CN111358956B - Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule - Google Patents

Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule Download PDF

Info

Publication number
CN111358956B
CN111358956B CN202010219298.0A CN202010219298A CN111358956B CN 111358956 B CN111358956 B CN 111358956B CN 202010219298 A CN202010219298 A CN 202010219298A CN 111358956 B CN111358956 B CN 111358956B
Authority
CN
China
Prior art keywords
car
cell
nano
targeting
solid tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010219298.0A
Other languages
Chinese (zh)
Other versions
CN111358956A (en
Inventor
李茹恬
刘宝瑞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Drum Tower Hospital
Original Assignee
Nanjing Drum Tower Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Drum Tower Hospital filed Critical Nanjing Drum Tower Hospital
Priority to CN202010219298.0A priority Critical patent/CN111358956B/en
Publication of CN111358956A publication Critical patent/CN111358956A/en
Application granted granted Critical
Publication of CN111358956B publication Critical patent/CN111358956B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001111—Immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/593—Polyesters, e.g. PLGA or polylactide-co-glycolide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/141—Intimate drug-carrier mixtures characterised by the carrier, e.g. ordered mixtures, adsorbates, solid solutions, eutectica, co-dried, co-solubilised, co-kneaded, co-milled, co-ground products, co-precipitates, co-evaporates, co-extrudates, co-melts; Drug nanoparticles with adsorbed surface modifiers
    • A61K9/146—Intimate drug-carrier mixtures characterised by the carrier, e.g. ordered mixtures, adsorbates, solid solutions, eutectica, co-dried, co-solubilised, co-kneaded, co-milled, co-ground products, co-precipitates, co-evaporates, co-extrudates, co-melts; Drug nanoparticles with adsorbed surface modifiers with organic macromolecular compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention discloses a nanometer switch molecule and a solid tumor targeting CAR-T cell for controlling activation thereof, wherein the solid tumor targeting CAR-T cell is prepared by the following steps: 1) preparing a nano switch molecule: loading the switch molecule on the tumor targeting nanoparticles by a double emulsification-volatilization method; 2) construction of an assembled CAR-T plasmid: introducing a T2A element, an FRB, an FKBP sequence and an ScFv segment targeting a solid tumor into the CAR-T plasmid by using a gene recombination method; 3) preparation of assembled CAR-T cells: transfecting the assembled CAR-T plasmid into a T lymphocyte; 4) preparing solid tumor targeting CAR-T cells: an assembled CAR-T cell endocytosed nanoswitch molecule. According to the invention, the tumor-targeting nanoparticle is used for loading the switch molecule, so that the switch molecule can be specifically gathered in tumor tissues, and the switch molecule is connected with FKBP and FRAP of CAR-T, so that the two parts of CAR-T are combined to have attack activity, and the problem of CAR-T cell off-target effect can be fundamentally solved.

Description

Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule
Technical Field
The invention belongs to the technical field of tumor immunology, and particularly relates to a nano switch molecule and a solid tumor targeting CAR-T cell for controlling activation of the nano switch molecule.
Background
CAR-T therapy (Chimeric Antigen Receptor T-Cell Immunotherapy) has made a major breakthrough in leukemia therapy, bringing new hopes for patients with specific hematological tumors. However, CAR-T therapy is hampered when applied to solid tumors, the most critical reason being that the current targets of solid tumor CAR-T are expressed in small amounts in normal tissues, so CAR-T can non-specifically attack normal tissues to cause serious off-target effects, and there are related death cases.
The CAR-T cell is prepared by transfecting CAR gene plasmid into T lymphocyte to obtain CAR-T cell, and the transfection method comprises virus transfection and electroporation transfection. The virus transfection method is to infect cells with lentivirus or retrovirus to make them express corresponding genes; electroporation is the transfection of the CAR gene with a transposon or transposase system, where the transposon is a DNA sequence that can be cleaved and inserted by a transposase, the CAR gene sequence can be inserted onto the transposon of a plasmid that is electroporated into the T cell prior to T cell activation, after which the transposon containing the CAR is cleaved by the transposase and then inserted into the genome of the T cell. The use of the transposon system improves the efficiency of gene transfection compared to the electroporation mode, which approaches the efficiency of viral transfection.
The main ideas for controlling CAR-T off-target effects of solid tumors include: 1. search for new targets or design for multi-target activation of CAR-T cells: the ideal CAR-T target point should meet the requirements that firstly, the CAR-T target point is positioned on the surface of a tumor cell, is highly expressed on the surface of a specific tumor cell, and is not expressed in a normal tissue, but a specific surface antigen of a solid tumor completely meeting the requirements is not found at present; 2. the method for controlling the inactivation of CAR-T comprises the introduction of artificially synthesized death control switches such as herpes simplex virus thymidine kinase (HSV-tk), Fas intracellular domain (delta FAS), iCasp9 and the like, but the method cannot fundamentally solve the problem of non-specific activation of CAR-T, and the complicated CAR-T design causes difficulty in production preparation and large-scale clinical application.
The polymer nanoparticles are polymer particles with a particle size of 1-1000nm, and the constituent materials of the polymer particles are biocompatible polymer materials, and can form stable particles with a particle size of less than 1000nm in an aqueous solution and load small molecule drugs, such as liposomes (lipome), polylactic acid (poly (lactic acid), PLA), poly (lactic-co-glycolic acid), PLGA, Polycaprolactone (PCL), chitosan (chitosan), Cyclodextrin (Cyclodextrin), and the like, and composite polymers formed by modifying the above polymers with other polymers, such as Polyethylene glycol (PEG), monomethoxypolyethylene glycol (Methoxy Polyethylene glycol), and poly (N-isopropyl acrylamide).
The switch molecule is a heterodimeric small molecule ligand comprising gibberellin, rapamycin and derivatives thereof, which can link two different domains for dimerization to regulate biological processes, wherein the rapamycin derivative AP21967(a/C heteromodulus) has two binding surfaces: one binds to FKBP12 and the other binds to the Frb domain of mTor/FRAP. The tumor targeting nano-carrier (polymer nano-particle) can load switch molecules, the loading method comprises a nano-precipitation method, an emulsification method, an isoelectric point method, a drug loading method and the like, the tumor targeting nano-carrier comprises a gelatinase targeting nano-particle, a magnetic targeting nano-particle, a thermal targeting nano-particle and an environmental response targeting nano-particle, wherein the gelatinase targeting nano-particle is repeatedly verified by previous work to deliver the loaded drug to tumor tissues in a targeted manner.
The CAR-T of the invention consists of two parts, a first part consisting of a solid tumor antigen recognition segment (ScFv), a costimulatory region and FKBP, capable of recognizing a target antigen, wherein the different ScFv segments recognize solid tumor target antigens including but not limited to Her2, EGFR and CEA, and a second part consisting of FRAP, a costimulatory region and a key downstream signaling element ITAM, and is active if and only when structurally intact, i.e. not capable of tumor killing if the first part is not bound to the second part. It has been demonstrated in the literature that switching molecules can link the FKBP and FRAP of CAR-T, allowing the two parts of CAR-T to bind and be active for attack.
Based on the research, the T2A element is added into the sequence of the traditional CAR-T plasmid, so that the plasmid is expressed into two sections in T cells after transfection, FKBP and FRAP sections are respectively arranged at the head and the tail of the two sections, the switch molecule is loaded by the tumor targeting nanoparticles to form the nano switch molecule, the switch molecule can be specifically gathered in tumor tissues, the FKBP and FRAP sections are connected through the switch molecule, the assembled CAR-T cells are activated at the tumor part by fixed points, and the problem of CAR-T off-target effect is effectively solved.
Disclosure of Invention
Aiming at the defects of the prior art, the tumor targeting nanoparticle loads the switch molecule to form the nanometer switch molecule, and the switch molecule is connected with FKBP and FRAP, so that the assembled CAR-T cell is activated at a tumor site in a fixed point manner, and the directional attack on the solid tumor is realized.
In order to achieve the technical purpose, the technical scheme adopted by the invention is as follows:
the invention provides a preparation method of a nanometer switch molecule, which specifically comprises the following steps:
step one), dissolving hydrophobic switch molecules and tumor targeting nano-carriers in dichloromethane solution to form an organic phase and mixed solution A;
step two), adding the mixed solution A into a first external water phase containing 1% PVA, and fully mixing by adopting an ultrasonic emulsification technology to form a mixed solution B, wherein the mPEG-PEP-PCL two-block copolymer is self-assembled into polymer nanoparticles in the water phase, the hydrophilic end is outward, and the hydrophobic end is inward;
step three), adding the mixed solution B into a second external water phase containing 1% of polyvinyl alcohol, and fully mixing by adopting an ultrasonic emulsification technology to form a mixed solution C;
and step four), stirring and volatilizing the mixed solution C by magnetic force at normal temperature, and removing the organic solvent to obtain the tumor targeting nanoparticles of the load switch molecules.
Further, the switch molecule is gibberellin or rapamycin or a rapamycin derivative.
Further, the tumor targeting nano-carrier is a gelatinase targeting nano-particle, a magnetic targeting nano-particle, a thermal targeting nano-particle or an environmental response targeting nano-particle.
The invention also provides a nano switch molecule which is a tumor targeting nano particle of the load switch molecule and is prepared by the preparation method of the nano switch molecule.
The invention also provides a preparation method of the solid tumor targeting CAR-T cell, which comprises the following steps:
1) preparing a nano switch molecule: the preparation method of the nanometer switch molecule is adopted;
2) construction of an assembled CAR-T plasmid: introducing a T2A element, an FRB sequence, an FKBP sequence and an ScFv segment of a target solid tumor into a CAR-T plasmid by using a gene recombination technology to construct an assembled CAR-T plasmid, amplifying the assembled CAR-T plasmid by using escherichia coli DH5 alpha as a vector, and extracting the assembled CAR-T plasmid from escherichia coli DH5 alpha;
3) preparation of assembled CAR-T cells: transfecting the assembled CAR-T plasmid into T lymphocytes by adopting a lentivirus transfection method or an electroporation transfection method to prepare assembled CAR-T cells;
4) preparing solid tumor targeting CAR-T cells: and 3) successfully transfecting the assembled CAR-T cell culture solution to endocytose the nano switch molecule prepared in the step 1), and activating the assembled CAR-T cell at a fixed point through the switch molecule to obtain the solid tumor targeting CAR-T cell.
The invention also provides a solid tumor targeting CAR-T cell which is prepared by the preparation method of the solid tumor targeting CAR-T cell.
The invention also provides application of the nano switch molecule and the assembled CAR-T cell in preparing a solid tumor targeting drug, wherein the nano switch molecule is specifically gathered in tumor tissues, and the FKBP and FRAP segments are connected through the switch molecule, so that the assembled CAR-T cell is activated at a tumor site in a fixed point manner, and the specific attack on the tumor cells is realized.
Compared with the prior art, the invention has the beneficial effects that:
1) the invention breaks the bottleneck of the current solid tumor CAR-T therapy optimization strategy, is not limited to the optimization design of CAR-T cells, but develops a new way to enable the switch molecules for activating the CAR-T cells to have tumor specificity, specifically, tumor-targeted nanoparticles are used for loading the switch molecules, so that the switch molecules can be specifically gathered in tumor tissues, the switch molecules are connected with FKBP and FRAP of the CAR-T, the two parts of the CAR-T are combined to have attack activity, and the problem of CAR-T cell off-target effect can be fundamentally solved;
2) the switch molecule used in the invention has poor water solubility, and tumor targeting nanoparticle loading is used, so that adverse reactions related to a solvent can be avoided while the water solubility of the medicine is improved, and the half-life period of the medicine is prolonged;
3) the tumor targeting nanoparticles used in the invention belong to antitumor nano-drugs approved by FDA and suitable for clinical application, and are safe and reliable.
Drawings
FIG. 1 is a schematic structural diagram of an assembled CAR-T plasmid;
FIG. 2 is the flow test result of the assembled CAR-T plasmid transfected T cell of example 3, wherein, a is the positive rate result of the untransfected T cell, b is the positive rate result of the extracellular segment of the transfected T cell (47.7%), c is the positive rate result of the intracellular segment of the transfected T cell (44.2%), and d is the positive rate result of the simultaneous expression of the intracellular segment and the extracellular segment of the transfected T cell (12.0%);
FIG. 3 shows the flow detection and morphological observation results of the assembled CAR-T cells prepared in example 3, wherein a is the expression results (65.9%) of the intracellular and extracellular segments of the assembled CAR-T cells after flow sorting, and b is the morphological observation results of the assembled CAR-T cells observed under a microscope;
FIG. 4 is a graph showing the results of the effect of the concentration of the nanoswitch molecule on the assembled CAR-T cells attacking gastric cancer cells highly expressing HER2 or gastric cancer cells lowly expressing HER2, wherein the abscissa is the concentration of the nanoswitch molecule, the ordinate is the IFN- γ secretion level of the assembled CAR-T cells, the HER2+ group is the co-culture group of the assembled CAR-T cells and gastric cancer cells highly expressing HER2, and the HER 2-group is the co-culture group of the assembled CAR-T cells and gastric cancer cells lowly expressing HER 2;
FIG. 5 shows the results of flow cytometry on the expression level of CD69 on the surface of an assembled CAR-T cell, wherein a is the expression level of CD69 on the surface of the assembled CAR-T cell with a switch molecule prepared in example 3, and b is the expression level of CD69 on the surface of the assembled CAR-T cell without a switch molecule, wherein the abscissa is the fluorescence value emitted from a fluorescent antibody against CD69, and the ordinate is the number of cells, and the expression level of CD69 is reflected.
FIG. 6 shows the release of the switch molecule in different concentrations of gelatinase;
FIG. 7 is a fluorescent in vivo imaging of switch molecules in mice.
Detailed Description
In order to make the technical solutions of the present invention better understood by those skilled in the art, the present invention is further described below by using specific examples.
The experimental procedures used in the examples below are, unless otherwise specified, conventional procedures and the reagents, methods and equipment used are, unless otherwise specified, conventional in the art.
Example 1
The preparation of the gelatinase targeted nanoparticles comprises the following 4 steps:
step A) Synthesis of PCL-NH 2: using epsilon-CL (epsilon-caprolactone ) as a raw material, synthesizing PCL (polycaprolactone) containing carboxyl by adopting a free radical polymerization method, and marking as PCL-COOH, then using EDC to aminate the tail end of the PCL-COOH to form PCL with active amino, and marking as PCL-NH2, wherein the specific reaction is as follows:
Figure BDA0002425509850000051
step B) synthesis of mPEG-PEP: the mPEG-PEP is synthesized by adopting the reaction of activated mPEG-NHS and the amino terminal of polyethylene glycol monomethyl ether (mPEG), and the specific reaction is as follows:
Figure BDA0002425509850000052
step C) synthesis of enzyme targeting vector: under the condition that EDC, DMAP and NHS exist, carboxyl at the tail end of mPEG-PEP reacts with amino at the tail end of PCL-NH2 to form mPEG-PEP-PCL two-block copolymer, compared with the traditional two-block copolymer mPEG-PCL (mPEG direct ring-opening synthesis), a section of peptide chain sensitive to MMP2/9 is connected between mPEG and PCL to serve as a 'switch' for triggering the drug-carrying particle to change in shape;
step D) preparation of the carrier: mixing and dissolving mPEG-PEP-PCL two-block copolymer, ethanol and acetone in a volume ratio of 1:1:1 to form primary mixed liquid, dripping the primary mixed liquid into cold pure water to form secondary mixed liquid, wherein the volume of the cold pure water is 25 times of the volume of the mixed liquid, then carrying out reduced pressure suction filtration on the secondary mixed liquid to remove an organic solvent, wherein the mPEG-PEP-PCL two-block copolymer spontaneously forms a micelle structure in a water phase, and then carrying out freeze drying on the secondary mixed liquid from which the organic solvent is removed to prepare gelatinase targeted nanoparticles, and storing the gelatinase targeted nanoparticles at 4 ℃;
example 2
The preparation of the nanometer switch molecule, the nanometer switch molecule is the tumor targeting nanometer particle of the load switch molecule, use the double emulsification-volatilize method to construct, include the following steps specifically:
step one), dissolving hydrophobic switch molecules and tumor targeting nano-carriers in dichloromethane solution to form an organic phase and mixed solution A;
step two), adding the mixed solution A into a first external water phase containing 3% of polyvinyl alcohol, and fully mixing by adopting an ultrasonic emulsification technology to form a mixed solution B, wherein the mPEG-PEP-PCL diblock copolymer is self-assembled into polymer nanoparticles in the water phase, the hydrophilic end of the polymer nanoparticles faces outwards, and the hydrophobic end of the polymer nanoparticles faces inwards;
step three), adding the mixed solution B into a second external water phase containing 1% of polyvinyl alcohol, and fully mixing by adopting an ultrasonic emulsification technology to form a mixed solution C;
and step four), stirring and volatilizing the mixed solution C by magnetic force at normal temperature, and removing the organic solvent to obtain the tumor targeting nanoparticles of the load switch molecules.
Step five) characterization detection of the nanometer switch molecules: measuring the particle size of the nanometer switch molecule through dynamic light scattering; transmission electron microscope and scanning electron microscope characterize the form, drug loading rate, encapsulation rate, release property research in different media, and the like, and observe the drug release condition of the system in PBS and gelatinase with different concentrations to know the controlled release performance.
In the embodiment, the tumor targeting nanocarrier may be selected from the gelatinase targeting nanoparticles, the magnetic targeting nanoparticles, the thermal targeting nanoparticles or the environmental response targeting nanoparticles, and the gelatinase targeting nanoparticles prepared in example 1 are selected in this embodiment.
In an embodiment, the hydrophobic switch molecule may also be rapamycin or a rapamycin derivative directly available from the market.
Example 3
Preparation of solid tumor targeting CAR-T cells comprising the steps of:
1) preparing a nano switch molecule: the nanoswitching molecule prepared in example 2 was used;
2) construction and amplification of an assembled CAR-T plasmid: introducing a T2A gene (the sequence of the T2A gene is shown as SEQ ID No.), an FRB sequence (the sequence of the FRB is shown as SEQ ID No.2), an FKBP sequence (the sequence of the FKBP is shown as SEQ ID No.3) and an ScFv segment (the sequence of the ScFv segment is shown as SEQ ID No.4) of a target solid tumor into a CAR-T plasmid by using a gene recombination technology to construct an assembled CAR-T plasmid (pDonor-SB-HER2-4-1BB-FKBP-DPA10-FRB-EGFP plasmid, which is shown as a figure 1), and amplifying the assembled CAR-T plasmid by using Escherichia coli DH5 alpha as a vector;
wherein, the T2A gene sequence: 5'-CGGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCTA-3' (SEQ ID NO. 1);
FKBP sequence: 5'-GGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAA-3' (SEQ ID NO. 2);
FRB sequence: 5'-ATCCTCTGGCATGAGATGTGGCATGAAGGCCTGGAAGAGGCATCTCGTTTGTACTTTGGGGAAAGGAACGTGAAAGGCATGTTTGAGGTGCTGGAGCCCTTGCATGCTATGATGGAACGGGGCCCCCAGACTCTGAAGGAAACATCCTTTAATCAGGCCTATGGTCGAGATTTAATGGAGGCCCAAGAGTGGTGCAGGAAGTACATGAAATCAGGGAATGTCAAGGACCTCCTCCAAGCCTGGGACCTCTATTATCATGTGTTCCGACGAATCTCAAAG-3' (SEQ ID NO. 3);
ScFv sequence: 5'-GCTGATATCGTGATGACCCAGTCCCACAAGTTCATGTCCACCTCTGTGGGCGATAGGGTCAGCATCACCTGCAAGGCCAGTCAGGATGTGAATACTGCTGTAGCCTGGTATCAACAGAAACCAGGACATTCTCCGAAACTACTGATTTACTCGGCATCCTTCCGGTACACTGGAGTCCCTGATCGCTTCACTGGCAATAGATCTGGGACGGATTTCACTTTCACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTATTACTGTCAGCAACATTATACTACTCCTCCCACGTTCGGAGGGGGTACCAAGGTGGAGATCAAAGCGTACGCTCAGGTTCAGCTGCAGCAGTCTGGCCCTGAGCTGGTGAAGCCAGGGGCCTCACTCAAGTTGTCCTGTACAGCTTCTGGCTTCAACATTAAAGACACCTATATACACTGGGTGAAACAGAGGCCTGAACAGGGCCTGGAATGGATTGGAAGGATTTATCCTACGAATGGTTATACTAGATATGACCCGAAGTTCCAGGACAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGGTCAGCCGCCTGACATCTGAGGACACTGCCGTCTATTATTGTTCTAGATGGGGAGGGGACGGCTTCTATGCTATGGACTACTGGGGTCAAGGAGCCTCGGTCACCGTCTCCTCG-3' (SEQ ID NO. 4);
wherein the CAR-T plasmid was purchased from Aikangdi biomedical technology (Suzhou) Co., Ltd.; construction of the assembled CAR-T plasmid was performed by Aikangdi biomedical technology (Suzhou) Inc.
Wherein, the ScFv segment can be correspondingly replaced with different solid tumor targets.
3) Preparation of assembled CAR-T cells: the method comprises the following steps:
3.1) extracting the assembled CAR-T Plasmid from the culture solution of Escherichia coli DH5 alpha in the step 2) by using a QIAGEN Endofree Plasmid Maxi Kit Plasmid extraction Kit;
3.2) transfecting the assembled CAR-T plasmid extracted in the step 3.1) into T lymphocytes by using a Lonza AMAXA Lonza Nucleofector 2B/II nuclear transfectator, thereby obtaining the assembled CAR-T cells, and specifically comprising the following steps:
3.2.1) isolation and culture of Peripheral Blood Mononuclear Cells (PBMC)
3.2.1.1) are inverted up and down for several times, lymphocyte separation solution Lymphoprep (human peripheral blood lymphocyte separation solution, Tianjin tertiary ocean Biotech, Ltd.) is fully and uniformly mixed, 15mL Lymphoprep reagent is added into a 50mL centrifuge tube in a biosafety cabinet, and the reagent is marked as a tube 1 for standby;
3.2.1.2) extracting a proper amount of peripheral venous blood of healthy volunteers, diluting the peripheral venous blood sample by using PBS + 2% FBS with the same volume, and then slowly adding the diluted peripheral venous blood sample to the upper layer of the Lymphoprep reagent in the tube 1 along the tube wall by using a pipette gun to avoid the mixing of the Lymphoprep reagent and the peripheral venous blood sample, wherein the mark is tube 2;
3.2.1.3) tube 2 was centrifuged at room temperature for 20 minutes at 800g centrifugal force (if the blood sample storage time exceeded 2 hours, the centrifugation time was extended to 30 minutes) and labeled tube 3;
3.2.1.4) after centrifugation, collecting the upper layer of light yellow serum in a tube 3 into another sterile centrifuge tube 4, preserving at-80 ℃, then gently sucking the mononuclear cell layer at the interface of the serum and the Lymphoprep reagent into a new centrifuge tube 5, and washing the cells once by using a complete culture medium (serum-free culture medium (AIMV, Gibco company) + 10% fetal bovine serum);
3.2.2) isolation of T cells
3.2.2.1) PBMCs cultured in 3.2.1.4) were diluted by complete medium (AIMV + 10% fetal bovine serum) to a cell density of 1 x 108cells/mL (total volume of PBMC solution is not more than 2.5mL), then resuspended in a 5mL round bottom tube, the supernatant is discarded, the pellet is retained, and tube 6 is labeled;
3.2.2.3) to tube 6, 100. mu.l/mL of antibody complex l (Cytokeratin antibody cocktail, available from Fitzgerald) was added, mixed well using a magnetic stirrer, and incubated at room temperature for 15 minutes;
3.2.2.4) blowing the magnetic beads up and down for at least 5 times by using a pipette, fully and uniformly mixing, then sucking 50 mu l of magnetic beads/mL to the sample mixed and incubated in the step 3.2.2.3), fully and uniformly mixing, and incubating for 10 minutes at room temperature;
3.2.2.5) adding a complete culture medium (AIMV + 10% fetal calf serum) to the culture solution mixed and incubated in the step 3.2.2.4) to 2.5mL, opening the cover of the centrifuge tube, inserting the centrifuge tube into a magnetic pole, and standing for 5 minutes at room temperature;
3.2.2.6), keeping the centrifugal tube in the magnetic pole, inverting slightly, and pouring out the liquid in the tube;
3.2.2.7) repeat steps 3.2.2.5) and 3.2.2.6) twice, then the cells were resuspended in AIMV medium and 10% FBS, 100U/mL IL-2, 5ng/mL IL-15 was added.
3.2.3) activation, infection, expansion of T cells
3.2.3.1) T cells prepared in step 3.2.2.7) were diluted to 1 x 10 by AIMV medium6cell/mL, cytokine and antibody complex (final concentration of 100U/mL IL-2, 10ng/mL IL-7, 5ng/mL IL-15, 100 ng/mL IL-15)ng/mL Anti-CD3(OKT3) and 250ng/mL Anti-CD137), and continuously culturing at 37 ℃ for 48 hours;
3.2.3.2) end of culture, 5 x 106Sucking each T cell into a 15ml centrifuge tube, uniformly blowing and stirring for 5 times, discharging the supernatant after 10min under the centrifugal force of 100g, and keeping the precipitate;
3.2.3.3) mixing 82ul Buffer1+18ul Buffer2+2ul target plasmid +2ul PiggyBac transposon, and then using the mixture to resuspend the pellet retained in 3.2.3.2);
wherein 82ul Buffer1+18ul Buffer2 is derived from a Lonza Amaxa electrotransformation Kit, the target Plasmid is the assembled CAR-T Plasmid extracted in the step 3.1), and PiggyBac transposon is purchased from Aikangde biomedical technology (Suzhou) Limited and extracted by using a QIAGEN EndoFree Plasmid Maxi Kit;
3.2.3.4) adding the resuspension solution obtained in step 3.2.3.3) into an electrotransfer cup provided by a Lonza Amaxa electrotransfer kit, and placing the electrotransfer cup into a Lonza Amaxa Nucleofector 2B nuclear transfectator to carry out electrotransfer in a T007 mode;
3.2.3.5) sucking the substances in the electric rotating cup into a 15ml centrifugal tube by a suction tube provided in a Lonza Amaxa electric rotating kit after the electric rotating is finished, centrifuging for 5min under the centrifugal force of 100g, removing the supernatant, and keeping the cell precipitate;
3.2.3.6) resuspending the cell pellet with fresh RPMI1640 medium (purchased from GIBCO), transferring the cell suspension to a new six-well plate, culturing in an incubator of 5% CO2 at 37 ℃, replacing the fresh RPMI1640 medium every 2-3 days and adding 100U/ml IL-2, continuing the culture for about 14 days, and finally sucking out a part of the cell culture solution to detect the expression level of CAR molecules on the surface of T cells using FACS.
Detecting the transfection positive rate of the assembled CAR-T plasmid transfected T cells by a flow cytometry method, specifically, respectively detecting the expression condition of untransfected T cells, the expression condition of extracellular segments of the transfected T cells, the expression condition of intracellular segments of the transfected T cells and the simultaneous expression condition of the intracellular segments and the extracellular segments of the transfected T cells by using a C6 flow cytometer according to a specification;
FIG. 2a shows the results of the detection of untransfected T cells, all of which are clustered in the lower left quadrant; FIG. 2b is the detection result of extracellular domain of transfected T cell, with the cell expressing extracellular domain in the lower right quadrant (accounting for 47.7% of all cells) and the cell not expressing extracellular domain in the lower left quadrant; FIG. 2c shows the results of measurements of intracellular fragments of transfected T cells, with cells expressing the intracellular fragment in the upper left quadrant (44.2% of all cells) and cells not expressing the intracellular fragment in the lower left quadrant; FIG. 2d is a result of detecting the simultaneous expression of the intracellular and extracellular segments of transfected T cells, wherein the cells expressed by both extracellular and intracellular segments are distributed in the upper right quadrant (accounting for 12.0% of all cells); the above test results indicate that about 12.0% of the T cells in step 3.2) have the assembled CAR-T plasmid entering the genome of the T cells and expressed on the surface of the T cells, which are assembled CAR-T cells;
sorting out 12.0% of the assembled CAR-T cells by using flow cytometry sorting, and then detecting the positive rate of CAR-T on the sorted assembled CAR-T cells, wherein the double positive rate of the expression of both extracellular segments and intracellular segments of the sorted assembled CAR-T cells reaches 65.9% as shown in figure 3 a; the morphology of the sorted assembled CAR-T cells was observed under a microscope, and as shown in fig. 3b, the clumps were clones formed after activation of the assembled CAR-T cells, indicating that the assembled CAR-T cells were better active.
4) Preparing solid tumor targeting CAR-T cells: step 3) successful transfection of the assembled CAR-T cell endocytosis the nanoswitch molecule prepared in step 1), specifically: after culturing in a complete culture medium (serum-free medium (AIMV, Gibco company) + 10% fetal bovine serum) for 2-3 days, adding the nano switch molecule prepared in the step 1) into an assembled CAR-T cell culture solution, and activating the assembled CAR-T cell at a fixed point by the nano switch molecule to obtain the solid tumor targeting CAR-T cell.
Example 4: verification that the nano switch molecule activates the assembled CAR-T cell at the tumor site in a fixed point manner to realize specific attack on the tumor cell
Overexpression of HER2 plays an important role in the progression of malignant tumors, and HER2 is known to be overexpressed in tissues such as gastric cancer and breast cancer. The HER2 targeted assembled CAR-T cells are respectively mixed with gastric cancer cells (HER2+ group, HER2 expression is 100 times higher than that of HER 2-group) which highly express HER2 and gastric cancer cells (HER 2-group) which lowly express HER2, the HER2+ group and HER 2-group are respectively added with nano switch molecules with different concentration gradients (0nM, 6.25nM, 12.5nM, 25nM, 50nM, 100.nM and 200nM), the assembled CAR-T cells, gastric cancer cells and nano switch molecules of HER2+ group and HER 2-group are co-cultured at 37 ℃ (assembled bovine serum-T cells: 5 ^ 10/well; gastric cancer cells: 5 ^ 10^ 3/well; complete medium (AIMV medium + 10% fetal) 100 ul/well) for 24 hours, and after the co-culture is finished, partial culture fluid is extracted, IFN secretion level is detected by flow cytometry, can reflect the activation condition of the assembled CAR-T cell to verify the influence of the concentration of the nano switch molecule on the effect of the assembled CAR-T cell on attacking gastric cancer cells with high expression of HER2 or gastric cancer cells with low expression of HER 2;
as shown in figure 4, IFN- γ secretion levels of HER2+ group increased significantly with increasing concentration of nanoswitch molecules (p <0.001), whereas HER 2-group was unaffected, indicating that nanoswitch molecules are target-specific for specific activation of CAR-T cells and can control assembled CAR-T cells to specifically attack HER2+ tumor cells.
The assembled CAR-T cell (a) added with the nano switch molecule and the assembled CAR-T cell (b) not added with the nano switch molecule are respectively co-cultured with gastric cancer cells (HER2+ group) highly expressing HER2 at 37 ℃ for 24 hours, and the expression quantity of CD69 on the surface of the assembled CAR-T cell is detected by flow cytometry, so that the activation condition of the assembled CAR-T cell can be reflected;
as shown in FIG. 5, compared with the assembled CAR-T cell (b) without the addition of the nanoswitch molecule, the curve of the assembled CAR-T cell (a) with the addition of the nanoswitch molecule is shifted to the right, and the fluorescence peak value exceeds 10^4, while the fluorescence number corresponding to the peak value of the assembled CAR-T cell (b) without the addition of the nanoswitch molecule is about 10^2, which proves that the expression level of CD69 of most cells in the group (a) exceeds that of the assembled CAR-T cell (b), and the expression level of CD69 on the surface of the assembled CAR-T cell (a) with the addition of the nanoswitch molecule is obviously increased, thus proving that the assembled CAR-T cell can be activated by the nanoswitch molecule.
Because the tumor targeting nano-carrier (gelatinase targeting nano-particle) contains the locally specific and high-secreted enzyme of the tumor: the substrate peptide segment of MMP2/9, therefore, MMP2/9 can be as the trigger medium of tumour targeting nanometer carrier structural change, tumour targeting nanometer carrier when circulating to the position of MMP2/9 high expression, just can be dissociated by MMP2/9, PEG section and PCL section separate, make the hydrophobic section of tumour targeting nanometer carrier expose, and gather in the tumour tissue position, take place the effect with surrounding tissue, make the hydrophobic section release at tumour tissue cell as the chemotherapeutic drug that tumour targeting nanometer carrier carried, reach the goal of targeting release medicine.
Collagenase type IV (0mg/mL, 0.125mg/mL, 0.25mg/mL, 0.5mg/mL and 1mg/mL) is added into the nano microsphere water solution at different concentrations, as shown in fig. 6, the absorbance of the solution gradually increases along with the prolonging of the treatment time, which implies that the turbidity of the solution increases (namely, the carrier is aggregated and precipitated), the higher the collagenase type IV concentration is, the larger the carrier deformation amount is, the higher the gelatinase concentration is, the higher the switch molecule concentration is, and the switch molecule can be released locally at the tumor due to the high gelatinase concentration locally at the tumor, so that the assembled CAR-T cell is specifically activated.
Injecting the nanometer switch molecule into 4-6 weeks old athymic nude mice at 10mg/kg, and as shown in figure 7, obtaining the result of in vivo imaging of animal experiment: fig. 7A shows the distribution of the nanoswitching molecules in the mouse over time, and it can be seen that the nanoswitching molecules (white regions) are first distributed in the mouse intestinal tract (1h), and begin to enter the mouse tumor 24 hours later for at least 144 hours, and fig. 7B shows that after 144 hours of injection, the tumor and major organs including heart, lung, spleen, liver, kidney, intestine, stomach and brain are excised for ex vivo imaging, and the results show that the nanoswitching molecules are finally specifically accumulated in the tumor part and metabolized by the liver.
In summary, the tumor targeting nanocarrier loads the switch molecule and is released locally in the tumor, and the switch molecule specifically activates the assembled CAR-T cell at the tumor site to achieve specific attack on the tumor cell.
The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above-mentioned embodiments, and all technical solutions belonging to the idea of the present invention belong to the protection scope of the present invention. It should be noted that modifications and embellishments within the scope of the invention may be made by those skilled in the art without departing from the principle of the invention.
Sequence listing
<110> Nanjing drum building hospital
<120> nano switch molecule and solid tumor targeting CAR-T cell for controlling activation thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cggaagcgga gagggcagag gaagtctgct aacatgcggt gacgtcgagg agaatcctgg 60
accta 65
<210> 2
<211> 321
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggagtgcagg tggaaaccat ctccccagga gacgggcgca ccttccccaa gcgcggccag 60
acctgcgtgg tgcactacac cgggatgctt gaagatggaa agaaatttga ttcctcccgg 120
gacagaaaca agccctttaa gtttatgcta ggcaagcagg aggtgatccg aggctgggaa 180
gaaggggttg cccagatgag tgtgggtcag agagccaaac tgactatatc tccagattat 240
gcctatggtg ccactgggca cccaggcatc atcccaccac atgccactct cgtcttcgat 300
gtggagcttc taaaactgga a 321
<210> 3
<211> 279
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgttt gtactttggg 60
gaaaggaacg tgaaaggcat gtttgaggtg ctggagccct tgcatgctat gatggaacgg 120
ggcccccaga ctctgaagga aacatccttt aatcaggcct atggtcgaga tttaatggag 180
gcccaagagt ggtgcaggaa gtacatgaaa tcagggaatg tcaaggacct cctccaagcc 240
tgggacctct attatcatgt gttccgacga atctcaaag 279
<210> 4
<211> 693
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gctgatatcg tgatgaccca gtcccacaag ttcatgtcca cctctgtggg cgatagggtc 60
agcatcacct gcaaggccag tcaggatgtg aatactgctg tagcctggta tcaacagaaa 120
ccaggacatt ctccgaaact actgatttac tcggcatcct tccggtacac tggagtccct 180
gatcgcttca ctggcaatag atctgggacg gatttcactt tcaccatcag cagtgtgcag 240
gctgaagacc tggcagttta ttactgtcag caacattata ctactcctcc cacgttcgga 300
gggggtacca aggtggagat caaagcgtac gctcaggttc agctgcagca gtctggccct 360
gagctggtga agccaggggc ctcactcaag ttgtcctgta cagcttctgg cttcaacatt 420
aaagacacct atatacactg ggtgaaacag aggcctgaac agggcctgga atggattgga 480
aggatttatc ctacgaatgg ttatactaga tatgacccga agttccagga caaggccact 540
ataacagcag acacatcctc caacacagcc tacctgcagg tcagccgcct gacatctgag 600
gacactgccg tctattattg ttctagatgg ggaggggacg gcttctatgc tatggactac 660
tggggtcaag gagcctcggt caccgtctcc tcg 693

Claims (5)

1. A preparation method of a controllable solid tumor CAR-T cell treatment system with a 'nano switch' is characterized by comprising the following steps:
1) preparing a nano switch molecule;
2) constructing an assembled CAR-T plasmid;
3) preparation of assembled CAR-T cells: transfecting the T lymphocytes with the assembled CAR-T plasmid successfully constructed in the step 2);
4) preparing solid tumor targeting CAR-T cells: step 3) successfully transfecting the assembled CAR-T cell culture solution to endocytose the nano switch molecule prepared in the step 1), and activating the assembled CAR-T cell at a fixed point through the switch molecule to obtain a solid tumor targeting CAR-T cell;
in the step 2), the construction steps of the assembled CAR-T plasmid are as follows: introducing a T2A element, an FRB sequence, an FKBP sequence and an ScFv segment targeting a solid tumor into a CAR-T plasmid by using a gene recombination technology to construct an assembled CAR-T plasmid;
in step 3), the assembled CAR-T plasmid is transfected into a T cell by a lentivirus transfection method or an electroporation transfection method;
the preparation method of the nanometer switch molecule specifically comprises the following steps:
step one), dissolving hydrophobic switch molecules and tumor targeting nano-carriers in dichloromethane solution to form an organic phase and mixed solution A;
step two), adding the mixed solution A into a first external water phase containing 3% of polyvinyl alcohol, and fully mixing by adopting an ultrasonic emulsification technology to form a mixed solution B, wherein the mPEG-PEP-PCL diblock copolymer is self-assembled into polymer nanoparticles in the water phase, the hydrophilic end of the polymer nanoparticles faces outwards, and the hydrophobic end of the polymer nanoparticles faces inwards;
step three), adding the mixed solution B into a second external water phase containing 1% of polyvinyl alcohol, and fully mixing by adopting an ultrasonic emulsification technology to form a mixed solution C;
and step four), stirring and volatilizing the mixed solution C by magnetic force at normal temperature, and removing the organic solvent to obtain the tumor targeting nanoparticles of the load switch molecules.
2. Method for the preparation of a controllable solid tumor CAR-T cell therapeutic system with "nanoswitches" according to claim 1, characterized in that: the switch molecule is gibberellin or rapamycin derivatives.
3. Method for the preparation of a controllable solid tumor CAR-T cell therapeutic system with "nanoswitches" according to claim 1, characterized in that: the tumor targeting nano-carrier is a gelatinase targeting nano-particle, a magnetic targeting nano-particle, a thermal targeting nano-particle or an environmental response targeting nano-particle.
4. The controllable solid tumor CAR-T cell treatment system with the 'nano switch' prepared by the preparation method of the controllable solid tumor CAR-T cell treatment system with the 'nano switch' according to any one of claims 1 to 3.
5. Use of the controllable solid tumor CAR-T cell treatment system with the 'nano switch' as described in any one of claims 1-3 in preparation of solid tumor targeted drugs.
CN202010219298.0A 2020-03-25 2020-03-25 Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule Active CN111358956B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010219298.0A CN111358956B (en) 2020-03-25 2020-03-25 Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010219298.0A CN111358956B (en) 2020-03-25 2020-03-25 Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule

Publications (2)

Publication Number Publication Date
CN111358956A CN111358956A (en) 2020-07-03
CN111358956B true CN111358956B (en) 2021-07-09

Family

ID=71199018

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010219298.0A Active CN111358956B (en) 2020-03-25 2020-03-25 Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule

Country Status (1)

Country Link
CN (1) CN111358956B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116519926A (en) * 2022-03-15 2023-08-01 上海君赛生物科技有限公司 Tumor specific immune cell marker and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101480377B (en) * 2009-01-16 2011-01-12 南京大学医学院附属鼓楼医院 Method for preparing tumor enzyme-targeted nano medicine-carrying polymer microsphere
CN101574530A (en) * 2009-06-18 2009-11-11 福建医科大学附属协和医院 Novel PLGA-PEG-PLGA multipolymer microbubble ultrasound contrast agent and preparation method thereof
CN106086078B (en) * 2016-07-08 2017-12-22 宜明细胞生物科技有限公司 A kind of CAR T cell toxicities indicate carrier

Also Published As

Publication number Publication date
CN111358956A (en) 2020-07-03

Similar Documents

Publication Publication Date Title
Sau et al. Multifunctional nanoparticles for cancer immunotherapy: A groundbreaking approach for reprogramming malfunctioned tumor environment
Liang et al. Nanoparticle-enhanced chemo-immunotherapy to trigger robust antitumor immunity
Pirisinu et al. Extracellular vesicles as natural therapeutic agents and innate drug delivery systems for cancer treatment: Recent advances, current obstacles, and challenges for clinical translation
Ortega et al. Biocompatible mannosylated endosomal-escape nanoparticles enhance selective delivery of short nucleotide sequences to tumor associated macrophages
CN111346236B (en) Tumor antigen-loaded polydopamine nanoparticle and preparation method and application thereof
Cruz et al. PLGA-nanoparticles for intracellular delivery of the CRISPR-complex to elevate fetal globin expression in erythroid cells
Meng et al. In situ activated NK cell as bio‐orthogonal targeted live‐cell nanocarrier augmented solid tumor immunotherapy
Laurent et al. Nucleic acid delivery using magnetic nanoparticles: The Magnetofection™ technology
Petrizzo et al. Functional characterization of biodegradable nanoparticles as antigen delivery system
Zhao et al. Exosomes as smart nanoplatforms for diagnosis and therapy of cancer
CN111358956B (en) Nano switch molecule and solid tumor targeting CAR-T cell for controlling activation of nano switch molecule
CN103709400A (en) Hyperbranched polyethylene imine-grafted polyalanine copolymer and preparation method thereof
Fang et al. Optimization of transforming growth factor-β1 siRNA loaded chitosan-tripolyphosphate nanoparticles for the treatment of colorectal cancer hepatic metastasis in a mouse model
JPWO2020080475A1 (en) T cell activation / proliferation method
JP2002541875A (en) Model membrane system
Gao et al. Polyethyleneimine functionalized polymer microsphere: a novel delivery vector for cells
WO2020198145A1 (en) Gene delivery particles to induce tumor-derived antigen presenting cells
CN108250431A (en) A kind of poly- L- glycine copolymer of hyperbranched polyethyleneimine grafting and preparation method thereof
AU2017313806B2 (en) Tumor-targeting bead vectors and methods of using the same
CN107837400B (en) Novel nano gene vector and preparation method thereof
Zhang et al. Microenvironment-activatable cascaded responsive carbonized polymer dots as a theranostic platform for precise rapamycin delivery to potentiate the synergy of chemotherapy and γδ T cells-mediated immunotherapy against tumor
Saengruengrit et al. Effective gene delivery into primary dendritic cells using synthesized PDMAEMA-iron oxide nanocubes
CN114410686A (en) Engineered exosome in-situ nano vaccine and preparation method and application thereof
Kong et al. Mannan‐Modified PLGA Nanoparticles for Targeted Gene Delivery
Laomeephol et al. Potential roles of hyaluronic acid in in vivo CAR T cell reprogramming for cancer immunotherapy

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant