CN111349624A - Nucleic acid, polypeptide coupling composition, polypeptide composition and preparation method and application thereof - Google Patents
Nucleic acid, polypeptide coupling composition, polypeptide composition and preparation method and application thereof Download PDFInfo
- Publication number
- CN111349624A CN111349624A CN202010199230.0A CN202010199230A CN111349624A CN 111349624 A CN111349624 A CN 111349624A CN 202010199230 A CN202010199230 A CN 202010199230A CN 111349624 A CN111349624 A CN 111349624A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- composition
- cdk3
- seq
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11022—Cyclin-dependent kinase (2.7.11.22)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
Abstract
The invention relates to a nucleic acid, a polypeptide coupling composition, a polypeptide composition, a preparation method and application thereof. The polypeptide composition contains polypeptide with an amino acid sequence shown as SEQ ID No.1 and polypeptide with an amino acid sequence shown as SEQ ID No. 2. The polypeptide composition can induce CDK3 antibody with higher specificity.
Description
Technical Field
The invention relates to the field of biology, in particular to a nucleic acid, a polypeptide coupling composition, a polypeptide composition, a preparation method and an application thereof.
Background
Cyclin-dependent protein kinases (CDKs) are a class of serine/threonine protein kinases, and play an important role in cell cycle regulation, promote and regulate the orderly progression of various phases of the cell cycle, and promote cell division and proliferation. CDK3 is one of the important members of the CDK family, playing an important role in cell cycle regulation. CDK3 activity occurs in G1, and in combination with cyclin E plays an important role in G1/S turnover. In addition, CDK3 bound to cyclin C, causing cells to resume the cell cycle from G0.
Research shows that CDK3 is highly expressed in breast cancer cells and breast cancer tissues, and miR-873 and miR-125a-3p reduce ER (estrogen receptor) activity and inhibit proliferation of ER positive breast cancer cells and tumor growth of tumor-bearing mice by down-regulating expression of a target gene CDK 3. CDK3 was found to be highly expressed in brain gliomas. CDK3 phosphorylates ATF1 (transcription activator 1) and c-Jun (a transcription regulator, belonging to leucine zipper family members), activates transcriptional activity of ATF1 and AP-1 (a transcription activator), promotes JB6 cell (mouse epidermal cell) transformation and Ras gene-induced plate colony formation of NIH3T3 cells, while CDK3 knockdown (CDK3 knockdown) inhibits ATF1 activity, glioma cell proliferation and soft agar colony formation. It was also found that CDK3 is highly expressed in skin cancer and CDK3 phosphorylates NFAT3 by interacting with the transcription factor NFAT3, promoting malignant transformation and tumorigenesis of skin cancer. The above studies indicate that CDK3 may play a role in oncogene in cell malignant transformation and tumorigenesis development, and is closely related to the malignant biological behavior of tumors. Therefore, it is necessary to study the biological function of CDK3 in biology and tumor cytology. Among them, antibodies that recognize CDK3 are indispensable tools. However, the poor specificity of existing antibodies recognizing CDK3 severely limits the in-depth study of CDK 3.
Disclosure of Invention
In view of this, there is a need to provide a polypeptide composition capable of inducing the production of antibodies to CDK3 with higher specificity.
In addition, a preparation method and application of the polypeptide composition, nucleic acid and polypeptide coupling composition are also needed to be provided.
A polypeptide composition comprises a polypeptide with an amino acid sequence shown as SEQ ID No.1 and a polypeptide with an amino acid sequence shown as SEQ ID No. 2.
Researches show that the polypeptide composition containing the polypeptide with the amino acid sequence shown as SEQ ID No.1 and the polypeptide with the amino acid sequence shown as SEQ ID No.2 can induce CDK3 antibody with higher specificity, and is favorable for the deep research of CDK 3.
In one embodiment, the carboxy terminus of the polypeptide is amidated.
A method of preparing a polypeptide composition comprising the steps of: the polypeptide with the amino acid sequence shown as SEQ ID No.1 and the polypeptide with the amino acid sequence shown as SEQ ID No.2 are prepared by a polypeptide solid phase synthesis method or a genetic engineering technology.
A nucleic acid comprising a coding sequence for a polypeptide having an amino acid sequence as set forth in SEQ ID No.1 or a coding sequence for a polypeptide having an amino acid sequence as set forth in SEQ ID No. 2.
A polypeptide conjugate composition comprising two polypeptide conjugates, both polypeptide conjugates comprising a polypeptide portion, one polypeptide portion of said polypeptide conjugate comprising a polypeptide having an amino acid sequence as set forth in SEQ ID No.1 and the other polypeptide portion of said polypeptide conjugate comprising a polypeptide having an amino acid sequence as set forth in SEQ ID No. 2.
In one embodiment, both of the polypeptide conjugates comprise a coupling moiety attached to the polypeptide moiety, the coupling moiety being selected from at least one of hemocyanin, ovalbumin, and bovine serum albumin.
A method of making a CDK3 antibody, comprising the steps of:
immunizing animals by using antigens, and collecting serum of the immunized animals to obtain CDK3 antibodies, wherein the antigens are the polypeptide composition or the polypeptide coupling composition.
CDK3 antibody prepared by the CDK3 antibody preparation method.
Use of the polypeptide composition, the polypeptide conjugate composition or the CDK3 antibody in the preparation of a test agent, a test kit or a test device.
A test kit comprising: the polypeptide composition described above, the polypeptide conjugate composition described above, or the CDK3 antibody described above.
Drawings
FIG. 1 shows the results of WesternBlot of example 5.
Detailed Description
To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
The polypeptide composition of an embodiment can induce the production of antibodies against CDK3 with higher specificity, so as to facilitate the intensive study of CDK3, so that the polypeptide composition can be applied to the preparation of detection reagents, detection kits or detection devices. The detection reagent, the detection kit or the detection device is used for detecting CDK3 or detecting the titer of CDK3 antibody.
In one embodiment, the polypeptide composition comprises a polypeptide having an amino acid sequence as shown in SEQ ID No.1 and a polypeptide having an amino acid sequence as shown in SEQ ID No. 2. Specifically, the amino acid sequence shown as SEQ ID No.1 is: FPKWTRKGLEEIVPNLEPEGRD, respectively; the amino acid sequence shown as SEQ ID No.2 is as follows: YDPSQRITAKTALAHPYFSSPEPSPAAR are provided.
Further, the carboxyl terminal of the polypeptide having an amino acid sequence shown in SEQ ID No.1 is amidated. Specifically, the carboxyl group of D (i.e. aspartic acid) at the carbon terminal of the polypeptide with the amino acid sequence shown as SEQ ID No.1 is amidated to be amide group, namely NH2-FPKWTRKGLEEIVPNLEPEGRD-CONH2。
Further onAnd the carboxyl terminal of the polypeptide with the amino acid sequence shown as SEQ ID No.2 is amidated. Specifically, the carboxyl of R (namely arginine) at the carbon terminal of the polypeptide with the amino acid sequence shown as SEQ ID No.2 is amidated into amido, namely NH2-YDPSQRITAKTALAHPYFSSPEPSPAAR-CONH2。
Researches show that the polypeptide composition containing the polypeptide with the amino acid sequence shown as SEQ ID No.1 and the polypeptide with the amino acid sequence shown as SEQ ID No.2 can induce CDK3 antibody with higher specificity, and is favorable for the deep research of CDK 3.
The method for preparing the polypeptide composition of the above embodiment comprises the following steps: the polypeptide is prepared by a polypeptide solid phase synthesis method or a gene engineering technology.
In one embodiment, the solid phase synthesis method of the polypeptide is Boc solid phase synthesis or Fmoc solid phase synthesis. Wherein Boc is tert-butyloxycarbonyl. In the Boc solid-phase synthesis method, an easily acidolyzed Boc group is used as an N-alpha-protective group. Fmoc is 9-fluorenylmethyloxycarbonyl. In the Fmoc solid-phase synthesis method, an Fmoc group which is easy to acidolyze is used as an N-alpha-protecting group.
In one embodiment, the genetic engineering technique is specifically: constructing recombinant vector containing the coding sequence of the polypeptide. The coding sequence of the polypeptide can be well preserved by constructing the recombinant vector, which is beneficial to the expression of the polypeptide.
Further, the recombinant vector is a recombinant expression vector or a recombinant cloning vector. The recombinant vector is capable of expressing or cloning the polypeptide.
Further, the recombinant vector contains a purification tag. And the purification tag is arranged, so that the separation and purification of the polypeptide are facilitated. Further, the purification tag is a His tag, a GST tag, or a SUMO tag. It should be noted that the purification tag is not limited to the above-mentioned purification tags, and other common purification tags can also be used as the purification tag of the recombinant vector.
The recombinant vector can be used as a recombinant vector, and can be used as a vector for genetic engineering, such as a pET-32a vector, a pGEX-6P-1 vector, a pPIC-9K vector or a pPIC-Z α vector.
In one embodiment, the genetic engineering technique is specifically: by constructing recombinant cells containing the coding sequence of the above polypeptide or the above recombinant vector. The recombinant cell is a cell for cloning the polypeptide or a cell for expressing the polypeptide.
The polypeptide can be cloned or expressed by constructing the recombinant cell, so that the polypeptide can be prepared in a large scale, and the polypeptide can be directionally expressed by the recombinant cell, so that the polypeptide with higher purity can be obtained, and the application of the polypeptide is facilitated.
Further, recombinant cells include recipient cells. The coding sequence of the polypeptide or the recombinant vector is located in a receptor cell.
More specifically, the recipient cell is Escherichia coli DH5 α, Escherichia coli Top10, Escherichia coli Orgami (DE3), Pichia pastoris GS115 or Pichia pastoris SMD 1168.
Of course, the method for preparing the polypeptide composition further comprises the step of mixing the polypeptides.
In the preparation method of the polypeptide composition, the preparation process of the polypeptide is simple, the operation is convenient, and the purity of the prepared polypeptide is high, so that CDK3 antibody with high specificity is induced and generated, and the deep research on CDK3 is facilitated.
Further, there is provided a nucleic acid of an embodiment comprising a coding sequence for any of the polypeptides of the above embodiments. Such an arrangement enables genetic engineering techniques to obtain any of the polypeptides of the above embodiments.
The polypeptide conjugate composition of one embodiment comprises two polypeptide conjugates, each comprising a polypeptide portion, the polypeptide portion of one polypeptide conjugate comprising a polypeptide having an amino acid sequence as set forth in SEQ ID No.1 and the polypeptide portion of the other polypeptide conjugate comprising a polypeptide having an amino acid sequence as set forth in SEQ ID No. 2. The polypeptide conjugate prepared from the polypeptide is beneficial to enhancing the immunogenicity of the polypeptide, so that CDK3 antibody is efficiently induced, and the polypeptide conjugate can be applied to preparation of detection reagents, detection kits or detection devices. The detection reagent, the detection kit or the detection device is used for detecting CDK3 or detecting the titer of CDK3 antibody.
Further, both polypeptide conjugates also comprise a coupling moiety. The coupling moiety is linked to the corresponding polypeptide moiety. Further, the coupling moiety is selected from at least one of hemocyanin (KLH), Ovalbumin (OVA) and Bovine Serum Albumin (BSA). The coupling moiety can be coupled to a polypeptide moiety to elicit a more complete immune response.
Alternatively, the coupling moiety is KLH. Klh (keyhole Limpet hemocyanin), hemocyanin, is a free blue respiratory pigment found in the hemolymph of certain molluscs, arthropods (spiders and crustaceans). Hemocyanin contains two copper ions directly connected with polypeptide chains, is similar to hemoglobin containing iron, is easy to combine with oxygen and dissociate from oxygen, is the only known copper protein capable of reversibly combining with oxygen, and is greenish when oxidized and white when reduced. The molecular weight of the compound is 45000-130000. KLH is more immunogenic than BSA.
In one embodiment, the polypeptide moiety is a polypeptide as described above and the coupling moiety is KLH.
Experiments prove that the titer of CDK3 antibodies induced by the polypeptide coupling composition is more than 1:32000, and the immune function is strong.
Further, there is provided a method for preparing the polypeptide conjugate of the above embodiment, comprising the steps of: mixing and reacting Sulfo-SMCC (4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid Sulfo succinimide ester sodium salt) polypeptide part and a coupling part to connect the polypeptide part and the coupling part to obtain a polypeptide conjugate; the polypeptide portion contains the polypeptide of the above embodiment or the polypeptide produced by the method for producing the polypeptide of the above embodiment.
In one embodiment, the mass ratio of Sulfo-SMCC, polypeptide moiety, and coupling moiety is 1:10: 10.
In one embodiment, the step of mixing and reacting the Sulfo-SMCC, polypeptide moiety and the coupling moiety comprises S110 to S120:
s110, mixing and reacting the Sulfo-SMCC with a coupling moiety to form an intermediate.
In one embodiment, S110 includes: mixing the coupled fraction with AH solution to obtain a first mixture; mixing Sulfo-SMCC with DMSO (dimethyl sulfoxide) to obtain a second mixture; the first mixture is mixed with the second mixture and reacted to provide an intermediate. Wherein the AH solution contains Na2HPO4、NaH2PO4NaCl and EDTA, and pH of AH solution was 7.2. Further, the final concentration of the coupling moiety in the first mixture was 10 mg/mL. The final concentration of Sulfo-SMCC in the second mixture was 100 mg/mL. The reaction temperature was room temperature. The reaction time was 4 h.
In one embodiment, the step of mixing and reacting the Sulfo-SMCC with the coupling moiety is preceded by the steps of: the reaction mixture obtained by mixing and reacting Sulfo-SMCC with a coupling moiety was purified. It should be noted that the above reactants are purified by conventional methods in the art, such as column separation and purification, and will not be described herein.
And S120, mixing the intermediate and the polypeptide part and reacting to obtain the polypeptide conjugate.
Specifically, the step of mixing and reacting the intermediate with the polypeptide moiety comprises: dissolving the polypeptide part, and mixing with AH solution to obtain a polypeptide mixture; and adding the polypeptide mixture into the intermediate, mixing and reacting to obtain the polypeptide conjugate. Wherein, the chemical reagent for dissolving the polypeptide is DMF (N, N-dimethylformamide). The concentration of the polypeptide in the polypeptide mixture was 6 mg/mL. The mass ratio of the polypeptide part, the coupling part and the Sulfo-SMCC in the mixture of the intermediate and the polypeptide mixture is 10:10: 1.
In one embodiment, the reaction time is 2h to 12 h. The reaction temperature was room temperature.
The preparation method of the polypeptide conjugate is simple to operate, and the prepared polypeptide conjugate can efficiently induce CDK3 antibodies.
The method for preparing the CDK3 antibody according to one embodiment can prepare the CDK3 antibody with high specificity and potency, so that the method can be applied to preparation of a detection reagent, a detection kit or a detection device. The detection reagent, the detection kit or the detection device is used for detecting CDK3 or detecting the titer of CDK3 antibody. The CDK3 antibody preparation method comprises the following steps: the animal is immunized with the antigen, and the serum of the immunized animal is collected to obtain the CDK3 antibody, wherein the antigen is the polypeptide composition of the above embodiment or the polypeptide conjugate composition of the above embodiment.
Specifically, after mixing the antigen with Freund's complete adjuvant, immunizing the rabbit with 180-220 mug antigen dose, raising for 2-3 weeks to obtain the rabbit immunized for the first time;
mixing the antigen with Freund's incomplete adjuvant, performing booster immunization on the primarily immunized rabbit at the antigen dose of 80-120 mug/rabbit, and feeding for 2-3 weeks to obtain the immunized rabbit. The number of booster immunizations is not limited to one, and may be two or more, for example, four. When the number of booster immunizations is four, the time interval between two adjacent booster immunizations is 2 weeks to 3 weeks.
Wherein, the rabbit is a rabbit conventionally used in animal experiments in the field, such as RB59731 New Zealand rabbit or RB59732 New Zealand rabbit.
The animal is not limited to a rabbit, and may be another animal, such as a mouse or a rat.
In one embodiment, the step of collecting the serum of the immunized animal further comprises the following steps: serum was purified to obtain CDK3 antibody. The way to purify serum is affinity purification.
The method for producing the CDK3 antibody is simple to operate, and the CDK3 antibody having high specificity and potency can be produced by using the polypeptide composition of the above embodiment or the polypeptide conjugate composition of the above embodiment as an antigen.
The detection kit of an embodiment comprises the polypeptide composition of the above embodiment or the polypeptide conjugate composition of the above embodiment. The detection kit can be used for detecting the titer of the CDK3 antibody.
It should be noted that the above-mentioned detection kit may further comprise other reagents commonly used in the art, such as coating solution, blocking solution and washing solution. The coating solution may be Tris-HCl (pH8.5), PBS (10 mM, pH7.4), or Na (50 mM, pH9.6)2CO3. The blocking solution comprises BSA (bovine serum albumin), skimmed milk powder, casein or gelatin, etc. The washing solution is PBST (phosphate buffered saline) or pure water.
The detection kit can be used for detecting the titer of the CDK3 antibody, and the detection accuracy is high.
The assay kit of one embodiment comprises the CDK3 antibody of the above embodiments. The test kit can be used to detect CDK 3.
It should be noted that the detection kit may further include other common reagents in the art, and the setting may be performed as needed, which is not described herein again.
The CDK3 antibody in the detection kit has high specificity and titer, can be used for detecting CDK3, and has high detection specificity and accuracy.
The following are specific examples:
in the following examples, unless otherwise specified, the experimental procedures without specifying the specific conditions are usually carried out according to conventional conditions, for example, the conditions described in the molecular cloning's Experimental guidelines [ M ] (Beijing: scientific Press, 1992) by Sammbruke, EF Friech, T Mannich, et al (decoded by gold winter goose, Rimeng maple, et al) or the procedures recommended by the manufacturers of the kits. The reagents used in the examples are all commercially available.
Example 1
Synthesis of polypeptides
According to the designed amino acid sequence, the polypeptide is synthesized by a solid phase synthesis method. Wherein the polypeptide with the amino acid sequence shown as SEQ ID No.1 is named as P1. The polypeptide with the amino acid sequence shown as SEQ ID No.2 is named as P2.
The process of the solid phase synthesis method specifically comprises the following steps: firstly, connecting the hydroxyl group of the hydroxyl terminal amino acid of the peptide chain to be synthesized with a solid phase carrier (namely insoluble high molecular resin) in a covalent bond structure, then taking the amino acid combined on the solid phase carrier as an amino component, removing an amino protecting group, reacting with an excessive activated carboxyl component (namely activated amino acid to be connected), lengthening the peptide chain, repeating the operation until the length of the peptide chain to be synthesized is reached, finally cracking the peptide chain from the resin, purifying and the like to obtain the polypeptide.
Wherein, the method for purifying the peptide chain after the resin cracking is RP-HPLC (reversed phase high performance liquid chromatography), and the purification conditions are as follows: the mobile phase A is a 0.1 percent TFA (trifluoroacetyl) aqueous solution by mass percent, and the mobile phase B is a 0.1 percent TFA acetonitrile solution by mass percent; the elution mode is gradient elution, namely elution is carried out within 30min by taking the volume ratio of the mobile phase A to the mobile phase B as 90:40 until the volume ratio of the mobile phase A to the mobile phase B is 40:90 and the flow rate is 1 mL/min; the temperature is room temperature (23 ℃); the detector is an ultraviolet detector, and the detection wavelength is 214 nm.
The purification method comprises the following specific steps: dissolving the peptide chain after the resin cracking in the mobile phase A, injecting 20-30 mg (or 2-2.5 mL) of sample, carrying out chromatography according to the purification conditions, collecting the main peak, and then freeze-drying to obtain the purified polypeptide.
And identifying the purity of the purified polypeptide by adopting a liquid chromatography-mass spectrometry (LC-MS), wherein the identification conditions are as follows: the mobile phase A is a 0.05 percent TFA (trifluoroacetyl) aqueous solution by mass, and the mobile phase B is a 0.1 percent TFA acetonitrile solution by mass; the elution mode is gradient elution, namely elution is carried out within 10min by taking the volume ratio of the mobile phase A to the mobile phase B as 90:10 until the volume ratio of the mobile phase A to the mobile phase B is 40:60 and the flow rate is 1 mL/min; the temperature is room temperature (23 ℃); the detector is an ultraviolet detector, and the detection wavelength is 214 nm; the mass spectrum is an atmospheric pressure electrospray (API-ESI) mass spectrum. The purity of each polypeptide after purification was identified to be higher than 90%. 10mg of each polypeptide was synthesized.
Example 2
Preparation of polypeptide conjugates
(1) Preparing a column bed: washing the column bed with pure water and coupling buffer solution; coupling buffer, i.e. AH solution, comprising Na2HPO4、NaH2PO4NaCl and EDTA, and pH of AH solution was 7.2.
(2) Preparation of polypeptide mixture: dissolving the polypeptide by using DMF, standing for 30min, adding AH solution and mixing when no particulate insoluble substances exist in the solution to obtain a polypeptide mixture, wherein the concentration of the polypeptide in the polypeptide mixture is 6 mg/mL. Wherein, the polypeptide is each of the polypeptides synthesized in example 1, and a polypeptide mixture of each of the polypeptides is obtained.
(3) The conjugated moiety was mixed with AH solution to give a first mixture, the final concentration of conjugated moiety in the first mixture was 10 mg/mL. Mixing the sulfol-SMCC with DMSO to obtain a second mixture, wherein the final concentration of the sulfol-SMCC in the second mixture is 100 mg/mL; the first mixture was mixed with the second mixture and reacted at room temperature for 4h, and separated with a chromatography column to give an intermediate. The coupling part is keyhole limpet hemocyanin.
(4) Adding the polypeptide mixture into the intermediate, uniformly mixing by using a vertical mixer, standing at room temperature for overnight reaction to obtain a polypeptide conjugate, and storing the polypeptide conjugate at-20 ℃. Wherein, in the mixture of the intermediate and the polypeptide mixture, the mass ratio of the polypeptide part, the coupling part and the Sulfo-SMCC is 10:10: 1.
The two polypeptides were prepared by the above method to obtain two polypeptide conjugates, which were named as P1-KLH and P2-KLH.
Example 3
Preparation of CDK3 antibody
1. The animals to be immunized are two rabbits, namely RB59731 New Zealand rabbit and RB59732 New Zealand rabbit.
2. P1-KLH and P2-KLH prepared in example 2 were mixed according to a mass ratio of 1:1 as antigens after mixing, two new zealand rabbits were immunized separately, the specific CDK3 antibody was prepared as follows:
(1) primary immunization: mixing the antigen and Freund's complete adjuvant at a volume ratio of 1:1, immunizing rabbit with 200 μ g/rabbit of antigen, and feeding for 15 days to obtain primary immunized rabbit. The immunization mode is intraperitoneal injection.
(2) And (3) secondary immunization: after the primary immunization, the antigen and Freund's incomplete adjuvant are mixed according to the volume ratio of 1:1 on the 15 th day, and the primary immunized rabbit is subjected to secondary immunization at the antigen dose of 100 mu g/rabbit and fed normally.
(3) Three times of immunization: and (3) normally feeding the twice-immunized rabbits by three times of immunization according to the operation of the step (2) at 29 days after the primary immunization. On day 35 after the primary immunization, three immunized rabbits were sampled with a blood collection amount of 5mL, and sera were collected for ELISA detection.
(4) Four immunizations: after the primary immunization, the three immunized rabbits were immunized four times on day 43 according to the procedure of step (2).
(4) Five immunizations: after the primary immunization, five immunizations were performed on the four immunized rabbits at day 57 according to the procedure of step (2). On day 69 after the primary immunization, five immunized rabbits were bled with a blood collection amount of 5mL, and sera were collected for ELISA detection. Sera from five immunizations of two rabbits were designated as primary (corresponding to RB59731 New Zealand rabbit) and secondary (RB59732 New Zealand rabbit) sera, respectively.
Example 4
ELISA was performed on the first serum and the second serum obtained in example 3, respectively
1. Positive serum: the first serum and the second serum obtained in example 3; negative sera (i.e. negative control): serum of rabbits prior to immunization; blank control: 2% by volume BSA in water. Serum samples were diluted individually at 1:1000, 1:2000, 1:4000, 1:8000, l:16000, 1:32000 for ELISA detection.
2. The required solution comprises coating solution, sealing solution and washing solution, wherein the coating solution is 50mM Na with pH9.62CO3(ii) a The washing liquid is pure water.
3. The ELISA detection process is as follows:
(1) dissolving P1 and P2 in the coating solution respectively to obtain two antigen solutions, wherein the concentration of the antigen in the antigen solutions is 2 mug/mL.
(2) mu.L of antigen solution was added to the corresponding wells and incubated overnight at 4 ℃. The liquid was emptied and the residual liquid was patted dry and the wash was rinsed 3 times.
(3) Add 200. mu.L of blocking solution to each well and incubate at 37 ℃ for 1 hour. And (3) emptying the liquid, draining the residual liquid, and washing the residual liquid for 3 times by using a washing solution to obtain the enzyme label plate coated with P1 and the enzyme label plate coated with P2.
(4) mu.L of primary antibody (i.e., serum after each dilution in step 1) was added to each well and incubated at 37 ℃ for 1 hour. The liquid was emptied and the residual liquid was patted dry and the wash was rinsed 3 times.
(5) mu.L of secondary antibody (1:10000 diluted secondary antibody against goat rabbit, purchased from Sigma) was added to each well and incubated at 37 ℃ for 1 hour. The liquid was emptied and the residual liquid was patted dry and the wash was rinsed 5 times.
(6) The residual liquid in the wells was dried, 100. mu.L of a developing solution (TMB) was added to each well, and the mixture was developed in the dark at 37 ℃ for 10 min. Add 50. mu.L of 2M H per well2SO4The color reaction was stopped and the absorbance (i.e., OD) at 450nm was immediately read. The results are shown in Table 1.
TABLE 1 results of ELISA
Example 5
Specificity verification
(1) HEK293T cells were cultured in 6-well plates (0FBS DMEM medium, 37 degrees, 5% CO)2) After the density is about 60 to 70 percent; using Invitrogen Lipo3000, the ratio of the volume (μ L) of Invitrogen Lipo3000 to the mass of plasmid (μ g) 1:1 ratio was transfected into the expression plasmid pCDH-CDK3 and pCMV6-entry-CDK2, respectively, in HEK293T, followed by culturing for an additional 36 h. Wherein, ORF (open reading frame) of CDK3 protein in pCDH-CDK3 expression plasmid is shown as SEQ ID No.3, namely: 5' -ATGGATATGTTCCAGAAGGTAGAGAAGATCGGAGAGGGCACCTATGGGGTGGTGTACAAGGCCAAGAACAGGGAGACAGGGCAGCTGGTGGCCCTGAAGAAGATCAGACTGGATTTGGAGATGGAGGGGGTCCCAAGCACTGCCATCAGGGAGATCTCGCTGCTCAAGGAACTGAAGCACCCCAACATCGTCCGACTGCTGGACGTGGTGCACAACGAGAGGAAGCTCTATCTGGTGTTTGAGTTCCTCAGCCAGGACCTGAAGAAGTACATGGACTCCACCCCAGGCTCAGAGCTCCCCCTGCACCTCATCAAGAGCTACCTCTTCCAGCTGCTGCAGGGGGTGAGTTTCTGCCACTCACATCGGGTCATCCACCGAGACCTGAAGCCCCAGAACCTGCTCATCAATGAGTTGGGTGCCATCAAGCTGGCTGACTTCGGCCTGGCTCGCGCCTTCGGGGTGCCCCTGCGCACCTACACCCATGAGGTGGTGACACTGTGGTATCGCGCCCCCGAGATTCTCTTGGGCAGCAAGTTCTATACCACAGCTGTGGATATCTGGAGCATTGGTTGCATCTTTGCAGAGATGGTGACTCGAAAAGCCCTGTTTCCTGGTGACTCTGAGATTGACCAGCTCTTTCGTATCTTTCGTATGCTGGGGACACCCAGCGAAGACACATGGCCCGGGGTCACCCAGCTGCCTGACTATAAGGGCAGCTTCCCTAAGTGGACCAGGAAGGGACTGGAAGAGATTGTGCCCAATCTGGAGCCAGAGGGCAGGGACCTGCTCATGCAACTCCTGCAGTATGACCCCAGCCAGCGGATCACAGCCAAGACTGCCCTGGCCCACCCGTACTTCTCATCCCCTGAGCCCTCCCCAGCTGCCCGCCAGTATGTGCTGCAGCGATTCCGCCATTGA-3'; the ORF of CDK2 protein in pCMV6-entry-CDK2 expression plasmid is shown in SEQ ID No.4, namely: 5'-ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAGAAACAAGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACTGAGACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGATCTCTCTGCTTAAGGAGCTTAACCATCCTAATATTGTCAAGCTGCTGGATGTCATTCACACAGAAAATAAACTCTACCTGGTTTTTGAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTCACTGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATTCTCATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACCCATGAGGTGGTGACCCTGTGGTACCGAGCTCCTGAAATCCTCCTGGGCTGCAAATATTATTCCACAGCTGTGGACATCTGGAGCCTGGGCTGCATCTTTGCTGAGATGGTGACTCGCCGGGCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGATCTTTCGGACTCTGGGGACCCCAGATGAGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTCCCCAAGTGGGCCCGGCAAGATTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTC-3' are provided.
(2) After 36h, cells were lysed using 1 × Laemlli lysis buffer and subjected to SDS-PAGE using a 10% polyacrilamide gel, which was then transferred to PVDF membrane.
(3) After 1 hour of 5% skim milk blocking, the primary serum prepared in example 3 was diluted with 5% skim milk at a volume ratio of 1:500 for 2 hours, and a secondary antibody (goat anti-rabbit secondary antibody) was diluted at 1:10000 to complete the subsequent steps of WesternBlot, and the results are shown in fig. 1.
As can be seen from FIG. 1, antibodies induced by a mixture of P1-KLH and P2-KLH as antigens specifically recognized CDK3 but not CDK 2.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Shenzhen university
<120> nucleic acid, polypeptide coupling composition, polypeptide composition, preparation method and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>22
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>1
Phe Pro Lys Trp Thr Arg Lys Gly Leu Glu Glu Ile Val Pro Asn Leu
1 5 10 15
Glu Pro Glu Gly Arg Asp
20
<210>2
<211>28
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>2
Tyr Asp Pro Ser Gln Arg Ile Thr Ala Lys Thr Ala Leu Ala His Pro
1 5 10 15
Tyr Phe Ser Ser Pro Glu Pro Ser Pro Ala Ala Arg
20 25
<210>3
<211>918
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atggatatgt tccagaaggt agagaagatc ggagagggca cctatggggt ggtgtacaag 60
gccaagaaca gggagacagg gcagctggtg gccctgaaga agatcagact ggatttggag 120
atggaggggg tcccaagcac tgccatcagg gagatctcgc tgctcaagga actgaagcac 180
cccaacatcg tccgactgct ggacgtggtg cacaacgagaggaagctcta tctggtgttt 240
gagttcctca gccaggacct gaagaagtac atggactcca ccccaggctc agagctcccc 300
ctgcacctca tcaagagcta cctcttccag ctgctgcagg gggtgagttt ctgccactca 360
catcgggtca tccaccgaga cctgaagccc cagaacctgc tcatcaatga gttgggtgcc 420
atcaagctgg ctgacttcgg cctggctcgc gccttcgggg tgcccctgcg cacctacacc 480
catgaggtgg tgacactgtg gtatcgcgcc cccgagattc tcttgggcag caagttctat 540
accacagctg tggatatctg gagcattggt tgcatctttg cagagatggt gactcgaaaa 600
gccctgtttc ctggtgactc tgagattgac cagctctttc gtatctttcg tatgctgggg 660
acacccagcg aagacacatg gcccggggtc acccagctgc ctgactataa gggcagcttc 720
cctaagtgga ccaggaaggg actggaagag attgtgccca atctggagcc agagggcagg 780
gacctgctca tgcaactcct gcagtatgac cccagccagc ggatcacagc caagactgcc 840
ctggcccacc cgtacttctc atcccctgag ccctccccag ctgcccgcca gtatgtgctg 900
cagcgattcc gccattga 918
<210>4
<211>894
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
atggagaact tccaaaaggt ggaaaagatc ggagagggca cgtacggagt tgtgtacaaa 60
gccagaaaca agttgacggg agaggtggtg gcgcttaaga aaatccgcct ggacactgag 120
actgagggtg tgcccagtac tgccatccga gagatctctc tgcttaagga gcttaaccat 180
cctaatattg tcaagctgct ggatgtcatt cacacagaaa ataaactcta cctggttttt 240
gaatttctgc accaagatct caagaaattc atggatgcct ctgctctcac tggcattcct 300
cttcccctca tcaagagcta tctgttccag ctgctccagg gcctagcttt ctgccattct 360
catcgggtcc tccaccgaga ccttaaacct cagaatctgc ttattaacac agagggggcc 420
atcaagctag cagactttgg actagccaga gcttttggag tccctgttcg tacttacacc 480
catgaggtgg tgaccctgtg gtaccgagct cctgaaatcc tcctgggctg caaatattat 540
tccacagctg tggacatctg gagcctgggc tgcatctttg ctgagatggt gactcgccgg 600
gccctattcc ctggagattc tgagattgac cagctcttcc ggatctttcg gactctgggg 660
accccagatg aggtggtgtg gccaggagtt acttctatgc ctgattacaa gccaagtttc 720
cccaagtggg cccggcaaga ttttagtaaa gttgtacctc ccctggatga agatggacgg 780
agcttgttat cgcaaatgct gcactacgac cctaacaagc ggatttcggc caaggcagcc 840
ctggctcacc ctttcttcca ggatgtgacc aagccagtac cccatcttcg actc 894
Claims (10)
1. A polypeptide composition, characterized in that the polypeptide composition comprises a polypeptide with an amino acid sequence shown as SEQ ID No.1 and a polypeptide with an amino acid sequence shown as SEQ ID No. 2.
2. The polypeptide composition of claim 1, wherein the carboxy-terminus of the polypeptide is amidated.
3. A method for preparing a polypeptide composition, comprising the steps of: the polypeptide with the amino acid sequence shown as SEQ ID No.1 and the polypeptide with the amino acid sequence shown as SEQ ID No.2 are prepared by a polypeptide solid phase synthesis method or a genetic engineering technology.
4. A nucleic acid comprising a coding sequence for a polypeptide having an amino acid sequence as shown in SEQ ID No.1 or a coding sequence for a polypeptide having an amino acid sequence as shown in SEQ ID No. 2.
5. A polypeptide conjugate composition comprising two polypeptide conjugates, both polypeptide conjugates comprising a polypeptide portion, one polypeptide portion of said polypeptide conjugate comprising a polypeptide having an amino acid sequence as shown in SEQ ID No.1 and the other polypeptide portion of said polypeptide conjugate comprising a polypeptide having an amino acid sequence as shown in SEQ ID No. 2.
6. The polypeptide conjugate composition of claim 5, wherein both polypeptide conjugates comprise a conjugate moiety linked to a polypeptide moiety, wherein the conjugate moiety is selected from at least one of hemocyanin, ovalbumin, and bovine serum albumin.
7. A method of making a CDK3 antibody, comprising the steps of:
immunizing an animal with an antigen, said antigen being a polypeptide composition according to any one of claims 1 to 2 or a polypeptide conjugate composition according to any one of claims 5 to 6, and collecting serum from said immunized animal to obtain CDK3 antibodies.
8. A CDK3 antibody prepared by the method of claim 7 for preparing CDK3 antibody.
9. Use of the polypeptide composition of any one of claims 1 to 2, the polypeptide conjugate composition of any one of claims 5 to 6 or the CDK3 antibody of claim 8 in the preparation of a test agent, a test kit or a test device.
10. A test kit, comprising: the polypeptide composition of any one of claims 1 to 2, the polypeptide conjugate composition of any one of claims 4 to 5 or the CDK3 antibody of claim 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010199230.0A CN111349624A (en) | 2020-03-20 | 2020-03-20 | Nucleic acid, polypeptide coupling composition, polypeptide composition and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010199230.0A CN111349624A (en) | 2020-03-20 | 2020-03-20 | Nucleic acid, polypeptide coupling composition, polypeptide composition and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111349624A true CN111349624A (en) | 2020-06-30 |
Family
ID=71192995
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010199230.0A Pending CN111349624A (en) | 2020-03-20 | 2020-03-20 | Nucleic acid, polypeptide coupling composition, polypeptide composition and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111349624A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008079933A2 (en) * | 2006-12-22 | 2008-07-03 | Novartis Ag | Heteroaryl-heteroaryl compounds as cdk inhibitors for the treatment of cancer, inflammation and viral infections |
| CN107271675A (en) * | 2017-03-24 | 2017-10-20 | 郑猛 | Anti-human ADRB3 monoclonal antibodies and its application in medical diagnosis on disease and treatment |
-
2020
- 2020-03-20 CN CN202010199230.0A patent/CN111349624A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008079933A2 (en) * | 2006-12-22 | 2008-07-03 | Novartis Ag | Heteroaryl-heteroaryl compounds as cdk inhibitors for the treatment of cancer, inflammation and viral infections |
| CN107271675A (en) * | 2017-03-24 | 2017-10-20 | 郑猛 | Anti-human ADRB3 monoclonal antibodies and its application in medical diagnosis on disease and treatment |
Non-Patent Citations (3)
| Title |
|---|
| ABNOVA: "CDK3 monoclonal antibody (M01), clone 3C12", 《ABNOVA》 * |
| ZHANG Y ET AL.: "NP_001249.1", 《GENBANK》 * |
| ZONGLIN ZHANG ET AL.: "HuR promotes breast cancer cell proliferation and survival via binding to CDK3 mRNA", 《BIOMEDICINE & PHARMACOTHERAPY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Trier et al. | Production and characterization of peptide antibodies | |
| CN110713522B (en) | Use of extracellular domain of low pH insertion peptide as antigen | |
| JPS61289099A (en) | Polypeptide and its derivative | |
| EP2075336B1 (en) | Purification of recombinant proteins fused to multiple epitopes | |
| KR101340649B1 (en) | Screening method of Human Papillomavirus antibody using fusion polypeptide HPV antigen | |
| KR20130136016A (en) | Screening kit for human papillomavirus antibody using fusion polypeptide hpv antigen | |
| CN111349624A (en) | Nucleic acid, polypeptide coupling composition, polypeptide composition and preparation method and application thereof | |
| CN110904059A (en) | Anthocyanin synthetase epitope peptide, antibody and application thereof | |
| US20110028409A1 (en) | Detection of anti-ribosomal p protein antibodies by means of synthetic peptides | |
| ES2355265T3 (en) | A KIT FOR IMMUNE DETECTION OF NUROGLOBULIN LINKED TO ENZYME AND USE OF THE SAME. | |
| CN111647049B (en) | Polypeptide and polypeptide conjugate as well as preparation method and application thereof | |
| WO2023141360A2 (en) | Anti-b7-h3 compounds and methods of use | |
| CN114409777B (en) | Specific nano antibody Nb3.27 of colorectal cancer related bacteroides fragilis toxin protein activator and application thereof | |
| CN104812773B (en) | Epitope tag antibody, hybridoma cell strain with and application thereof | |
| CN113621079B (en) | Fusion protein of Fab antibody and calf intestinal alkaline phosphatase and preparation method thereof | |
| CN110468108B (en) | Hybridoma cell strain secreting human ferritin light chain monoclonal antibody and application thereof | |
| CN114057861A (en) | Bio-PROTAC artificial protein targeting UBE2C | |
| Beutel et al. | Bind&Bite: Covalently stabilized heterodimeric coiled-coil peptides for the site-selective, cysteine-free chemical modification of proteins | |
| CN107629112B (en) | High-affinity LC3 protein targeting peptide and application thereof | |
| KR101227434B1 (en) | Peptides targeting the cd44 protein as a biomarker for breast cancer stem cell and uses thereof | |
| CN114524864B (en) | SARS-CoV-2 related polypeptide | |
| CN111072772B (en) | Peptide tag and application thereof in detection or purification of fusion protein | |
| CN109706160A (en) | Recombinant human protein's kinases Nek2 Protein expression and purification method | |
| CN110054676B (en) | Immunogenic polypeptide, anti-TTC 36 antibody AP3-5 and application | |
| JP2925479B2 (en) | Drug for detecting small cell lung cancer and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200630 |
|
| RJ01 | Rejection of invention patent application after publication |