CN111334578A - IGHMBP2 gene mutation site detection kit and application thereof - Google Patents
IGHMBP2 gene mutation site detection kit and application thereof Download PDFInfo
- Publication number
- CN111334578A CN111334578A CN202010212788.8A CN202010212788A CN111334578A CN 111334578 A CN111334578 A CN 111334578A CN 202010212788 A CN202010212788 A CN 202010212788A CN 111334578 A CN111334578 A CN 111334578A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- sequence
- detection kit
- ighmbp2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the technical field of biological detection, and relates to a detection kit for IGHMBP2 gene mutation sites and application thereof. The detection kit comprises an amplification primer and an extension primer, wherein the sequence of a forward primer of the amplification primer is shown as SEQ ID NO.3, the sequence of a reverse primer of the amplification primer is shown as SEQ ID NO.4, the sequence of the extension primer is shown as SEQ ID NO.5, the sequence of the IGHMBP2 gene is shown as SEQ ID NO.1, and the sequence of the mutated IGHMBP2 gene is shown as SEQ ID NO. 2. The IGHMBP2 gene mutation site detection kit can predict the radiation sensitivity of personnel with high efficiency and low cost.
Description
Technical Field
The invention belongs to the technical field of biological detection, and relates to a detection kit for IGHMBP2 gene mutation sites and application thereof.
Background
Currently, radiation therapy remains the mainstay of modern cancer therapy, and approximately 50% of cancer patients require radiation therapy. However, patients receiving the same dose of radiation therapy exhibit different radiotoxicity: few have no obvious toxic effects, most have mild or moderate toxic reactions clinically, while few cause severe normal tissue complications and may even be life threatening. Therefore, there is a need to find a molecular marker associated with radiosensitivity for predicting whether a patient is a radiosensitive (or radioresistant) individual.
The prediction of radiation sensitivity is to be able to tailor the radiation treatment regimen to individual patients to improve prognosis, so that on the one hand the radiation dose can be reduced to reduce toxicity to sensitive individuals, and on the other hand the radiation dose can be increased to allow more radiation resistant patients to be effectively treated. This will maximize control of the tumor while minimizing damage to the patient's normal tissues. In addition, about 20 thousands of radiation workers exist in China, the radiation workers need to receive professional irradiation for a long time during daily work, and prediction of radiation sensitivity of the radiation workers is helpful for preventing and reducing professional injuries.
The site IGHMBP2 rs1249463, at chromosome 11, 68904009, is located at the allele T > C, and is a gene encoding a member of the helicase superfamily that binds to specific DNA sequences of the immunoglobulin mu chain switch region. Mutations in this gene can lead to spinal muscular atrophy with respiratory distress type I.
Single nucleotide polymorphism markers (SNPs) are "third generation DNA genetic markers", and 300 ten thousand of them exist in the human genome, and are considered as genetic markers with the best application prospect. SNPs can truly reflect genetic differences and are associated with radiation-induced toxicity in normal tissues.
In addition, compared with the traditional gene detection method mainly based on sequencing and hybridization principles, the matrix-assisted laser desorption ionization mass spectrometry technology has incomparable advantages in the aspects of detection efficiency, detection flux, detection sensitivity, detection accuracy, detection repeatability, detection cost and the like. The technology can realize simultaneous detection of 384 samples, the detection of each detection point only needs 3-5s, pmol level can be detected, and the accuracy reaches more than 98%. Therefore, the matrix-assisted laser desorption ionization mass spectrometry is used for judging the radiation sensitivity, so that the personnel radiation sensitivity can be quickly, accurately, high in flux and low in cost.
Disclosure of Invention
The invention aims to provide a kit for detecting mutation sites of IGHMBP2 gene, which can predict the radiation sensitivity of people with high efficiency and low cost.
To achieve the purpose, in a basic embodiment, the invention provides an IGHMBP2 gene mutation site detection kit, which comprises an amplification primer and an extension primer,
the sequence of the forward primer of the amplification primer is shown as SEQ ID NO.3, the sequence of the reverse primer of the amplification primer is shown as SEQ ID NO.4,
the sequence of the extension primer is shown as SEQ ID NO.5,
the sequence of the IGHMBP2 gene is shown as SEQ ID NO.1, the mutation site is rs1249463 site (mutation from T to C) of IGHMBP2 gene, and the sequence of the mutated IGHMBP2 gene is shown as SEQ ID NO. 2.
In a preferred embodiment, the invention provides a kit for detecting mutation sites of IGHMBP2 gene, wherein the concentration of the forward primer of the amplification primer is 2-3 μ M.
In a preferred embodiment, the invention provides a kit for detecting the mutation site of IGHMBP2 gene, wherein the concentration of the reverse primer of the amplification primer is 2-3 μ M.
In a preferred embodiment, the invention provides a kit for detecting the mutation site of IGHMBP2 gene, wherein the concentration of the extension primer is 3.5-4.5. mu.M.
The second purpose of the invention is to provide the application of the detection kit for preparing the kit for predicting the radiation sensitivity of the personnel, so that the radiation sensitivity of the personnel can be predicted with high efficiency and low cost.
To achieve this object, in a basic embodiment, the present invention provides the use of the above-described detection kit for the preparation of a kit for predicting the radiation sensitivity of a person.
The kit for detecting the mutation site of the IGHMBP2 gene has the advantages of high efficiency and low cost and can predict the radiation sensitivity of personnel.
Detailed Description
The following examples further illustrate the practice of the present invention, but the embodiments of the present invention are not limited to the following examples.
Example 1:
1) sample acquisition and irradiation and chromosome aberration analysis
Collecting peripheral blood of healthy adult male of 20-30 years old, and administering 0, 2Gy60And (4) irradiating Co gamma rays. And (3) carrying out chromosome aberration analysis on the 2Gy gamma ray irradiation sample, and dividing the population into a susceptible group, a general group and an insensitive group. After the irradiation, the blood sample is cultured for 52h, and then the chromosome is harvested and sliced. Each sample was analyzed for 200 metaphase phases.
2) Peripheral blood genome DNA extraction
Genomic DNA of 0Gy irradiated samples of susceptible and non-susceptible groups was extracted. The whole blood genome DNA extraction is carried out by adopting a blood genome DNA extraction kit of Beijing Tianzhu Biochemical technology Co., Ltd according to a product specification, and the specific steps are shown in the specification. The quantitative detection A260/280 of the sampled nucleic acid is between 1.70 and 1.90, the quality meets the experiment requirements, and the subsequent experiment can be carried out.
3) Whole exon capture sequencing
Sequencing data is firstly subjected to data filtration to remove low-quality data, and clear Reads are obtained. The sequencing needs to reach the clean Reads rate of more than 90%, the clean base rate of more than 20G, the clean base rate of more than 90%, and the Q20 rate of more than 98%, and the experimental sample meets the requirements.
4) Biological information analysis
Clear Reads were aligned to the reference genome and differential SNP sites were screened. Reference genome version: GRCh37(hg19), ftp:// ftp.1000genes.ebi.ac.uk/vol 1/ftp/technical/reference/human _ g1k _ v37. fasta.gz. Differential site IGHMBP2 rs1249463 site was selected by bioinformatics analysis, see Table 1.
TABLE 1 selected radiation sensitive sites
SNP site | Gene | SNP site position | Alleles |
rs1249463 | IGHMBP2 | chr11:68904009 | T/C |
Example 2:
1) the method utilizes a blood genome DNA extraction kit (non-centrifugal column type; catalog number: DP319) human whole blood genome (blood from healthy male volunteers between 20-30 years old) DNA extraction was performed according to the product instructions.
2) The amplification primer pair of SEQ ID NO.3 and SEQ ID NO.4 is adopted, and a specific reaction system (5 mu l of the reaction system comprises 0.95 mu l H)2O、0.625μl PCR Buffer(10×)、0.325μl MgCl2PCR reaction (25mM), 1. mu.l dNTP (2.5mM), 1. mu.l primer, 0.1. mu.l HotstarTaq (5U/. mu.L)) was performed according to the following reaction program: 15min at 94 ℃; [94 ℃, 20sec, 56 ℃, 30sec ]]45 cycles; 72 ℃ for 4 min. The reaction product was stored at 4 ℃.
3) Using an SAP reaction solution (2. mu.l SAP reaction solution included 1.53. mu.l H)2O, 0.17. mu.l of SAP Buffer (10 ×), 0.3. mu.l of SAP enzyme (1U/. mu.L)) were applied to the reaction product of step 2) at 37 ℃ for 40min and 85 ℃ for 5min, and the treated product was stored at 4 ℃.
4) Carrying out extension reaction on the treated product in the step 3) by adopting an extension primer of SEQ ID NO.5,
2 μ l reaction included 0.755 μ l H2O, 0.2. mu.l of iPLex Buffer (10 ×), 0.2. mu.l of iPLEX termination mix, 0.041. mu.l of iPLex enzyme, 0.804. mu.l of primer.
The reaction procedure is as follows: 30s at 94 ℃; 5 cycles of [94 ℃, 5s, (52 ℃, 5s, 80 ℃, 5s) ]40 cycles; 72 ℃ for 3 min. The extension product was stored at 4 ℃.
5) Purifying the extension product of step 4). 6mg of resin was uniformly applied to cover the 384 well plate and left for 20 min. The 384 well plate containing the extension product of step 4) was centrifuged at 1000rpm for 1min, 25. mu.L of deionized water was added to each well, inverted on the resin plate, and then the resin plate was snapped on the 384 well plate in the inverted position, and the resin was dropped into the 384 well plate by tapping, and the membrane was sealed. The 384 well plate was inverted for 20 minutes with the long axis of the 384 well plate as the axis, and centrifuged at 3500rpm for 5 minutes for use.
6) Detecting the genotype of the gene locus: the sample treated in step 5) was transferred to a MassARRAYPectroCHIP chip (SAMSUNG, MassArray. TM. Nanodispenser) and put into a mass spectrometer (SEQUENOM, MassARRAY compact System) for detection.
The detection result shows that the primer designed by the embodiment can detect the rs1249463 locus genotype of the IGHMBP2 gene and can be used for detecting the mutation of the radiation-sensitive gene IGHMBP2 rs1249463 locus.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is intended to include such modifications and variations. The foregoing examples or embodiments are merely illustrative of the present invention, which may be embodied in other specific forms or in other specific forms without departing from the spirit or essential characteristics thereof. The described embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. The scope of the invention should be indicated by the appended claims, and any changes that are equivalent to the intent and scope of the claims should be construed to be included therein.
Sequence listing
<110> China institute for radiation protection
<120> IGHMBP2 gene mutation site detection kit and application thereof
<130>-
<141>2020-03-24
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>1001
<212>DNA
<213> human (Homo sapiens)
<400>1
cacgcacgca gccggccctg gacgcactgg aggggaaggg actctctgct tatgcccagc 60
ccgccgctgg ccggatcggg ggcagccagt gcacctgact catgctgccg gggcctgact 120
gagaatgggc gcaaaccatg tttactgaat gaataaggga aagggctgct aactcgctgc 180
gggtggaact ggggtcgggg ccagggccca ggagtgtaag cttagtgggg ggtctcgggt 240
cgggaaatca aagtgcttct taagggtccc caaacggaac gcgctgccca ggaagtgatg 300
agactgacaa ctcgggaggt ggccaagcag gggacggacg atccctgccc ctgactcgaa 360
gggtcggaga cgaaattccc gccccagact atgaggccga gcccctcgga gactctgccc 420
gggacacggc gggaccgacc gcgagggagc ggcgccggcg gcctcccgta cctgcgctcc 480
tccacctccg cgtctctctc aagctccagc aggtccagtt gcttggtcac gaagctctcc 540
acagctgccg aggccatcgc cgccgccggc ctgggcccct agaagccgac gtcccgcttc 600
tgcgccgggc cggtgttaca gcggaccggt gttccccgcc gggcccgtgc gttacgcacg 660
cggttcgcgt cgtttccgtt tccggccgag gctgcggcca tggcagcatc ttccctgacg 720
gtcaccttag ggcggctggc gtccgcgtgc agccacagca tcctgagacc ttcggggccc 780
ggagcaggtg agacctggga tatgggagga agggaggacg cagagcgagc gctgctccct 840
gcggtctcgc cacgtatgtg cctgggtccg acctggtgcc ttgtgtgttg atcgcatttg 900
tggtgaatat agcacgggtt ttggagtcgggggaacccag gttcagattt tgattccttc 960
agttagtagc ctgaatactg acaatagccc ttgaactttg g 1001
<210>2
<211>1001
<212>DNA
<213> human (Homo sapiens)
<400>2
cacgcacgca gccggccctg gacgcactgg aggggaaggg actctctgct tatgcccagc 60
ccgccgctgg ccggatcggg ggcagccagt gcacctgact catgctgccg gggcctgact 120
gagaatgggc gcaaaccatg tttactgaat gaataaggga aagggctgct aactcgctgc 180
gggtggaact ggggtcgggg ccagggccca ggagtgtaag cttagtgggg ggtctcgggt 240
cgggaaatca aagtgcttct taagggtccc caaacggaac gcgctgccca ggaagtgatg 300
agactgacaa ctcgggaggt ggccaagcag gggacggacg atccctgccc ctgactcgaa 360
gggtcggaga cgaaattccc gccccagact atgaggccga gcccctcgga gactctgccc 420
gggacacggc gggaccgacc gcgagggagc ggcgccggcg gcctcccgta cctgcgctcc 480
tccacctccg cgtctctctc gagctccagc aggtccagtt gcttggtcac gaagctctcc 540
acagctgccg aggccatcgc cgccgccggc ctgggcccct agaagccgac gtcccgcttc 600
tgcgccgggc cggtgttaca gcggaccggt gttccccgcc gggcccgtgc gttacgcacg 660
cggttcgcgt cgtttccgtt tccggccgag gctgcggcca tggcagcatc ttccctgacg 720
gtcaccttag ggcggctggc gtccgcgtgc agccacagca tcctgagacc ttcggggccc 780
ggagcaggtg agacctggga tatgggagga agggaggacg cagagcgagc gctgctccct 840
gcggtctcgc cacgtatgtg cctgggtccg acctggtgcc ttgtgtgttg atcgcatttg 900
tggtgaatat agcacgggtt ttggagtcgg gggaacccag gttcagattt tgattccttc 960
agttagtagc ctgaatactg acaatagccc ttgaactttg g 1001
<210>3
<211>30
<212>DNA
<213> human (Homo sapiens)
<400>3
acgttggatg agcttcgtga ccaagcaact 30
<210>4
<211>29
<212>DNA
<213> human (Homo sapiens)
<400>4
acgttggatg tacctgcgct cctccacct 29
<210>5
<211>15
<212>DNA
<213> human (Homo sapiens)
<400>5
ctccgcgtct ctctc 15
Claims (5)
1. A detection kit for mutation sites of IGHMBP2 gene is characterized in that: the detection kit comprises an amplification primer and an extension primer,
the sequence of the forward primer of the amplification primer is shown as SEQ ID NO.3, the sequence of the reverse primer of the amplification primer is shown as SEQ ID NO.4,
the sequence of the extension primer is shown as SEQ ID NO.5,
the sequence of the IGHMBP2 gene is shown as SEQ ID NO.1, and the sequence of the mutated IGHMBP2 gene is shown as SEQ ID NO. 2.
2. The detection kit according to claim 1, characterized in that: the concentration of the forward primer of the amplification primer is 2-3 mu M.
3. The detection kit according to claim 1, characterized in that: the concentration of the reverse primer of the amplification primer is 2-3 mu M.
4. The detection kit according to claim 1, characterized in that: the concentration of the extension primer is 3.5-4.5 mu M.
5. Use of the test kit according to any one of claims 1 to 4 for the preparation of a kit for predicting the radiation sensitivity of a human.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010212788.8A CN111334578A (en) | 2020-03-24 | 2020-03-24 | IGHMBP2 gene mutation site detection kit and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010212788.8A CN111334578A (en) | 2020-03-24 | 2020-03-24 | IGHMBP2 gene mutation site detection kit and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111334578A true CN111334578A (en) | 2020-06-26 |
Family
ID=71178498
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010212788.8A Pending CN111334578A (en) | 2020-03-24 | 2020-03-24 | IGHMBP2 gene mutation site detection kit and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111334578A (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009068423A2 (en) * | 2007-11-30 | 2009-06-04 | Siemens Healthcare Diagnostics Gmbh | Method for predicting therapy responsiveness in basal like tumors |
CN111500719A (en) * | 2020-03-24 | 2020-08-07 | 中国辐射防护研究院 | Use of IGHMBP2 gene as molecular marker for predicting radiation sensitivity |
-
2020
- 2020-03-24 CN CN202010212788.8A patent/CN111334578A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009068423A2 (en) * | 2007-11-30 | 2009-06-04 | Siemens Healthcare Diagnostics Gmbh | Method for predicting therapy responsiveness in basal like tumors |
CN111500719A (en) * | 2020-03-24 | 2020-08-07 | 中国辐射防护研究院 | Use of IGHMBP2 gene as molecular marker for predicting radiation sensitivity |
Non-Patent Citations (3)
Title |
---|
1000GENOMES: "ss110609215" * |
BIRD,T.D.: "Homo sapiens immunoglobulin mu DNA binding protein 2 (IGHMBP2), RefSeqGene (LRG_250) on chromosome 11" * |
原雅艺: "辐射致染色体损伤的遗传易感位点的筛选" * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111172272A (en) | Application of TRIP12 gene as molecular marker for judging susceptibility to radiation damage | |
CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
WO2013060005A1 (en) | Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor | |
CN110551813B (en) | Primer group, application, product and method for detecting related SNP (single nucleotide polymorphism) sites of drug metabolic capability of rheumatic immune disease | |
CN116411062A (en) | Kit for evaluating effectiveness of adalimumab in treating psoriasis based on 78SNP loci | |
CN111500719B (en) | Use of IGHMBP2 gene as molecular marker for predicting radiation sensitivity | |
CN112195229B (en) | Kit for simultaneously detecting multiple SNP sites related to radiosensitivity | |
CN111286540B (en) | Use of POLN gene as molecular marker for predicting radiation sensitivity | |
Williams et al. | Genetic abnormalities of chromosome 22 and the development of psychosis | |
CN111378752A (en) | POLN gene mutation site detection kit and application thereof | |
CN111944912B (en) | Skin gene detection method | |
CN110734974B (en) | SNP locus combination and detection primer for cancer chemotherapy drugs | |
CN109777889B (en) | Application of EB virus genome variation site and kit | |
WO2016019633A1 (en) | Gene polymorphism variation site diagnostic reagent kit for early evaluation of breast cancer risk | |
CN111334578A (en) | IGHMBP2 gene mutation site detection kit and application thereof | |
CN111172271A (en) | Application of UIMC1 gene as molecular marker for judging susceptibility of radiation damage | |
CN111073976A (en) | UIMC1 gene mutation site detection kit and application thereof | |
CN115725721A (en) | Reagent for detecting pathogenic genes KCNQ1 and KCNH2 of long QT syndrome and application thereof | |
CN116004642A (en) | Long QT syndrome variant gene KCNH2 and application thereof | |
CN104894261B (en) | Kit for predicting curative effect of ranibizumab on treatment of age-related macular degeneration | |
Souery et al. | Tyrosine hydroxylase polymorphism and phenotypic heterogeneity in bipolar affective disorder: a multicenter association study | |
CN111154859A (en) | TRIP12 gene mutation site detection kit and application thereof | |
CN113957144B (en) | Combined methylmalonic acidemia gene mutation detection kit | |
WO2013060004A1 (en) | Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor | |
KR100642421B1 (en) | 1711.2-12 Diagnosis method and kits for inherited neuropathies caused by duplication or deletion of chromosome 17p11.2-p12 region |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |