagggtccggagtattgggacggggagacacggaaagtgaaggcccactcacagactcaccgagtggacctggggaccctgcgcggctactacaaccagagcgaggccggttctcacaccgtccagaggatgtatggctgcgacgtggggtcggactggcgcttcctccgcgggtaccaccagtacgcctacgacggcaaggattacatcgccctgaaagaggacctgcgctcttggaccgcggcggacatggcagctcagaccaccaagcacaagtgggagg cggcccatgtggcggagcagttgagagcctacctggagggcacgtgcgtggagtggctccgcagatacctggag aacgggaaggagacgctgcagcgcacggacgcccccaaaacgcatatgactcaccacgctgtctctgaccatga agccaccctgaggtgctgggccctgagcttctaccctgcggagatcacactgacctggcagcgggatggggagg accagacccaggacacggagctcgtggagaccaggcctgcaggggatggaaccttccagaagtgggcggctgt ggtggtgccttctggacaggagcagagatacacctgccatgtgcagcatgagggtttgcccaagcccctcaccctg agatgggagccgtcttcccagcccaccatccccatcgtgggcatcattgctggcctggttctctttggagctgtgatca ctggagctgtggtcgctgctgtgatgtggaggaggaagagctcagatagaaaaggagggagctactctcaggctg caagcagtgacagtgcccagggctctgatgtgtctctcacagcttgtaaagtgtga

HLA-B1501(SEQ ID No.53)：

atgcgggtcacggcgccccgaaccgtcctcctgctgctctcgggagccctggccctgaccgagacctggg ccggctcccactccatgaggtatttctacaccgccatgtcccggcccggccgcggggagccccgcttcatcgcagt gggctacgtggacgacacccagttcgtgaggttcgacagcgacgccgcgagtccgaggatggcgccccgggcgccatggatagagcaggaggggccggagtattgggaccgggagacacagatctccaagaccaacacacagactta ccgagagagcctgcggaacctgcgcggctactacaaccagagcgaggccgggtctcacaccctccagaggatgt acggctgcgacgtggggccggacgggcgcctcctccgcgggcatgaccagtccgcctacgacggcaaggatta catcgccctgaacgaggacctgagctcctggaccgcggcggacacggcggctcagatcacccagcgcaagtgg gaggcggcccgtgaggcggagcagtggagagcctacctggagggcctgtgcgtggagtggctccgcagatacc tggagaacgggaaggagacgctgcagcgcgcggaccccccaaagacacatgtgacccaccaccccatctctga ccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcgggatgg cgaggaccaaactcaggacaccgagcttgtggagaccagaccagcaggagatagaaccttccagaagtgggca gctgtggtggtgccttctggagaagagcagagatacacatgccatgtacagcatgaggggctgccgaagcccctc accctgagatgggagccatcttcccagtccaccatccccatcgtgggcattgttgctggcctggctgtcctagcagtt gtggtcatcggagctgtggtcgctactgtgatgtgtaggaggaagagctcaggtggaaaaggagggagctactctc aggctgcgtccagcgacagtgcccagggctctgatgtgtctctcacagcttga

Transforming the obtained recombinant plasmid into competent cells, selecting a monoclonal antibody for sequencing, selecting the clone with the correct sequencing result, and carrying out subsequent experiments;

2) the plasmid extraction was carried out with Tiangen plasmid extraction kit (purchased from Tiangen Biochemical technology, Beijing) Ltd.) according to the manufacturer's instructions.

3) Slow virus package, recovering 293T cell, transferring two generations and using for slow virus package, cell transfection (T175 culture bottle) cell density is 2 × 10⁷One/bottle; a15 mL centrifuge tube (labeled A) was taken, and packaged plasmids 4K (17. mu.g), 6K (34. mu.g) and the desired plasmid (51. mu.g) were added to a Buffer containing 1mL jetPRIME, and gently mixed. Slowly dripping jetPRIME (marked as B) into the centrifuge tube A, adding while shaking the centrifuge tube A at a constant speed to obtain solution C, and standing for 10 min; old medium was decanted from T175, 18mL DMEM (without antibiotics and serum) was added to C, added to a T175 flask, and placed at 37 ℃ in 5% CO₂Culturing in an incubator. After 4-6 h of transfection, the medium containing the transfection complex was aspirated off and replaced with fresh medium preheated at 37 ℃. Cultured for 48h and 72h and collected.

4) Lentiviral transfection of 3T3 cells Whole cell culture Medium containing 7% FBS was prepared using DMEM, noted DMEM, 3T3 cell concentration was adjusted to 5 × 10 using DMEM⁵Perml, add 6 well plates, 1mL per well, incubate at 37 ℃ overnight. DMEM medium in 6-well plates was discarded, and 1ml of virus-V-P mixture was added to each well. Cultivation methodCulturing for 3 days, transferring into a T75 culture bottle, and adding puromycin for screening; after screening for 6 days, 3T3 cells stably expressing HLA-A2601, HLA-A0201 and HLA-B1501 were obtained and labeled as 3T 3-HLA;

5. killing experiment-LDH method

1) Collecting target cells 3T3 and 3T3-HLA, and centrifuging at 1000rpm for 5 min;

2) washing with PBS, and centrifuging at 1000rpm for 5 min;

3) adding antigen solution, and adding 9 th and 16 th antigens into one group; numbers 31 and 45 are a group, numbers 7, 8 and 23 are a group, the concentration of each antigen in each group is 50ng/mL, the volume is 3mL, the loading of effective new antigen combination is carried out, and the loading is carried out for 4h at 37 ℃;

4) centrifuging at 1000rpm for 5min, removing excess solution, and washing with PBS for 2 times;

5) after resuspension in 1640+ 2% FBS, the count was adjusted to 8 × 10⁴cells/mL, divided into 96-well plates (U-shaped bottom), 50 μ L/well for use;

6) collecting CTL cells, and centrifuging at 1000rpm for 5 min;

7) washing with PBS, and centrifuging at 1000rpm for 5 min;

8) after counting the resuspended cells in 1640+ 2% FBS, they were dispensed into 96-well plates (U-bottom), 50 μ L/well, and the effective target ratio (CTL: 3T3-HLA or CTL: 3T 3-HLA-loaded antigen combination) is 40:1, 20:1, 10:1, 5:1, 2.5:1 and 1.25: 1; 5% CO at 37 ℃₂After the incubation for 20h, performing LDH detection, wherein a kit for LDH detection is cytoxicity LDHAssay

The manufacturer: dojindo has a product number CK 12.

As shown in FIGS. 3, 4 and 5, the antigen-stimulated cultured CTLs showed higher killing efficiency against target cells loaded with the antigen polypeptide than target cells loaded with HLA alone, indicating that the cultured CTLs recognize the antigen and have specific killing effect, and thus can be used as the antigen of choice for the treatment of fallopian tube cancer.

6. Flow-type typing

1) Collecting CTL, centrifuging at 1000rpm for 5 min;

2)1×10⁶cells/tube, adding CD3, CD4, CD8 and CD56 antibody, and keeping away from light for 30 min at room temperature;

3) washing twice with PBS, and centrifuging at 1000rpm for 5 min;

4) and (5) resuspending by PBS and detecting on a machine.

The screened potent neoantigens were cultured and analyzed for cell phenotype by flow cytometry, and the results are shown in FIG. 6, NKT (CD 56)⁺CD3⁺) The ratio was 29.31%, 50.93% was CD8⁺A T cell; NK can generate nonspecific killing, the low NK proportion indicates that the nonspecific killing is small, and the specific killing effect is obvious.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Beijing ancient cooking peptide source Biotechnology Ltd

<120> fallopian tube cancer target antigen combination, CTL cell cultured by fallopian tube cancer target antigen combination stimulation and application thereof

<160>53

<170>SIPOSequenceListing 1.0

<210>1

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Ala Leu Ala Arg Ala Val Ser Ala Val

1 5

<210>2

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Glu Lys Ser Glu Ala Gly Leu Ala Gly Ala Leu

1 5 10

<210>3

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Gly Leu Ala Gly Ala Leu Ala Arg Ala Val

1 5 10

<210>4

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Gly Ala Leu Ala Arg Ala Val Ser Ala Val

1 5 10

<210>5

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Leu Ala Arg Ala Val Ser Ala Val Lys Asn Met

1 5 10

<210>6

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Ser Val Ala Gly Asn Cys Arg Met Tyr

1 5

<210>7

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Arg Leu Ser Val Ala Gly Asn Cys Arg Met Tyr

1 5 10

<210>8

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

Arg Tyr Gln Cys Leu Ala Leu Lys Gly Phe

1 5 10

<210>9

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Tyr His Lys Glu Ile Glu Val Asp

1 5

<210>10

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Asn Leu His Asp Tyr Gly Val Arg Glu Leu

1 510

<210>11

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Leu Asp Asn Asn Asn Leu His Asp Tyr Gly Val

1 5 10

<210>12

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>12

Lys Asn Leu Tyr Phe Leu Leu Ile Gln Ile

1 5 10

<210>13

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>13

Thr Val Trp Gly Asn Met Leu Ile Val Val

1 5 10

<210>14

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>14

Val Thr Val Trp Gly Asn Met Leu Ile Val

1 5 10

<210>15

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>15

Asn Ala Thr Val Tyr Gly Thr Gly Val Tyr

1 5 10

<210>16

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>16

Thr Val Tyr Gly Thr Gly Val Tyr Phe

1 5

<210>17

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>17

Ile Arg Ser Pro Gln Thr His Ile Leu Leu Val

1 5 10

<210>18

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>18

Thr Ser Ile Arg Ser Pro Gln Thr His Ile Leu

1 5 10

<210>19

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>19

Gln Thr His Ile Leu Leu Val Gly Gly

1 5

<210>20

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>20

Asp Leu Phe Glu Gly Ser Asn Glu Gly Ser Leu

1 5 10

<210>21

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>21

Trp Glu Met Ser Ser Leu Phe Arg Glu Leu

1 5 10

<210>22

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>22

Tyr Ser Val Ile Arg Gly Glu Val

1 5

<210>23

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>23

Gln Cys Leu Ala Leu Lys Gly Phe

15

<210>24

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>24

Phe Ser Leu Pro Glu Glu Tyr Val

1 5

<210>25

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>25

His Arg Ile Pro Cys Arg Asp Met Ser Pro

1 5 10

<210>26

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>26

Asp Met Ser Pro Thr Leu Ile Arg Thr

1 5

<210>27

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>27

Trp Val Trp Val Thr Ser Thr Gly Arg

1 5

<210>28

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>28

Glu Ala Gly Leu Ala Gly Ala Leu

1 5

<210>29

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>29

Leu Ala Arg Ala Val Ser Ala Val Lys Asn Met

1 5 10

<210>30

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>30

Ser Glu Ala Gly Leu Ala Gly Ala Leu

1 5

<210>31

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>31

Val Asp Val Glu Glu Met Cys Leu Leu Thr Val

1 5 10

<210>32

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>32

Phe Val Asn MetTrp Ile Glu Arg Thr Ile Tyr

1 5 10

<210>33

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>33

Gly Thr Gly Pro Pro Gly Gly Ala Leu Tyr

1 5 10

<210>34

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>34

Ile Arg Ser Pro Gln Thr His Ile Leu

1 5

<210>35

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>35

Cys Gln Pro Ala Cys Cys Met Pro Val Ser

1 5 10

<210>36

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>36

Val Cys Gln Pro Ala Cys Cys Met Pro

1 5

<210>37

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>37

Leu Ser Val Ala Gly Asn Cys Arg Met Tyr

1 5 10

<210>38

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>38

Leu His Asp Tyr Gly Val Arg Glu Leu

1 5

<210>39

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>39

Thr Val Trp Gly Asn Met Leu Ile Val

1 5

<210>40

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>40

Ser Leu Ser Ser Gly Ser Ser Gly Ala

1 5

<210>41

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>41

Ala Arg Ala Pro Val Ala Ala Ile Ile

1 5

<210>42

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>42

Gly Gly Ser Ala Leu Phe Ser Glu Tyr

1 5

<210>43

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>43

Asp His Glu Glu Asn Val Ala Leu Glu

1 5

<210>44

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>44

Gln Asp His Glu Glu Asn Val Ala Leu Glu Ala

1 5 10

<210>45

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>45

Leu Leu Gly Arg Thr Ala Phe Cys

1 5

<210>46

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>46

Leu Val Trp Glu Met Ser Ser Leu Phe

1 5

<210>47

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>47

Trp Glu Met Ser Ser Leu Phe Arg Glu Leu

1 5 10

<210>48

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>48

Arg Thr Tyr Arg Tyr Phe Tyr Leu Phe Ile

1 5 10

<210>49

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>49

Thr Ser Thr Gln Ala Ser Pro Asp Gln Leu Leu

1 5 10

<210>50

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>50

Leu Tyr Thr Trp Glu Met Phe Gln Asp Pro Val

1 5 10

<210>51

<211>1098

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

atggccgtca tggcgccccg aaccctcgtc ctgctactct cgggggccct ggccctgacc 60

cagacctggg cgggctccca ctccatgagg tatttctaca cctccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccgtgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgacg ccgcgagcca gaggatggag ccgcgggcgc cgtggataga gcaggagggg 240

ccggagtatt gggaccggaa cacacggaat gtgaaggccc actcacagac tgaccgagcg 300

aacctgggga ccctgcgcgg ctactacaac cagagcgagg acggttctca caccatccag 360

aggatgtatg gctgcgacgt ggggccggac gggcgcttcc tccgcgggta ccagcaggac 420

gcttacgacg gcaaggatta catcgccctg aacgaggacc tgcgctcttg gaccgcggcg 480

gacatggcgg ctcagatcac ccagcgcaag tgggagacgg cccatgaggc ggagcagtgg 540

agagcctacc tggagggccg gtgcgtggag tggctccgca gatacctgga gaacgggaag 600

gagacgctgc agcgcacgga cgcccccaag acgcatatga ctcaccacgc tgtctctgac 660

catgaggcca ccctgaggtg ctgggccctg agcttctacc ctgcggagat cacactgacc 720

tggcagcggg atggggagga ccagacccag gacacggagc tcgtggagac caggcctgca 780

ggggatggga ccttccagaa gtgggcgtct gtggtggtgc cttctggaca ggagcagaga 840

tacacctgcc atgtgcagca tgagggtctg cccaagcccc tcaccctgag atgggagccg 900

tcttcccagc ccaccatccc catcgtgggc atcattgctg gcctggttct ctttggagct 960

gtgatcgctg gagctgtggt cgctgctgtg atgtggagga ggaagagctc agatagaaaa 1020

ggagggagct actctcaggc tgcaagcagt gacagtgccc agggctctga tatgtctctc 1080

acagcttgta aagtgtga 1098

<210>52

<211>1098

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

atggccgtca tggcgccccg aaccctcgtc ctgctactct cgggggctct ggccctgacc 60

cagacctggg cgggctctca ctccatgagg tatttcttca catccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgcagtgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgacg ccgcgagcca gaggatggag ccgcgggcgc cgtggataga gcaggagggt 240

ccggagtatt gggacgggga gacacggaaa gtgaaggccc actcacagac tcaccgagtg 300

gacctgggga ccctgcgcgg ctactacaac cagagcgagg ccggttctca caccgtccag 360

aggatgtatg gctgcgacgt ggggtcggac tggcgcttcc tccgcgggta ccaccagtac 420

gcctacgacg gcaaggatta catcgccctg aaagaggacc tgcgctcttg gaccgcggcg 480

gacatggcag ctcagaccac caagcacaag tgggaggcgg cccatgtggc ggagcagttg 540

agagcctacc tggagggcac gtgcgtggag tggctccgca gatacctgga gaacgggaag 600

gagacgctgc agcgcacgga cgcccccaaa acgcatatga ctcaccacgc tgtctctgac 660

catgaagcca ccctgaggtg ctgggccctg agcttctacc ctgcggagat cacactgacc 720

tggcagcggg atggggagga ccagacccag gacacggagc tcgtggagac caggcctgca 780

ggggatggaa ccttccagaa gtgggcggct gtggtggtgc cttctggaca ggagcagaga 840

tacacctgcc atgtgcagca tgagggtttg cccaagcccc tcaccctgag atgggagccg 900

tcttcccagc ccaccatccc catcgtgggc atcattgctg gcctggttct ctttggagct 960

gtgatcactg gagctgtggt cgctgctgtg atgtggagga ggaagagctc agatagaaaa 1020

ggagggagct actctcaggc tgcaagcagt gacagtgccc agggctctga tgtgtctctc 1080

acagcttgta aagtgtga 1098

<210>53

<211>1089

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

atgcgggtca cggcgccccg aaccgtcctc ctgctgctct cgggagccct ggccctgacc 60

gagacctggg ccggctccca ctccatgagg tatttctaca ccgccatgtc ccggcccggc 120

cgcggggagc cccgcttcat cgcagtgggc tacgtggacg acacccagtt cgtgaggttc 180

gacagcgacg ccgcgagtcc gaggatggcg ccccgggcgc catggataga gcaggagggg 240

ccggagtatt gggaccggga gacacagatc tccaagacca acacacagac ttaccgagag 300

agcctgcgga acctgcgcgg ctactacaac cagagcgagg ccgggtctca caccctccag 360

aggatgtacg gctgcgacgt ggggccggac gggcgcctcc tccgcgggca tgaccagtcc 420

gcctacgacg gcaaggatta catcgccctg aacgaggacc tgagctcctg gaccgcggcg 480

gacacggcgg ctcagatcac ccagcgcaag tgggaggcgg cccgtgaggc ggagcagtgg 540

agagcctacc tggagggcct gtgcgtggag tggctccgca gatacctgga gaacgggaag 600

gagacgctgc agcgcgcgga ccccccaaag acacatgtga cccaccaccc catctctgac 660

catgaggcca ccctgaggtg ctgggccctg ggcttctacc ctgcggagat cacactgacc 720

tggcagcggg atggcgagga ccaaactcag gacaccgagc ttgtggagac cagaccagca 780

ggagatagaa ccttccagaa gtgggcagct gtggtggtgc cttctggaga agagcagaga 840

tacacatgcc atgtacagca tgaggggctg ccgaagcccc tcaccctgag atgggagcca 900

tcttcccagt ccaccatccc catcgtgggc attgttgctg gcctggctgt cctagcagtt 960

gtggtcatcg gagctgtggt cgctactgtg atgtgtagga ggaagagctc aggtggaaaa 1020

ggagggagct actctcaggc tgcgtccagc gacagtgccc agggctctga tgtgtctctc 1080

acagcttga 1089

Claims

1. A salpingemphraxis target antigen combination is characterized by comprising one or more antigens of which the amino acid sequences are shown as SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.16, SEQ ID No.23, SEQ ID No.31 and SEQ ID No. 45.

2. Use of the fallopian tube cancer target antigen combination of claim 1 for the preparation of a medicament for the treatment of fallopian tube cancer.

3. Use of the salpingo carcinoma target antigen combination according to claim 1 for the preparation of CTL cells for the treatment of salpingo carcinoma.

4. A CTL cell, wherein said CTL cell is a CTL cell cultured by stimulation with the salpingcarcinoma target antigen combination according to claim 1.

5. The method for producing CTL cells according to claim 4, comprising the steps of:

1) adjusting the concentration of CTL cells to 2-3 × 10⁵cells/mL；

2) Mixing the CTL cells after adjusting the cell concentration, IL-2 and the salpingcarcinoma target antigen combination as set forth in claim 1 to obtain a culture system;

3) and culturing the culture system to obtain the CTL cells cultured by the target antigen stimulation of the fallopian tube cancer.

6. The method according to claim 5, wherein the final concentration of IL-2 in the culture system is 150 to 250U/mL.

7. The method of claim 5 or 6, wherein the final concentration of each of the fallopian tube cancer target antigen in the combination of fallopian tube cancer target antigens in the culture system is 40-60 ng/mL.

8. The method according to claim 5, wherein the temperature of the culture in step 3) is 36 to 38 ℃ and the time of the culture is 22 to 26 hours.

9. The method according to claim 5, wherein the CTL cells in step 1) are obtained by co-culturing the PBMC cells and the APC cells.

10. Use of the CTL cell according to claim 4 or the CTL cell obtained by the method according to any one of claims 5 to 9 for the preparation of a medicament for the treatment of fallopian tube cancer.