CN111349576A

CN111349576A - Pichia pastoris engineering bacteria for constitutive expression of porcine pepsinogen A and application thereof

Info

Publication number: CN111349576A
Application number: CN201811566097.7A
Authority: CN
Inventors: 金渭武; 陈博; 郑晓卫; 安泰; 王博; 焦琳
Original assignee: Cofco Biotechnology Beijing Co ltd; Cofco Nutrition and Health Research Institute Co Ltd
Current assignee: Cofco Biotechnology Beijing Co ltd; Cofco Nutrition and Health Research Institute Co Ltd
Priority date: 2018-12-20
Filing date: 2018-12-20
Publication date: 2020-06-30
Anticipated expiration: 2038-12-20
Also published as: CN111349576B

Abstract

The inventionThe invention discloses a pichia pastoris engineering strain for constitutive expression of porcine pepsinogen A (PGA). in the invention, an artificially modified PGA gene is connected to a pichia pastoris constitutive expression vector pGAPZ α A and is introduced into a pichia pastoris GS115 strain, the pichia pastoris strain GS115-pGAPZ α A-PGA capable of efficiently and constitutively secreting and expressing the PGA without induction is obtained through screening and identification, the strain secretes and expresses the porcine pepsinogen A in a culture medium YPD, and the enzyme activity is 200 U.mL after 48 hours of culture^‑1The constitutive high expression of the porcine pepsinogen A in the pichia pastoris is realized, and the efficient continuous production of the porcine pepsinogen A can be realized through the optimization of a culture medium and culture conditions in the later period. The pig pepsinogen A can be automatically activated under an acidic condition (pH5.0) to generate active pepsin, can be widely applied to industries such as feed, food, medicine and the like, and has good commercial application prospect.

Description

Pichia pastoris engineering bacteria for constitutive expression of porcine pepsinogen A and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a pichia pastoris engineering bacterium for constitutive expression of porcine pepsinogen A and application thereof.

Background

Pepsin is one of proteases, and is widely applied to various fields such as medicines, foods, light industry, biotechnology and the like. At present, the pepsin mainly comes from the stomach tissues of animals (such as cattle, sheep, pigs and the like), but animal-derived pepsin has more problems, such as easy restriction of animal organ resources; the pepsin has small yield, high price, low enzyme activity and unstable quality; harmful chemical residues, such as toxic and harmful factors of animal tissues, are easily generated. Therefore, the above factors limit the widespread use of pepsin. The method is an effective method for solving the bottleneck of the prior application of the pepsin, can greatly reduce the cost through large-scale fermentation production, has little residue of purified enzyme products and high purity, and has the advantages of environmental protection, no limitation of raw materials and the like. However, there are still few engineering bacteria that can efficiently express active pepsin, and there are few commercially available recombinant pepsins.

Pepsinogen is a precursor of pepsin and can generate active pepsin by autocatalytic reaction under acidic condition (pH 5). At present, the construction of genetic engineering bacteria aiming at precursor pepsinogen is an effective method for industrially obtaining pepsin. At present, the engineering strain of the recombinant porcine pepsinogen A is researched more, and pichia pastoris and escherichia coli are mainly used as hosts. The different hosts capable of expressing the porcine pepsinogen A are comprehensively compared, and the protein expressed by the pichia pastoris is easy to purify and high in yield, so that the pichia pastoris is widely researched and used at present. The expression of heterologous proteins in pichia pastoris usually adopts a methanol induction mode, so that the growth phase and the production phase of strains can be separated, the large-scale growth of thalli is realized in the early stage, and the high-efficiency expression of proteins is realized in the later stage. However, there are many disadvantages in the production of the inducible recombinant strain, such as the methanol is volatile and toxic, and is easy to cause safety and environmental problems. In addition, when the method is applied to the food and medicine industries, the methanol residue is avoided to the utmost extent.

Therefore, how to avoid the use of methanol and improve the yield of the porcine pepsinogen A (namely enzyme activity) is a problem which needs to be solved at present.

Disclosure of Invention

In order to solve the problems, the invention provides a pichia pastoris engineering bacterium for constitutive expression of porcine pepsinogen A (PGA), which realizes constitutive expression of the porcine pepsinogen A in pichia pastoris by using a constitutive expression vector, does not need methanol induction, realizes safer and more effective production of the porcine pepsinogen A, and simultaneously improves the yield of the porcine pepsinogen A.

On one hand, the invention provides a Pichia pastoris engineering strain for constitutive expression of porcine pepsinogen A, wherein the Pichia pastoris GS115(Pichia pastoris GS115) is used as a host, and pGAPZ α A is used as a vector for expressing the porcine pepsinogen A.

Wherein the amino acid sequence of the porcine pepsinogen A is shown in SEQ ID No. 2.

On the other hand, the invention provides a method for constructing the pichia pastoris engineering bacteria for constitutive expression of the porcine pepsinogen A, and the method comprises the following steps:

(1) artificially synthesizing a polynucleotide sequence for coding the porcine pepsinogen A;

(2) connecting the polynucleotide sequence for coding the porcine pepsinogen A obtained in the step (1) to a pichia pastoris constitutive expression vector pGAPZ α A to obtain a recombinant plasmid pGAPZ α A-PGA;

(3) and (3) introducing the recombinant plasmid pGAPZ α A-PGA obtained in the step (2) into Pichia pastoris GS115 to obtain the Pichia pastoris engineering bacteria.

In another aspect, the invention provides a method for producing porcine pepsinogen A, which comprises fermenting the pichia pastoris engineering bacteria or the pichia pastoris engineering bacteria constructed by the method, so as to obtain the porcine pepsinogen A.

On the other hand, the invention also provides the pig pepsinogen A produced by the pichia pastoris engineering bacteria or the pichia pastoris engineering bacteria constructed by the method or produced by the method and the activated pig pepsinogen A thereof. The amino acid sequence of the porcine pepsinogen A is shown by SEQ ID No. 2. The pig pepsinogen A can be activated under an acidic condition (pH 5) to obtain active pig pepsin A. The activity of the porcine pepsin A is consistent with that of porcine pepsin of animal origin, but the porcine pepsin A does not contain risk factors of the porcine pepsin of animal origin.

In another aspect, the invention provides the application of the pichia pastoris engineering bacteria or the pichia pastoris engineering bacteria constructed by the method in the aspects of food, feed or medicine. The invention also provides the application of the porcine pepsinogen A and the porcine pepsin A obtained by activating the porcine pepsinogen A in the aspects of food, feed or medicine.

The invention has the beneficial effects that:

the Pichia pastoris engineering bacteria (also called Pichia pastoris GS115-pGAPZ α A-PGA) for constitutive expression of the porcine pepsinogen A realizes high constitutive expression of the porcine pepsinogen A in Pichia pastoris, and the enzyme activity can reach 200U ∙ mL after continuous culture of 48h in a minimal medium^-1Lays a foundation for the constitutive production of the porcine pepsin and has good industrial application prospect. The porcine pepsinogen A can be subjected to autocatalytic reaction under acidic conditions to generate active pepsin A, can be widely applied to industries such as food, feed, medicine and the like, and has good commercial application prospect.

Drawings

FIG. 1 is a plasmid map of pGAPZ α A-PGA.

FIG. 2 shows the restriction enzyme digestion results of pGAPZ α A-PGA plasmid construction, wherein lane 1 is pGAPZ α A, lane 2 is pGAPZ α A-PGA, and lane 3 is the product of pGAPZ α A-PGA subjected to double restriction with EcoR I and Not I.

FIG. 3 shows the SDS-PAGE analysis of porcine pepsinogen A, wherein

lanes

1 and 2 are the supernatants of the fermentation broths from Pichia pastoris GS115-pGAPZ α A-PGA fermented for 48h and 24h, respectively.

FIG. 4 is an artificially synthesized polynucleotide sequence (SEQ ID No.:1) encoding porcine pepsinogen A.

FIG. 5 is the amino acid sequence of porcine pepsinogen A of the present invention (SEQ ID No.: 2).

Detailed Description

The invention obtains a Pichia pastoris engineering bacterium Pichia pastoris GS115-pGAPZ α A-PGA for constitutive expression of porcine pepsinogen A (PGA) by connecting a polynucleotide sequence which is artificially synthesized and is preferred by Pichia pastoris codon and codes the porcine pepsinogen A (PGA) into a constitutive vector pPGAPZ α A and introducing the polynucleotide sequence into Pichia pastoris GS115(Pichia pastoris GS115), and the Pichia pastoris engineering bacterium is used for fermentation and can produce enzyme activity as high as 200 U.mL without methanol induction^-1Porcine pepsinogen a.

In one embodiment, the invention provides a Pichia pastoris engineering bacterium (Pichia pastoris GS115-pGAPZ α A-PGA) for compositionally expressing porcine pepsinogen A, wherein the Pichia pastoris engineering bacterium takes Pichia pastoris GS115(Pichia pastoris GS115) as a host and pGAPZ α A as a vector to express porcine pepsinogen A (PGA).

Wherein the amino acid sequence of the porcine pepsinogen A is shown in SEQ ID No. 2. The nucleotide sequence encoding porcine pepsinogen A was optimized based on the yeast preferred codons. In a preferred embodiment, the polynucleotide sequence encoding porcine pepsinogen A is represented by SEQ ID No. 1.

In one embodiment, the invention provides a method for constructing the pichia pastoris engineered bacterium constitutively expressing porcine pepsinogen a of the invention, comprising the following steps:

(2) connecting the polynucleotide sequence of the porcine pepsinogen A obtained in the step (1) to a pichia pastoris constitutive expression vector pGAPZ α A to obtain a recombinant plasmid pGAPZ α A-PGA;

Wherein the amino acid sequence of the porcine pepsinogen A is shown as SEQ ID No. 2.

In a preferred embodiment, in step 1), the polynucleotide sequence encoding porcine pepsinogen a is represented by SEQ ID No. 1.

In a preferred embodiment, in step (2), the polynucleotide sequence encoding porcine pepsinogen A is ligated to the pGAPZ α A vector using various methods known to those skilled in the art, such as blunt end ligation, sticky end ligation.

In the present invention, the pGAPZ α a vector is commercially available, for example from Invitrogen.

In a preferred embodiment, in step (3), the recombinant plasmid pGAPZ α A-PGA may be introduced into Pichia pastoris GS115 using various yeast transformation methods known to those skilled in the art, such as chemical transformation methods, electrical transformation methods.

In a preferred embodiment, in the step (3), the method further comprises screening and identifying the pichia pastoris engineering bacteria obtained after transformation. The selection method may be any method for selecting transformants well known to those skilled in the art, for example, by antibiotic resistance selection such as Zeocin positive selection. The identification method may be any of various methods for identifying transformants well known to those skilled in the art, such as detecting the nucleotide sequence of porcine pepsinogen a contained in the genome, e.g., performing PCR analysis; or detecting the expression of porcine pepsinogen a, e.g. by western blotting.

In another embodiment, the present invention provides a method for producing porcine pepsinogen a, which comprises fermenting the pichia pastoris engineered bacteria of the present invention or the pichia pastoris engineered bacteria constructed by the method of the present invention, thereby obtaining the porcine pepsinogen a.

It should be noted that the fermentation conditions are only suitable for the fermentation conditions of pichia pastoris GS115, and those skilled in the art can modify or optimize the culture conditions and the culture medium according to actual needs, and the modifications and/or optimization are also within the scope of the present invention.

In a preferred embodiment, the pichia pastoris engineering bacteria of the invention are inoculated into a fermentation medium and fermented under suitable fermentation conditions, for example, at a culture temperature of 28 ℃ to 30 ℃, preferably 30 ℃; the rotation speed is 150-250rpm, preferably 220 rpm; the culture medium is any medium or culture solution known in the art suitable for culturing pichia pastoris, such as YPD common medium; the incubation time is 24-72 hours, preferably 48 hours, in succession. In a further preferred embodiment, the pichia pastoris engineered bacteria of the invention are activated prior to inoculation.

The porcine pepsinogen A of the present invention can be autocatalytically reacted under acidic conditions (e.g., pH 5) to produce active porcine pepsin A. The activity of the pig pepsin A is consistent with that of the animal-derived pig pepsin A, but the pig pepsin A does not contain risk factors contained in the animal-derived pig protease, can be widely applied to industries such as food, feed, medicine and the like as commercial recombinant pepsin, and has good commercial prospect.

In one embodiment, the invention provides the pichia pastoris engineering bacteria or the pichia pastoris engineering bacteria constructed by the method, the porcine pepsinogen A produced by the pichia pastoris engineering bacteria and the application of the porcine pepsin A obtained by activating the porcine pepsinogen A in the aspects of food, feed or medicine.

Examples

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, but the scope of the present invention is not limited thereto. The experimental methods and equipment described in the following examples are conventional methods and conventional experimental equipment unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified.

Reagents used in examples:

YPD liquid medium: tryptone 20 g.L^-1Yeast powder 10 g.L^-1Glucose 20 g.L^-1；

YPDS plates: tryptone 20 g.L^-1Yeast powder 10 g.L^-1Glucose 20 g.L^-1Agar 1.8 g. L^-1，200ug·mL^-1Zeocin。

0.05mol/L lactic acid buffer solution: uniformly mixing the solution A, the solution B and distilled water in a volume ratio of 8:1:9, wherein the solution A: weighing 10.6g of 80-90% lactic acid, and fixing the volume to 1000mL by using water; and liquid B, weighing 16g of 70% sodium lactate, and dissolving with distilled water to a constant volume of 1000 mL.

Example 1 construction and identification of recombinant bacteria

The method comprises the steps of optimizing porcine pepsinogen A genes (NCBI, NM-213873) based on yeast preferred codons to obtain a polynucleotide sequence SEQ ID NO. 1, artificially synthesizing the polynucleotide sequence shown in the SEQ ID NO. 1 by biological engineering Limited, cloning the nucleotide sequence between EcoR I and Not I enzyme cutting sites on an expression vector pGAPZ α A (Invitrogen) according to the instruction provided by the Invitrogen company to obtain a recombinant plasmid pGAPZ α A-PGA (the plasmid map is shown in figure 1), carrying out enzyme cutting on the recombinant plasmid by using the EcoR I and Not I enzymes, carrying out electrophoresis on 1 wt% agar gel containing EB, and displaying that the size of the inserted gene sequence is correct (figure 2).

Then, the recombinant vector pGAPZ α A-PGA was introduced into Pichia pastoris GS115 strain (Invitrogen corporation) by using an electrical transformation method, and the specific steps were as follows:

1) preparation of yeast competent cells: selecting a single colony of Pichia pastoris GS115 to inoculate in 25mL YPD liquid culture medium, and shaking-culturing overnight in a shaking table at 30 ℃ and 220 rpm; transferred to 50mL YPD liquid medium at an inoculum size of 5 v/v%, and shake-cultured at 30 ℃ and 220rpm until OD₆₀₀1.3-1.5; centrifuging the fermentation liquor at 4 deg.C and 5000rpm for 5min, removing supernatant, and collecting thallus; resuspending the thallus with 50mL of ice-precooled sterile water, centrifuging at 4 ℃ and 5000rpm for 5min, discarding the supernatant, and collecting the thallus; resuspending the thallus with 25mL of ice-precooled sterile water, centrifuging at 4 ℃ and 5000rpm for 5min, discarding the supernatant, and collecting the thallus; 5mL of 1 mol. L was again used^-1Washing thallus with ice-precooled sorbitol for 1 time, resuspending, centrifuging at 4 ℃ and 5000rpm for 5min, and discarding the supernatant; 0.4mL of 1 mol. L was added^-1Resuspending the ice-precooled sorbitol; 80 μ L of each tube was dispensed into sterile EP tubes for transformation;

2) transformation of recombinant expression vector pGAPZ α A-PGA (extracted with a plasmid miniprep kit from TIANGEN) linearized with Avr II enzyme (NEB Co.), addition of 5. mu.g of plasmid linearized with Avr II enzyme to the above 80. mu.L of yeast competent cells, standing on ice for 15 minutes, rapid addition of 0.2cm cuvette (ice-precooled), 1500V shocking, rapid addition of 1mL of ice-precooled sorbitol, spreading on a layer containing 200 ug. mL of sorbitol^-1Positive monoclonals were picked up by culturing on YPDS plates from Zeocin (Invitrogen) at 30 ℃ for 3 to 4 days.

The selected monoclonal is cultured in 5mL YPD liquid medium by shaking at 30 ℃ and 220rpm overnight, the genome of the positive monoclonal thallus is extracted by a yeast genome miniprep kit (TIANGEN company) and PCR analysis is carried out by using the genome as a template according to the instruction (primer 1, α -Factor:5' TACTATTGCCAGCATTGCTGC 3' (SEQ ID NO: 3), primer 2, 3' AOX 5' GGCAAATGGCATTCTGACAT3' (SEQ ID NO: 4), PCR program: 95 ℃ 5min, 95 ℃ 30s, 58 ℃ 40s, 72 ℃ 1min, 30 cycles, 72 ℃ 7min), the PCR product is electrophoresed on 1 wt% agar gel containing EB, the target band (about 1500bp) is recovered and sent to bioengineering biotechnology limited company for sequence measurement, and the recombinant Pichia torula pasz 115-pGAPZ α A-PGA zymogen containing pig pepsin A genes is obtained by screening and identification.

Example 2 production of porcine pepsinogen A Using the Pichia engineering bacteria of example 1

The Pichia pastoris GS115-pGAPZ α A-PGA constructed in the embodiment 1 is used for fermentation production of porcine pepsinogen A, and the enzyme activity is measured.

The pichia pastoris engineering bacteria are streaked in a YPD flat plate, are subjected to static culture at 30 ℃ for 48 hours, single clones are selected and inoculated into a test tube containing 5mL of YPD liquid culture medium to be cultured at 30 ℃ and 220rpm for 6 hours, then all the bacteria are transferred into 50mL of YPD liquid culture medium to be continuously cultured at 30 ℃ and 220rpm for 24 hours and 48 hours, fermentation liquor of 24 hours and 48 hours is respectively taken and centrifuged at 8000rpm for 5 minutes, supernatant (extracellular PGA is contained in the extracellular PGA) is taken to be subjected to SDS-PAGE analysis, SDS-PAGE precast gel electrophoresis of Jinsrie Biotechnology company Limited is selected, the specific operation method follows a product instruction, samples of 24 hours and 48 hours are mixed with 6 × sample buffer solution according to the volume ratio of 5:1, boiling water bath is carried out for 10 minutes, the samples are taken after cooling, electrophoresis is carried out at 80V photographic voltage, after an indicator enters separation gel, the voltage is adjusted to 120V, the electrophoresis is finished when the indicator reaches the bottom of the gel, the gel is stained by using Coomassie brilliant blue liquid, and the decolorizing and the gel is decolorized.

As shown in FIG. 3, a protein band at about 40kD was observed after 24 hours of continuous culture without methanol, which is close to the theoretical molecular weight of porcine pepsinogen A and has no other impurity bands, indicating that the impurities are less and no further purification is required; when the continuous culture is carried out for 48 hours without adding methanol, the protein content is obviously increased, and the result shows that the pichia pastoris engineering bacteria realize the constitutive high-level expression of the porcine pepsinogen A.

Meanwhile, the enzyme activity of extracellular PGA in the supernatant of the fermentation broth was measured. Definition of unit enzyme activity: hydrolysis of casein at a temperature (40 ℃. + -. 0.2 ℃) and corresponding pH conditions (pH3.0) within 1min produced an amount of enzyme corresponding to 1. mu.g of phenolic amino acid (expressed as tyrosine equivalent), expressed as U, of 1 enzyme activity unit. The spectrophotometry is adopted for determination, and the specific steps are as follows:

centrifuging the fermentation liquor at 8000rpm for 5min, diluting the supernatant of the fermentation liquor by 50 times, and performing enzyme activity detection, wherein the specific detection is as follows:

taking 5mL of 1% casein solution (prepared by 0.05mol/L lactic acid buffer solution, pH3.0), placing in 40 + -0.2 deg.C constant temperature water bath, and preheating for 5 min;

then, 4 tubes with plugs were taken and 1mL of 50-fold diluted fermentation supernatant was added to each tube. Taking one tube as a blank tube, adding 2mL of trichloroacetic acid, taking the other 3 tubes as test tubes, respectively adding 1mL of preheated casein solution, shaking up, and keeping the temperature at 40 ℃ for 10 min;

taking out the test tubes, adding 2mL of trichloroacetic acid into each of 3 test tubes, and adding 1mL of preheated casein solution into a blank tube;

standing for 10min, filtering to obtain precipitate, and adding 0.4mol/L Na into each 1mL filtrate₂CO₃5mL, and 1mL of forrine reagent. Color development was carried out at 40 ℃ for 20 min. OD was measured at 680nm using a spectrophotometer and zeroed with a blank tube.

Calculating the activity of the crude enzyme solution, the activity of the protease is A × K × 4/10 × n U/g (mL)

A: average OD values for parallel testing of samples; k: a light absorption constant;

4: the total volume of the reaction reagents; 10: carrying out enzymolysis reaction time; n: total dilution multiple of enzyme solution

The result shows that the Pichia pastoris GS115-pGAPZ α A-PGA is cultured continuously for 48 hours in a shake flask without adding methanol, and the enzyme activity of the obtained pig pepsinogen A is 200 U.mL^-1. The yield is the initial yield in a minimal medium YPD, and the yield is excellent after the optimization of the medium and the culture conditionsAfter the digestion, the efficient continuous industrial production of the porcine pepsinogen A is extremely potential, and the method has good industrial application prospect.

Example 3: example 2 activation of porcine pepsinogen A produced

The enzyme activity of pepsinogen A produced in example 2 was measured under different pH conditions (see Table 1), and the results are shown in Table 2 below. The same procedure as in example 2 was followed except that the fermentation supernatant was diluted (50-fold) with the following buffer and a 1% casein solution was prepared in place of the 0.05mol/L lactic acid buffer solution. Different pH conditions were achieved with different ratios of 0.2M disodium hydrogen phosphate to 0.1M citric acid buffer, the specific ratios are shown in Table 1.

TABLE 1 different pH (20mL buffer system)

pH	0.2M disodium hydrogen phosphate (mL)	0.1M citric acid buffer (mL)
			pH3.0	4.11	15.89
pH3.4	5.70	14.30
			pH4.0	7.71	12.29
pH4.4	8.82	11.18
			pH5.0	10.30	9.70
pH5.4	11.15	8.85

As shown in Table 2, the enzyme activity can be detected under the pH condition of below pH5, which indicates that the porcine pepsinogen A produced by the Pichia pastoris engineering bacteria can be subjected to autocatalytic reaction under the acidic condition of below pH5 to generate the active pepsin A.

TABLE 2 results of enzyme activity measurement of pepsinogen A produced in example 2 under different pH conditions

pH	Enzyme activity (U/mL)
		pH3.0	180.2
pH3.4	80.5
		pH4.0	50.5
pH4.4	10.2
		pH5.0	8.1
pH5.4	0.0

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Zhongliang Biotechnology (Beijing) Ltd

COFCO NUTRITION AND HEALTH RESEARCH INSTITUTE Co.,Ltd.

<120> pichia pastoris engineering bacteria for constitutive expression of porcine pepsinogen A and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1037

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gaattcaagt ggctactgct gctcagcttg gtggtgctct ccgagtgcat cggtgacgaa 60

ccattggaaa actacttgga caccgaatac ttcggtacca tcggtatcgg taccccagct 120

caagacttca ccgttatctt cgacaccggt tcttctaact tgtgggttcc atctgtttac 180

tgttcttctt tggcttgttc tgaccacaac caattcaacc cagacgactc ttctaccttc 240

gaagctacct ctcaagaatt gtctatcacc tacggtaccg gttctatgac cggtatcttg 300

ggttacgaca ccgttcaagt tggtggtatc tctgacacca accaaatctt cggtttgtct 360

gaaaccgaac caggttcttt cttgtactac gctccattcg acggtatctt gggtttggct 420

tacccatcta tctctgcttc tggtgctacc ccagttttcg acaacttgtg ggaccaaggt 480

ttggtttctc aagacttgtt ctctgtttac ttgtcttcta acgacgactc tggttctgtt 540

gttttgttgg gtggtatcga ctcttcttac tacaccggtt ctttgaactg ggttccagtt 600

tctgttgaag gttactggca aatcaccttg gactctatca ccatggacgg tgaaaccatc 660

gcttgttctg gtggttgtca agctatcgtt gacaccggta cctctttgtt gaccggtcca 720

acctctgcta tcgctaacat ccaatctgac atcggtgctt ctgaaaactc tgacggtgaa 780

atggttatct cttgttcttc tatcgactct ttgccagaca tcgttttcac catcaacggt 840

gttcaatacc cattgtctcc atctgcttac atcttgcaag acgacgactc ttgtacctct 900

ggtttcgaag gtatggacgt tccaacctct tctggtgaat tgtggatctt gggtgacgtt 960

ttcatcagac aatactacac cgttttcgac agagctaaca acaaggttgg tttggctcca 1020

gttgcttaag cggccgc 1037

<210>2

<211>342

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Glu Phe Lys Trp Leu Leu Leu Leu Ser Leu Val Val Leu Ser Glu Cys

1 5 10 15

Ile Gly Asp Glu Pro Leu Glu Asn Tyr Leu Asp Thr Glu Tyr Phe Gly

20 25 30

Thr Ile Gly Ile Gly Thr Pro Ala Gln Asp Phe Thr Val Ile Phe Asp

35 40 45

Thr Gly Ser Ser Asn Leu Trp Val Pro Ser Val Tyr Cys Ser Ser Leu

50 55 60

Ala Cys Ser Asp His Asn Gln Phe Asn Pro Asp Asp Ser Ser Thr Phe

65 70 75 80

Glu Ala Thr Ser Gln Glu Leu Ser Ile Thr Tyr Gly Thr Gly Ser Met

85 90 95

Thr Gly Ile Leu Gly Tyr Asp Thr Val Gln Val Gly Gly Ile Ser Asp

100 105 110

Thr Asn Gln Ile Phe Gly Leu Ser Glu Thr Glu Pro Gly Ser Phe Leu

115 120 125

Tyr Tyr Ala Pro Phe Asp Gly Ile Leu Gly Leu Ala Tyr Pro Ser Ile

130 135 140

Ser Ala Ser Gly Ala Thr Pro Val Phe Asp Asn Leu Trp Asp Gln Gly

145 150 155 160

Leu Val Ser Gln Asp Leu Phe Ser Val Tyr Leu Ser Ser Asn Asp Asp

165 170 175

Ser Gly Ser Val Val Leu Leu Gly Gly Ile Asp Ser Ser Tyr Tyr Thr

180 185 190

Gly Ser Leu Asn Trp Val Pro Val Ser Val Glu Gly Tyr Trp Gln Ile

195 200 205

Thr Leu Asp Ser Ile Thr Met Asp Gly Glu Thr Ile Ala Cys Ser Gly

210 215 220

Gly Cys Gln Ala Ile Val Asp Thr Gly Thr Ser Leu Leu Thr Gly Pro

225 230 235 240

Thr Ser Ala Ile Ala Asn Ile Gln Ser Asp Ile Gly Ala Ser Glu Asn

245 250 255

Ser Asp Gly Glu Met Val Ile Ser Cys Ser Ser Ile Asp Ser Leu Pro

260 265 270

Asp Ile Val Phe Thr Ile Asn Gly Val Gln Tyr Pro Leu Ser Pro Ser

275 280 285

Ala Tyr Ile Leu Gln Asp Asp Asp Ser Cys Thr Ser Gly Phe Glu Gly

290 295 300

Met Asp Val Pro Thr Ser Ser Gly Glu Leu Trp Ile Leu Gly Asp Val

305 310 315 320

Phe Ile Arg Gln Tyr Tyr Thr Val Phe Asp Arg Ala Asn Asn Lys Val

325 330 335

Gly Leu Ala Pro Val Ala

340

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tactattgcc agcattgctg c 21

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggcaaatggc attctgacat 20

Claims

1. A Pichia pastoris engineering bacterium for constitutive expression of porcine pepsinogen A, which takes Pichia pastoris GS115(Pichia pastoris GS115) as a host and pGAPZ α A as a vector to express the porcine pepsinogen A.

2. The pichia pastoris engineering bacteria of claim 1, wherein the amino acid sequence of the porcine pepsinogen a is shown in SEQ ID No. 2.

3. The Pichia pastoris engineered bacterium according to claim 1 or 2, wherein the polynucleotide sequence encoding the porcine pepsinogen A is shown in SEQ ID No. 1.

4. A method of constructing the pichia pastoris engineered bacterium of any one of claims 1 to 3, the method comprising:

(2) connecting the polynucleotide sequence obtained in step (1) to an expression vector pGAPZ α A to obtain a recombinant plasmid pGAPZ α A-PGA, and

5. The Pichia pastoris engineered bacterium according to claim 3, wherein the amino acid sequence of porcine pepsinogen A is shown in SEQ ID No. 2.

6. The method of claim 4 or 5, wherein the polynucleotide sequence is represented by SEQ ID No. 1.

7. A method of producing porcine pepsinogen a, the method comprising: fermenting the pichia pastoris engineered strain of claim 1 or 2, or the pichia pastoris engineered strain constructed by the method of claim 3 or 4, so as to obtain the porcine pepsinogen a.

8. Porcine pepsinogen a produced by the pichia pastoris engineered bacterium of any one of claims 1 to 3, or produced by the pichia pastoris engineered bacterium constructed by the method of any one of claims 4 to 6, or produced by the method of claim 7, and porcine pepsin a obtained by activation thereof.

9. The pichia pastoris engineering bacteria of any one of claims 1 to 3 or the pichia pastoris engineering bacteria constructed by the method of any one of claims 4 to 6, and the application of the pichia pastoris engineering bacteria in food, feed or medicine.

10. The porcine pepsinogen A and the activated porcine pepsin A of claim 8 for use in food, feed or medicine.