CN111349701A

CN111349701A - RSPH14 gene application, RSPH14 inhibitor application, nucleic acid molecule, construct and composition

Info

Publication number: CN111349701A
Application number: CN202010159307.1A
Authority: CN
Inventors: 何金涛; 马可; 彭俊; 荣昊; 张华川
Original assignee: Sichuan Cancer Hospital
Current assignee: Sichuan Cancer Hospital
Priority date: 2020-03-09
Filing date: 2020-03-09
Publication date: 2020-06-30
Anticipated expiration: 2040-03-09
Also published as: CN111349701B

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of a human RSPH14 gene as a target in preparation of a lung cancer treatment drug or a lung cancer diagnosis drug. The invention is widely and deeply researched to discover that the proliferation of lung cancer cells can be effectively inhibited and the apoptosis can be promoted after the expression of the human RSPH14 gene is down regulated by adopting an RNAi method, and the growth process of the lung cancer can be effectively controlled. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the proliferation rate of lung cancer cells, influence the lung cancer cell cycle, promote the apoptosis of the lung cancer cells and inhibit the growth of the lung cancer, thereby treating the lung cancer and opening up a new direction for treating the lung cancer.

Description

RSPH14 gene application, RSPH14 inhibitor application, nucleic acid molecule, construct and composition

Technical Field

The invention belongs to the field of biomedical research, and particularly relates to application of a human RSPH14 gene and a related product.

Background

The RSPH14 gene encodes a protein of unknown function that is somewhat similar to the yeast vacuolar protein. The gene is located in a chromosomal deletion region in rhabdomyosarcoma of brain, kidney, soft tissue, etc. in children, but the mutation of the gene is not related to diseases (Isolation of genes from the rhabdoid tumor deletion region in chromosome base 22q11.2.Zhou J, et al. Gene,2000Jan 4.PMID 10607907). A surgical specimen from 354 patients with congenital heart disease was subjected to multiplex ligation-related probe amplification and capillary electrophoresis, in which 11.3% of patients had a different degree of deletion or amplification in the region of 22q11.2 in the genome, while the RSPH14 gene was located in this region, indicating that this gene may be associated with congenital heart disease (Genetic characterization of 22q11.2 variations and prediction in pathology with Genetic heart disease. Arch Dis child.2019 Obct30. pi: archdischild-2018-316634.doi: 10.1136/archdischild-2018-316634). In addition, the rs4443100SNP near RTDR1 may be associated with serum parathyroid hormone levels.

There is no report on the use of the RSPH14 gene in lung cancer treatment.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims to provide the application of the human RSPH14 gene and related products.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

in a first aspect of the invention, the human RSPH14 gene is provided as a target for preparing a lung cancer treatment drug or a lung cancer diagnosis drug.

The application of the human RSPH14 gene as a target in preparing a lung cancer treatment drug specifically comprises the following steps: the RSPH14 gene is used as an action object, and the medicine or the preparation is screened to find the medicine which can inhibit the expression of the human RSPH14 gene and is used as a candidate medicine for treating the lung cancer. The RSPH14 gene small interfering RNA (siRNA) is obtained by screening a human RSPH14 gene serving as an action object and can be used as a medicine for inhibiting the proliferation of lung cancer cells. In addition, RSPH14 gene can be used as an object of action, such as antibody drug, small molecule drug, etc.

The application of the human RSPH14 gene as a target in preparing a lung cancer diagnosis medicament specifically comprises the following steps: the RSPH14 gene expression product is used as a lung cancer diagnosis index to be applied to the preparation of lung cancer diagnosis medicines.

The lung cancer treatment drug is a molecule or a drug which can specifically inhibit the transcription or translation of RSPH14 gene, or can specifically inhibit the expression or activity of RSPH14 protein, so that the expression level of the RSPH14 gene in lung cancer cells is reduced, and the purpose of inhibiting the proliferation, growth, differentiation and/or survival of the lung cancer cells is achieved.

The lung cancer therapeutic drug or lung cancer diagnostic drug prepared by using the RSPH14 gene as a target includes but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering lentiviruses.

Such nucleic acid molecules include, but are not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA produced by endoribonuclease III or short hairpin RNA (shRNA).

The lung cancer therapeutic agent is administered in an amount sufficient to reduce transcription or translation of the human RSPH14 gene, or to reduce expression or activity of the human RSPH14 protein. Such that the expression of the human RSPH14 gene is reduced by at least 40% to 100%, e.g., 50%, 80%, 90%, 95%, or 99%.

The method for treating the lung cancer by adopting the lung cancer treatment medicine mainly achieves the aim of treating by reducing the expression level of human RSPH14 gene to inhibit the proliferation of lung cancer cells. In particular, a substance effective to reduce the expression level of human RSPH14 gene is administered to a patient during treatment.

In one embodiment, the target sequence of the RSPH14 gene is set forth in SEQ ID NO:1 is shown. The method specifically comprises the following steps: 5'-GATCATCAGCAAAGGTCTGAT-3' are provided.

In a second aspect of the invention, the use of an RSPH14 inhibitor for the manufacture of a medicament for the treatment of lung cancer. Preferably, the RSPH14 inhibitor plays a role in treating lung cancer by at least one of inhibiting the proliferation rate of lung cancer cells, influencing the cell cycle of lung cancer cells, promoting the apoptosis of lung cancer cells or inhibiting the growth of lung cancer, thereby realizing the efficacy of the RSPH14 inhibitor in the medicine for treating lung cancer.

Further, the invention provides the use of an RSPH14 inhibitor in the preparation of a product having at least one of the following effects:

treating lung cancer;

inhibiting the rate of proliferation of lung cancer cells;

affecting lung cancer cell cycle;

promoting apoptosis of lung cancer cells;

inhibiting the growth of lung cancer.

The product necessarily comprises an inhibitor of RSPH14, and an inhibitor of RSPH14 as an active ingredient of the aforementioned effects. The RSPH14 inhibitor is a molecule having an inhibitory effect on RSPH 14.

The active ingredient for the above purpose may be only an RSPH14 inhibitor, or may comprise other molecules for the above purpose.

That is, the RSPH14 inhibitor is the only active ingredient or one of the active ingredients of the product.

The product may be a single component material or a multi-component material.

The form of the product is not particularly limited, and can be various substance forms such as solid, liquid, gel, semifluid, aerosol and the like.

The product is primarily directed to mammals. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

Such products include, but are not limited to, pharmaceuticals, nutraceuticals, foods, and the like.

The RSPH14 inhibitor can be nucleic acid molecules (double-stranded RNA and shRNA), antibodies and small molecule compounds.

As exemplified in the examples herein, the RSPH14 inhibitor can be a nucleic acid molecule that reduces the expression of the RSPH14 gene in lung cancer cells. Specifically, it may be a double-stranded RNA or shRNA.

In a third aspect of the invention, a method of treating lung cancer is provided by administering to a subject an RSPH14 inhibitor.

The subject may be a mammal or a mammalian lung cancer cell. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human. The lung cancer cell may be an ex vivo lung cancer cell.

The subject may be a patient suffering from lung cancer or an individual in whom treatment for lung cancer is desired. Or the subject is an isolated lung cancer cell from a lung cancer patient or an individual expected to treat lung cancer.

The RSPH14 inhibitor may be administered to a subject before, during, or after receiving treatment for lung cancer.

The fourth aspect of the invention discloses a nucleic acid molecule for reducing the expression of RSPH14 gene in lung cancer cells, wherein the nucleic acid molecule comprises double-stranded RNA or shRNA.

Wherein the double-stranded RNA contains a nucleotide sequence capable of hybridizing with RSPH14 gene;

the shRNA contains a nucleotide sequence capable of hybridizing with RSPH14 gene.

Further, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a target sequence in the RSPH14 gene.

The target sequence in the RSPH14 gene is a segment in the RSPH14 gene corresponding to an mRNA segment which is recognized and silenced by the nucleic acid molecule when the nucleic acid molecule is used for specifically silencing the expression of the RSPH14 gene.

Further, the target sequence of the double-stranded RNA is shown as SEQ ID NO:1 is shown. The method specifically comprises the following steps: 5'-GATCATCAGCAAAGGTCTGAT-3' are provided. Further, the sequence of the first strand of the double-stranded RNA is shown as SEQ ID NO:2, respectively. Specifically 5'-GAUCAUCAGCAAAGGUCUGAU-3'.

Further, the double-stranded RNA is small interfering RNA (siRNA).

SEQ ID NO:2 is designed by taking the sequence shown in SEQ ID NO. 1 as an RNA interference target sequence and aiming at one strand of small interfering RNA of human RSPH14 gene, the sequence of the other strand, namely the second strand, is complementary with the sequence of the first strand, and the siRNA can play a role in specifically silencing the expression of endogenous RSPH14 gene in lung cancer cells.

The shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is basically identical to a target sequence in RSPH14 gene.

Further, the target sequence of the sh RNA is shown as SEQ ID NO:1 is shown.

The shRNA can become small interfering RNA (siRNA) after enzyme digestion and processing, and further plays a role in specifically silencing endogenous RSPH14 gene expression in lung cancer cells.

Further, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, and CCACACC.

Further, the sequence of the shRNA is shown as SEQ ID NO: 3, respectively. Specifically 5'-GAUCAUCAGCAAAGGUCUGAUCUCGAGAUCAGACCUUUGCUGAUGAUC-3'.

Further, the RSPH14 gene is derived from human.

In the fifth aspect of the invention, the RSPH14 gene interfering nucleic acid construct contains a gene segment for coding shRNA in the nucleic acid molecule and can express the shRNA.

The RSPH14 gene interfering nucleic acid construct can be obtained by cloning a gene segment for coding the human RSPH14 gene shRNA into a known vector.

Further, the RSPH14 gene interference nucleic acid construct is an RSPH14 gene interference lentiviral vector.

The RSPH14 gene interference lentiviral vector disclosed by the invention is obtained by cloning a DNA fragment for coding the RSPH14 gene shRNA into a known vector, wherein the known vector is mostly a lentiviral vector, the RSPH14 gene interference lentiviral vector is packaged into infectious viral particles by viruses, then lung cancer cells are infected, the shRNA is transcribed, and the siRNA is finally obtained through the steps of enzyme digestion processing and the like and is used for specifically silencing the expression of the RSPH14 gene.

Further, the RSPH14 gene interference lentiviral vector also contains a promoter sequence and/or a nucleotide sequence which codes for a marker which can be detected in the lung cancer cells; preferably, the detectable label is Green Fluorescent Protein (GFP).

Further, the lentiviral vector may be selected from the group consisting of: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti 6-GW/U6-laminsham, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti 6.2/N-Lumio/V5-GW/lacZ.

The embodiment of the invention specifically discloses a human RSPH14 gene interference lentiviral vector constructed by taking pGCSIL-GFP as a vector, which is named as pGCSIL-GFP-RSPH 14-siRNA.

The RSPH14 gene siRNA can be used for inhibiting the proliferation of lung cancer cells, and further can be used as a medicine or a preparation for treating lung cancer. RSPH14 gene interference lentiviral vector can be used for preparing the RSPH14 gene siRNA. When used as a medicament or formulation for treating lung cancer, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The particular dosage will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.

In the sixth aspect of the invention, the RSPH14 gene interference lentivirus is formed by virus packaging of the RSPH14 gene interference nucleic acid construct under the assistance of lentivirus packaging plasmids and cell lines. The lentivirus can infect lung cancer cells and generate small interfering RNA aiming at RSPH14 gene, thereby inhibiting the proliferation of the lung cancer cells. The RSPH14 gene interference lentivirus can be used for preparing a medicament for preventing or treating lung cancer.

In a seventh aspect of the present invention, there is provided a use of the nucleic acid molecule, or the RSPH14 gene interference nucleic acid construct, or the RSPH14 gene interference lentivirus, wherein: the polypeptide is used for preparing a medicine for preventing or treating lung cancer or a kit for reducing the expression of RSPH14 gene in lung cancer cells.

Further, the application of the nucleic acid molecule, the RSPH14 gene interference nucleic acid construct, or the RSPH14 gene interference lentivirus is used for preparing a medicine for preventing or treating lung cancer.

Further, the application of the nucleic acid molecule, the RSPH14 gene interference nucleic acid construct, or the RSPH14 gene interference lentivirus is provided, and the kit is used for preparing the kit for reducing the expression of the RSPH14 gene in lung cancer cells.

The application of the medicament for preventing or treating the lung cancer provides a method for treating the lung cancer, in particular to a method for preventing or treating the lung cancer in a subject, which comprises the step of administering an effective dose of the medicament to the subject.

Further, when the medicament is used for preventing or treating lung cancer in a subject, an effective dose of the medicament needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and/or metastasis of lung cancer is inhibited. Further, at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% fraction of the growth, proliferation, recurrence and/or metastasis of the lung cancer is inhibited.

The subject of the method may be a human.

In an eighth aspect of the present invention, there is provided a composition for preventing or treating lung cancer, comprising, as active ingredients:

the aforementioned nucleic acid molecules; and/or, the aforementioned RSPH14 gene interfering nucleic acid construct; and/or, the aforementioned RSPH14 gene interferes with lentiviruses, and a pharmaceutically acceptable carrier, diluent, or excipient.

Further, the composition may be a pharmaceutical composition.

When the composition is used for preventing or treating lung cancer in a subject, an effective dose of the composition is administered to the subject. Using this method, the growth, proliferation, recurrence and/or metastasis of lung cancer is inhibited. Further, at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% fraction of the growth, proliferation, recurrence and/or metastasis of the lung cancer is inhibited.

The form of the composition is not particularly limited, and may be in the form of various substances such as solid, liquid, gel, semifluid, aerosol, etc.

The subject to which the composition is primarily directed is a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

In conclusion, the invention designs an RNAi target sequence aiming at the human RSPH14 gene and constructs a corresponding RSPH14RNAi vector, wherein the RNAi vector pGCSIL-GFP-RSPH14-siRNA can obviously reduce the expression of the RSPH14 gene at the mRNA level and the protein level. The slow virus (lentivirus, abbreviated as Lv) is used as a gene operation tool to carry an RNAi vector pGCSIL-GFP-RSPH14-siRNA, so that the RNAi sequence aiming at the RSPH14 gene can be efficiently introduced into lung cancer A549 cells in a targeted manner, the expression level of the RSPH14 gene is reduced, and the proliferation capacity of the tumor cells is remarkably inhibited. Lentivirus-mediated silencing of the RSPH14 gene is therefore a potential clinical non-surgical treatment modality for malignancies.

Compared with the prior art, the invention has the following beneficial effects:

the invention is widely and deeply researched to discover that the proliferation of lung cancer cells can be effectively inhibited and the apoptosis can be promoted after the expression of the human RSPH14 gene is down regulated by adopting an RNAi method, and the growth process of the lung cancer can be effectively controlled. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the proliferation rate of lung cancer cells, influence the lung cancer cell cycle, promote the apoptosis of the lung cancer cells and inhibit the growth of the lung cancer, thereby treating the lung cancer and opening up a new direction for treating the lung cancer.

Drawings

FIG. 1: RT-PCR detects the target gene reduction efficiency of A549 cell mRNA level.

FIG. 2: western Blot is used for detecting that the protein level expression of the RSPH14 gene is reduced by the A549 cell target.

FIG. 3: results of automatic analysis of Celigo cells revealed that depletion of RSPH14 gene inhibited proliferation of lung cancer cells. (cell line is A549 cell, cell number is counted 1, 2, 3, 4 and 5 days after virus infection)

FIG. 4: and (5) detecting the OD value of each experimental group cell by using an enzyme-labeling instrument of 490/570nm to obtain a statistical result graph.

FIG. 5-1: the effect of shRSPH14 on A549 cell cycle was detected by PI-FACS method, and the result is shown as a flow cell cycle peak chart.

FIG. 5-2: the PI-FACS method detects the influence of shRSPH14 on the A549 cell cycle, and is shown as the statistical result of cell histograms in each cycle, and the statistical result is shown as the average value of the cell percentage +/-standard deviation.

FIG. 6-1: the influence of shRSPH14 on A549 cell apoptosis is detected by the Annexin V single staining method flow cytometry, and the image is the result of a flow cell apoptosis peak image.

FIG. 6-2: the influence of shRSPH14 on A549 cell apoptosis is detected by the Annexin V single staining method flow cytometry, and the graph is a histogram statistical result of the apoptotic cell and is shown as the average value plus or minus standard deviation of the cell percentage.

In the drawings, there is shown in the drawings,

bar graphs represent the mean of three experiments and error bars represent Standard Deviation (SD).

P <0.01 for shCtrl compared to target gene shRNA lentivirus treatment group.

And compared with the target gene shRNA lentivirus treatment group, the shCtrl is not less than 0.01 and P is less than 0.05.

Detailed Description

The invention proves the function of the RSPH14 gene in the occurrence of lung cancer from the viewpoint of cell function. Transfecting lung cancer cells after constructing a target gene shRNA lentivirus, and comparing with a transfection control lentivirus to detect the expression conditions of mRNA and protein level target genes in two groups of lung cancer cell lines; and then cell proliferation, apoptosis and other detection are carried out through cytofunctional experiments, and the results show that the lung cancer cell proliferation inhibition degree of the shRNA group is obviously higher than that of the control group and the increase degree of the cell apoptosis rate of the shRNA group is higher than that of the control group compared with the control group.

According to the research results, a new method for diagnosing and treating the gene is further explored and developed, so that more choices can be provided for the diagnosis and treatment of the lung cancer patient.

RSPH14 inhibitor

Refers to a molecule having inhibitory effect on RSPH 14. Having inhibitory effects on RSPH14 include, but are not limited to: inhibit the expression or activity of RSPH 14.

Inhibition of RSPH14 activity refers to a decrease in RSPH14 activity. Preferably, the RSPH14 activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% compared to the activity prior to inhibition.

The inhibition of the expression of RSPH14 can specifically be the inhibition of the transcription or translation of RSPH14 gene, and specifically can be the inhibition of the expression of RSPH14 gene: the gene of RSPH14 is not transcribed, the transcription activity of the gene of RSPH14 is reduced, the gene of RSPH14 is not translated, or the translation level of the gene of RSPH14 is reduced.

The regulation of RSPH14 gene expression can be performed by one skilled in the art using conventional methods, such as gene knockout, homologous recombination, interfering RNA, etc.

Inhibition of gene expression of RSPH14 was confirmed by PCR and Western Blot detection of expression level.

Preferably, the RSPH14 gene expression is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, most preferably by no expression of the RSPH14 gene, compared to the wild type.

Small molecule compounds

The invention refers to a compound which is composed of several or dozens of atoms and has the molecular mass of less than 1000.

Preparation of medicine for preventing or treating lung cancer

Nucleic acid molecules that reduce the expression of the RSPH14 gene in lung cancer cells can be utilized; and/or, RSPH14 gene interfering nucleic acid constructs; and/or RSPH14 gene interferes lentivirus, and is used as an effective component for preparing a medicament for preventing or treating lung cancer. Generally, the medicament can comprise one or more pharmaceutically acceptable carriers or auxiliary materials besides the effective components according to the requirements of different dosage forms.

By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

The "pharmaceutically acceptable carrier or adjuvant" should be compatible with the active ingredient, i.e., capable of being blended therewith without substantially diminishing the effectiveness of the drug under ordinary circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

Example 1 preparation of RNAi lentivirus against the human RSPH14 Gene

1. Screening effective siRNA target point aiming at human RSPH14 gene

Calling RSPH14 (NM-014433) gene information from Genbank; designing effective siRNA target point aiming at RSPH14 gene. Table 1-1 lists the effective siRNA target sequences selected against the RSPH14 gene.

TABLE 1-1 siRNA target sequences targeting the human RSPH14 gene

SEQ ID NO	TargetSeq(5’-3’)
		1	GATCATCAGCAAAGGTCTGAT

2. Preparation of Lentiviral vectors

Synthesizing double-stranded DNAoligo sequences (Table 1-2) containing Age I and EcoR I enzyme cutting sites at two ends aiming at siRNA targets (taking SEQ ID NO:1 as an example); the restriction enzymes AgeI and EcoR I act on pGCSIL-GFP vector (provided by Shanghai Jikai Gene chemistry Co., Ltd.), linearize the vector, and identify the enzyme-cleaved fragments by agarose gel electrophoresis.

TABLE 1-2 double-stranded DNAoligo with AgeI and EcoRI cleavage sites at both ends

The vector DNA linearized by double digestion (digestion system shown in tables 1-4, 37 ℃ C., reaction 1h) and the purified double-stranded DNAoligo were ligated by T4 DNA ligase, and ligated overnight at 16 ℃ in an appropriate buffer system (ligation system shown in tables 1-5), and the ligation product was recovered. The ligation product was transformed into calcium chloride prepared fresh E.coli competent cells (transformation protocol reference: molecular cloning protocols second edition, pages 55-56). Dipping the surface of the clone of the strain growing out of the connected transformation product, dissolving the surface in 10 mul LB culture medium, uniformly mixing and taking 1 mul as a template; designing universal PCR primers at the upstream and downstream of RNAi sequence in the lentiviral vector, wherein the upstream primer sequence: 5'-CCTATTTCCCATGATTCCTTCATA-3' (SEQ ID NO: 6); the sequence of the downstream primer is as follows: 5'-GTAATACGGTTATCCACGCG-3' (SEQ ID NO: 7), and PCR identification experiments were performed (PCR reaction system shown in tables 1-6, reaction conditions shown in tables 1-7). Sequencing and comparing the clones which are identified to be positive by the PCR, wherein the correctly compared clones are the clones which are successfully constructed and are directed at the nucleotide sequence shown in SEQ ID NO:1, named pGCSIL-GFP-RSPH 14-siRNA.

pGCSIL-GFP-Scr-siRNA negative control plasmid was constructed with negative control siRNA target sequence 5'-ttctccgaacgtgtcacgt-3' (SEQ ID NO: 8). When pGCSIL-GFP-Scr-siRNA negative control plasmid is constructed, double-stranded DNAoligo sequences (tables 1-3) containing AgeI and EcoRI enzyme cutting sites at two ends are synthesized aiming at the Scr siRNA target spot, and the rest construction methods, identification methods and conditions are the same as pGCSIL-GFP-RSPH 14-siRNA.

TABLE 1-3 double-stranded DNAoligo with AgeI and EcoRI cleavage sites at both ends

TABLE 1-4 pGCSIL-GFP plasmid digestion reaction System

Reagent	Volume (μ l)
		pGCSIL-GFP plasmid (1. mu.g/. mu.l)	2.0
10×buffer	5.0
		100×BSA	0.5
AgeI(10U/μl)	1.0
		EcoRI(10U/μl)	1.0
ddH₂O	40.5
		Total	50.0

TABLE 1-5 ligation reaction System of vector DNA and double-stranded DNAoligo

TABLE 1-6-1 PCR reaction System

Reagent	Volume (μ l)
		10×buffer	2.0
dNTPs(2.5mM)	0.8
		Upstream primer	0.4
Downstream primer	0.4
		Taq polymerase	0.2
Form panel	1.0
		ddH₂O	15.2
Total	20.0

TABLE 1-7 PCR reaction System Programming

3. Packaging of RSPH14-siRNA lentivirus

The DNA of RNAi plasmid pGCSIL-GFP-RSPH14-siRNA was extracted using a plasmid extraction kit from Qiagen corporation to prepare a 100 ng/. mu.l stock solution.

24h before transfection, human embryonic kidney cell 293T cells in logarithmic growth phase were trypsinized and cell density was adjusted to 1.5 × 10 in DMEM complete medium containing 10% fetal bovine serum⁵Cells/ml, seeded in 6-well plates at 37 ℃ with 5% CO₂Culturing in an incubator. The cell density can reach 70-80% to be used for transfection. 2h before transfection, the original medium was aspirated and 1.5ml of fresh complete medium was added. Mu.l of Packing Mix (PVM), 12. mu.l of PEI, and 400. mu.l of serum-free DMEM medium were added to a sterilized centrifuge tube according to the instructions of the MISSION Lentiviral Packing Mix kit from Sigma-aldrich, and 20. mu.l of the above-mentioned extracted plasmid DNA was added to the above-mentioned PVM/PEI/DMEM mixture.

The transfection mixture was incubated at room temperature for 15min, transferred to medium of human embryonic kidney 293T cells at 37 ℃ with 5% CO₂Culturing for 16h in an incubator. The medium containing the transfection mixture was discarded, washed with PBS solution, 2ml of complete medium was added and incubation continued for 48 h. The cell supernatant was collected, and the lentivirus was purified and concentrated by a Centricon Plus-20 centrifugal ultrafiltration device (Millipore) according to the following steps: (1) centrifuging at 4 deg.C and 4000g for 10min to remove cell debris; (2) filtering the supernatant with a 0.45 μm filter in a 40ml ultracentrifuge tube; (3) centrifuging at 4000g for 10-15min to obtain the required virus concentration volume; (4) after the centrifugation is finished, the filter cup and the lower filtrate collecting cup are separatedOpening, reversely buckling the filter cup on the sample collection cup, and centrifuging for 2min until the centrifugal force is not more than 1000 g; (5) the centrifuge cup is removed from the sample collection cup, and the virus concentrate is obtained. Subpackaging the virus concentrated solution and storing at-80 ℃. The sequence of the first strand of siRNA contained in the virus concentrated solution is shown in SEQ ID NO. 2. The packaging procedure for the control lentivirus was identical to that of the RSPH14-siRNA lentivirus except that the pGCSIL-GFP-Scr-siRNA vector was used in place of the pGCSIL-GFP-RSPH14-siRNA vector.

Example 2 detection of Gene silencing efficiency

Human lung carcinoma A549 cells in logarithmic growth phase were trypsinized to prepare a cell suspension (cell number about 5 × 10)⁴/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. According to the complex infection value (MOI, A549: 10), an appropriate amount of the lentivirus prepared in example 1 is added, the culture medium is replaced after 24h of culture, and cells are collected after the infection time reaches 5 days.

a) Real-time fluorescent quantitative RT-PCR

Total RNA was extracted according to the Trizol protocol of Invitrogen corporation. The RNA was reverse-transcribed to obtain cDNA according to the M-MLV protocol of Promega (reverse transcription reaction system shown in Table 2-1, reaction at 42 ℃ for 1 hour, and then reverse transcriptase was inactivated by water bath for 10min at 70 ℃ in a water bath).

Real-time quantitative detection was carried out using a TP800 Real time PCR instrument (TAKARA). Primers for the RSPH14 gene were as follows: an upstream primer 5'-GCAATGTGGTGCTTGTCCTGA-3' (SEQ ID NO: 11) and a downstream primer 5'-TCACATGCTCCACTGGGTCTT-3' (SEQ ID NO: 12). The housekeeping gene GAPDH is used as an internal reference, and the primer sequences are as follows: an upstream primer 5'-TGACTTCAACAGCGACACCCA-3' (SEQ ID NO: 13) and a downstream primer 5'-CACCCTGTTGCTGTAGCCAAA-3' (SEQ ID NO: 14). The reaction system was prepared in the proportions shown in Table 2-2.

TABLE 2-1 reverse transcription reaction System

Reagent	Volume (μ l)
		5×RTbuffer	4.0
10mMdNTPs	2.0
		RNasin	0.4
M-MLV-RTase	1.0
		DEPCH₂O	2.6
Total	10.0

TABLE 2-2 Real-time PCR reaction System

Reagent	Volume (μ l)
		SYBRpremixextaq	6.0
Primer MIX (5. mu.M)	0.3
		cDNA	0.6
ddH₂O	5.1
		Total	12.0

The program was a two-step Real-time PCR: pre-denaturation at 95 ℃ for 15 s; then, denaturation is carried out at 95 ℃ for 5s in each step; annealing and extending for 30s at 60 ℃; a total of 45 cycles were performed. Each time reading the absorbance value during the extension phase. After the PCR was completed, the DNA was denatured at 95 ℃ for 1min, and then cooled to 55 ℃ to allow the DNA double strands to be sufficiently bound. Melting curves were prepared by increasing the temperature from 55 ℃ to 95 ℃ by 0.5 ℃ for 4 seconds and reading the absorbance. By using 2^-ΔΔCtThe assay calculates the expression abundance of the infected RSPH14 mRNA. Cells infected with the control virus served as controls. The experimental results are shown in fig. 1, which shows that the expression level of RSPH14mRNA in human lung cancer A549 cells is down-regulated by 94.8%.

b) WesternBlotting Process

1. Extraction of Total cellular proteins

(1) Cell samples were received and washed twice with PBS. An appropriate amount of RIPA lysate was taken and PMSF was added to a final concentration of 1mM within a few minutes before use. (using RIPA lysate, instruction chain: http:// www.beyotime.com/RIPA-lysine-buffer. htm)

(2) Adding appropriate amount of RIPA lysate, and lysing on ice for 10-15 min. Cells were scraped off and transferred to a new EP tube, and then cells were sonicated (20 times at 40W, 1s each, 2s apart).

(3) Centrifugation was carried out at 12000g for 15min at 4 ℃ and the supernatant BCA method was used to determine the Protein concentration (BCA Protein Assay Kit instruction: http:// www.beyotime.com/p0010s. htm)

(4) The protein concentration of each sample was adjusted to be consistent by adding fresh lysate, typically 2. mu.g/. mu.L. Then 6X loddingbuffer of 1/5 volumes is added and mixed evenly, the mixture is boiled for 10min in a metal bath of 100 ℃, and the mixture is stored at minus 80 ℃ for standby after short-time centrifugation.

2.SDS-PAGE

(1) Preparing glue: according to the molecular weight of the target protein, glue with different concentrations is prepared, and the specific system is as follows:

TABLE 3-18 mL System separation gel Components

TABLE 3-210 mL System separation gel Components

Tables 3-3 concentrated gel Components

(2) Loading: after the gel is solidified, the comb is pulled out, the electrophoresis buffer solution is used for cleaning the sample loading hole, and the prepared sample is loaded.

(3) Electrophoresis: concentrating the gel at 80mA for 20 min; the separation gel was 120mA, 1 h.

3. Immunoblotting (Wet transfer)

After the electrophoresis is finished, the protein is transferred to the PVDF membrane by using a transfer electrophoresis device and electrotransfer for 150min under the constant current condition of 300mA at 4 ℃.

4. Antibody hybridization:

(1) and (3) sealing: PVDF membrane was blocked with blocking solution (TBST solution containing 5% skim milk) at room temperature for 1h or overnight at 4 ℃.

(2) Primary antibody incubation: the antibody was diluted with blocking solution and incubated with the blocked PVDF membrane at room temperature for 2h or overnight at 4 ℃ and the membrane was washed 4 times with TBST for 8min each.

(3) And (3) secondary antibody incubation: the corresponding secondary antibody was diluted with blocking solution, the PVDF membrane was incubated at room temperature for 1.5h, and the membrane was washed 4 times with TBST, 8min each.

X-ray development: (use of 20X from CST Co., Ltd.)

Reagent and 20X Peroxide #7003 kit, instruction linked: https:// www.cst-c.com.cn/products/wb-ip-reagents/20 x-lumiglo-reagents-and-20 x-peroxides/7003? site-search-type product)

(1) The solution A and the solution B in the kit are mixed according to the proportion of 1:1, inverted and mixed evenly, and can be used after being placed for a plurality of minutes.

(2) Taking out the film, wiping the absorbent paper dry, spreading into a cassette, dripping a proper amount of uniformly mixed ECL luminous liquid, spreading a preservative film (avoiding generating bubbles), putting an X-ray film (avoiding the movement of the X-ray film), closing the cassette, and exposing for 1 s-several min (the exposure time needs to be tried for several times, and the exposure time is properly adjusted according to whether the naked eye can see fluorescence and the strength of the fluorescence.

(3) Taking out the X-ray film, placing in developing solution, taking out after banding occurs, rinsing in clear water for several seconds, and placing in fixing solution for at least 2 min.

(4) Taking out the X-ray film, drying and analyzing.

The results are shown in FIG. 2, which indicates that the target has a knockdown effect on the endogenous expression of the target gene, and thus is an effective target.

Example 3 examination of the proliferative Capacity of tumor cells infected with RSPH14-siRNA lentivirus

a) Celigo experiment

Human lung carcinoma A549 cells in logarithmic growth phase were trypsinized to prepare a cell suspension (cell number about 5 × 10)⁴Perml) was inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. according to the multiplicity of infection (MOI, A549: 10), an appropriate amount of virus was added, the medium was changed after 24 hours of culture, and after the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. the complete medium was resuspended in a cell suspension (2 × 10)⁴Per ml) at a cell density of about 3000 cells per well, 96-well plates were seeded. Each set of 5 duplicate wells, 100. mu.l per well. After the plate is laid, the plate is placed at 37 ℃ and 5% CO₂Culturing in an incubator. The plate reading was performed once a day with Celigo instrument (Nexcelom) starting the next day after plating, and the plate reading was performed continuously for 5 days. By adjusting the input parameters of analysissettings, the cells with green fluorescence in the well plate of each scanning can be accurately calculatedThe number of (2); the data were statistically plotted and cell proliferation curves were plotted for 5 days.

The results are shown in fig. 3, and the results show that after each tumor in the lentivirus infection group is cultured in vitro for 5 days, the proliferation speed is remarkably slowed down and is far lower than that of the tumor cells in the control group, the reduction ratio of the number of viable cells is 91.9%, and the result shows that the proliferation capacity of the human lung cancer A549 cells is inhibited due to the silencing of the RSPH14 gene.

b) CCK8 experiment

Human lung carcinoma A549 cells in logarithmic growth phase were trypsinized to prepare a cell suspension (cell number about 5 × 10)⁴/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. Adding a proper amount of virus according to the infection number, culturing for 24h, then replacing the culture medium, collecting pancreatin digestion of cells of each experimental group in the logarithmic growth phase, completely suspending the culture medium into cell suspension, and counting. Determining the density of plated cells (2000 cells/well) according to the growth speed of the cells, repeating each group by 3-5, uniformly plating, observing the cell density of each experimental group under a microscope after the cells are completely precipitated, fixing one group if the density is not uniform, finely adjusting the amount of the cells of other groups, plating again (for example, plating again after the cells of the Con group are found to be more and the cell amount is reduced), and putting the cells into a cell culture box for culture. Starting the day after plating, 20. mu.L of 5mg/mL MTT was added to the wells 4h before termination of the culture without changing the medium. After 4h, the culture was completely aspirated, and the formazan particles were dissolved by adding 100. mu.L of LDMSO, taking care not to aspirate the formazan particles at the bottom of the well plate. Oscillating for 2-5min with oscillator, and detecting OD value with enzyme labeling instrument 490/570 nm. And (6) carrying out data statistical analysis.

The results are shown in fig. 4, and the results show that after each tumor in the lentivirus infection group, the proliferation speed is remarkably reduced and is far lower than that of the tumor cells in the control group, the reduction ratio of the number of the viable cells is 68.30%, and the RSPH14 gene silencing leads to the inhibition of the proliferation capacity of the human lung cancer A549 cells.

Example 4 tumor cell cycle assay for infection with RSPH14-siRNA lentivirus

Human lung carcinoma A549 cells in logarithmic growth phase were trypsinized to prepare a cell suspension (cell number about 5 × 10)⁴/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. According to the infection complex number (MOI, A549: 10), adding a proper amount of virus, culturing for 24h, then replacing the culture medium, and collecting cells of each experimental group in the logarithmic growth phase after the infection time reaches 3 days. If the cells are adherent cells, when the 6cmdish cells in each experimental group grow to the coverage rate of about 80% (the cells do not enter the growth plateau), pancreatin digestion is carried out, the complete culture medium is re-suspended into cell suspension, the cells are collected in a 5mL centrifuge tube, and each group is provided with three multiple holes (in order to ensure that the number of the cells on the machine is enough, the number of the cells is more than or equal to 10⁶Treatment), if the cells are suspension cells, directly collecting the suspension cells, centrifuging for 5min at 1300rmp, discarding the supernatant, washing the Cell sediment for 1 time at 4 ℃ by pre-cooled D-Hanks (pH 7.2-7.4), centrifuging for 5min at 1300rmp, fixing the cells by 75% ethanol pre-cooled at 4 ℃ for at least 1 h.1300rmp, removing the fixing solution, washing the Cell sediment once by D-Hanks, and synchronously preparing a Cell staining solution in step 2. 40 × PI mother solution (2 mg/mL): 100 × RNase mother solution (10 mg/mL): 1 × D-Hanks ═ 25: 10: 1000 Cell staining, adding a certain volume of Cell staining solution (0.6-1mL) according to the Cell amount, re-suspending, and ensuring the Cell passing rate at the machine-on machine to be 300-800/s, and carrying out the machine detection and analyzing the Cell data.

The results are shown in FIGS. 5-1 and 5-2, which show that the expression of the gene decreased by RNA interference (shRSPH14 group) and that the number of cells decreased at S-stage and G2/M and increased at G1-stage, respectively, compared with the control interference (shCtrl group).

Example 5 detection of apoptosis levels in tumor cells infected with RSPH14-siRNA lentivirus

Human lung cancer A549 cells in logarithmic growth phase are trypsinized and then inoculated into a 12-well plate, the cell density is 10-15%, and the cells are replaced by fresh culture medium containing 5ug/ml polybrene the next day. Lentiviruses were added to the plates at multiplicity of infection (MOI, A549: 10) and the medium was changed fresh 12-24h after infection. After infection for 96h, fluorescence is observed under a fluorescence microscope, and the infection efficiency reaches 90%.

After trypsinizing the cells in logarithmic growth phase, resuspending the complete medium into a cell suspension; collecting the supernatant in the same 5mL centrifuge tube, and setting three multiple holes in each group (to ensure enough cells on the machine, fineThe number of cells is more than or equal to 5 × 10⁵Treatment), 1300rmp centrifugation for 5min, abandoning the supernatant, washing the cell sediment with 4 ℃ precooled PBS, washing the cell sediment with 1 × binding buffer once, 1300rmp centrifugation for 3min, collecting the cells, resuspending the cell sediment with 200 uL 1 × binding buffer, adding 10 uLannexin V-APC for staining, keeping the room temperature away from light for 10-15min, adding 400 uL 1 × binding buffer according to the cell amount, detecting with an up-flow cytometer, and analyzing the result.

The results are shown in FIG. 6-1 and FIG. 6-2, which indicate that the apoptosis ratio of tumor cells is increased after the down-regulation of gene expression. After the control interference (shCtrl group) and the RNA interference reduce the expression of the gene (shRSPH14 group), the number of apoptotic tumor cells is increased; indicating that gene silencing leads to apoptosis of tumor cells.

While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

SEQUENCE LISTING

<110> Hospital for tumor in Sichuan province

<120> uses of RSPH14 gene, uses of RSPH14 inhibitor, nucleic acid molecule, construct and composition

<130>none

<160>14

<170>PatentIn version 3.5

<210>1

<211>21

<212>DNA

<213> human source

<400>1

gatcatcagc aaaggtctga t 21

<210>2

<211>21

<212>RNA

<213> Artificial sequence

<400>2

gaucaucagc aaaggucuga u 21

<210>3

<211>48

<212>RNA

<213> Artificial sequence

<400>3

gaucaucagc aaaggucuga ucucgagauc agaccuuugc ugaugauc 48

<210>4

<211>58

<212>DNA

<213> Artificial sequence

<400>4

ccgggatcat cagcaaaggt ctgatctcga gatcagacct ttgctgatga tctttttg 58

<210>5

<211>58

<212>DNA

<213> Artificial sequence

<400>5

aattcaaaaa gatcatcagc aaaggtctga tctcgagatc agacctttgc tgatgatc 58

<210>6

<211>24

<212>DNA

<213> Artificial sequence

<400>6

cctatttccc atgattcctt cata 24

<210>7

<211>20

<212>DNA

<213> Artificial sequence

<400>7

gtaatacggt tatccacgcg 20

<210>8

<211>19

<212>DNA

<213> Artificial sequence

<400>8

ttctccgaac gtgtcacgt 19

<210>9

<211>54

<212>DNA

<213> Artificial sequence

<400>9

ccggttctcc gaacgtgtca cgtctcgaga cgtgacacgt tcggagaatt tttg 54

<210>10

<211>54

<212>DNA

<213> Artificial sequence

<400>10

aattcaaaaa ttctccgaac gtgtcacgtc tcgagacgtg acacgttcgg agaa 54

<210>11

<211>21

<212>DNA

<213> Artificial sequence

<400>11

gcaatgtggt gcttgtcctg a 21

<210>12

<211>21

<212>DNA

<213> Artificial sequence

<400>12

tcacatgctc cactgggtct t 21

<210>13

<211>21

<212>DNA

<213> Artificial sequence

<400>13

tgacttcaac agcgacaccc a 21

<210>14

<211>21

<212>DNA

<213> Artificial sequence

<400>14

caccctgttg ctgtagccaa a 21

Claims

1. The human RSPH14 gene is used as a target in the preparation of lung cancer treatment medicines or lung cancer diagnosis medicines.

Use of an RSPH14 inhibitor for the preparation of a product having at least one of the following effects:

treating lung cancer;

inhibiting the rate of proliferation of lung cancer cells;

affecting lung cancer cell cycle;

promoting apoptosis of lung cancer cells;

inhibiting the growth of lung cancer.

3. Use according to claim 2, further comprising one or more of the following features:

1) the RSPH14 inhibitor is a molecule having an inhibitory effect on RSPH 14;

2) the RSPH14 inhibitor is the only effective component or one of the effective components of the product;

3) the RSPH14 inhibitor is selected from double-stranded RNA, shRNA, antibody or small molecule compound.

4. Use according to claim 3, further comprising one or more of the following features:

1) the shRNA or double-stranded RNA target sequence is shown as SEQ ID NO:1 is shown in the specification;

2) the double-stranded RNA comprises a first strand and a second strand, wherein the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is shown as SEQ ID NO:2 is shown in the specification;

3) the nucleotide sequence of the shRNA is shown as SEQ ID NO: 3, respectively.

5. A nucleic acid molecule for reducing the expression of RSPH14 gene in a lung cancer cell, the nucleic acid molecule comprising:

a. double-stranded RNA containing a nucleotide sequence capable of hybridizing with RSPH14 gene;

the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a target sequence in the RSPH14 gene; or

shRNA, which contains a nucleotide sequence capable of hybridizing with RSPH14 gene;

6. The nucleic acid molecule for reducing the expression of the RSPH14 gene in a lung cancer cell of claim 5, further comprising one or more of the following characteristics:

2) the double-stranded RNA is siRNA, and the sequence of the first strand of the siRNA is shown as SEQ ID NO:2 is shown in the specification;

3) the nucleotide sequence of the shRNA is shown as SEQ ID NO: 3, respectively.

7. An RSPH14 gene interfering nucleic acid construct containing a gene segment encoding the shRNA in the nucleic acid molecule according to any one of claims 5 to 6, capable of expressing the shRNA.

8. An interference lentivirus of RSPH14 gene, which is prepared by virus packaging of the interference nucleic acid construct of claim 7 with the help of lentivirus packaging plasmid and cell line.

9. The nucleic acid molecule of any one of claims 5 to 6, or the RSPH14 gene interfering nucleic acid construct of claim 7, or the RSPH14 gene interfering lentivirus of claim 8, for use in: the polypeptide is used for preparing a medicine for preventing or treating lung cancer or a kit for reducing the expression of RSPH14 gene in lung cancer cells.

10. A composition for preventing or treating lung cancer, which comprises the following effective components:

the nucleic acid molecule of any one of claims 5-6; and/or, the RSPH14 gene interfering nucleic acid construct of claim 7; and/or, the RSPH14 gene interfering lentivirus of claim 8,

and a pharmaceutically acceptable carrier, diluent or excipient.