CN111321185B - Engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof - Google Patents
Engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof Download PDFInfo
- Publication number
- CN111321185B CN111321185B CN201811523520.5A CN201811523520A CN111321185B CN 111321185 B CN111321185 B CN 111321185B CN 201811523520 A CN201811523520 A CN 201811523520A CN 111321185 B CN111321185 B CN 111321185B
- Authority
- CN
- China
- Prior art keywords
- xanthan gum
- xanthomonas campestris
- gume
- protein
- construction method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
- C12P19/06—Xanthan, i.e. Xanthomonas-type heteropolysaccharides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
Abstract
The invention discloses an engineering bacterium for producing xanthan gum and a construction method and application thereof. The construction method of the engineering bacteria for producing the xanthan gum provided by the invention comprises the following steps: improving the expression quantity and/or activity of GumE protein in Xanthomonas campestris. According to the invention, through genetic modification of the Xanthomonas campestris, which is a production strain, Xanthomonas campestris, the expression quantity of protein related to xanthan polymerization is increased, the viscosity of the produced xanthan is increased, and the high-viscosity xanthan product can be obtained by means of genetic engineering successfully.
Description
Technical Field
The invention relates to the field of xanthan gum production, and improves the performance of xanthan gum product by genetically modifying Xanthomonas campestris Xanthomonas campestris.
Background
Xanthan Gum is a generic name of extracellular acidic heteropolysaccharide produced by Xanthomonas campestris (Xanthomonas campestris), also known as Xanthan Gum, Xanthomonas campestris, etc., is a natural carbohydrate with high molecular weight, and is a microbial polysaccharide with the largest output at present. The backbone of the xanthan molecule has a pentasaccharide unit structure, consisting of two molecules of D-glucose, two molecules of D-mannose and one molecule of D-glucuronic acid.
The xanthan gum has the characteristics of thickening property, pseudoplastic rheological property, water solubility, suspension property, emulsion stability, acid and alkali resistance, salt resistance, temperature resistance, excellent compatibility and the like, and is widely applied to the industries of chemical industry, food, oil extraction, printing and dyeing, papermaking, textile, ceramics, coating, medicine and the like.
At present, xanthan gum is widely applied to industries such as food, petroleum and the like as a thickening agent and a suspending agent. The viscosity of the xanthan gum is improved, the same viscosity or higher viscosity can be kept under the condition of reducing the use amount of the xanthan gum, and the use cost is reduced. Research has shown that: heat treatment of xanthan gum fermentation broth can cause the xanthan gum to change its native conformation, producing high viscosity xanthan gum, but heat treatment can cause the xanthan gum to degrade.
Disclosure of Invention
The technical problem to be solved by the invention is how to improve the viscosity of xanthan gum.
In order to solve the technical problems, the invention firstly provides a construction method of an engineering bacterium for producing xanthan gum.
The construction method of the engineering bacteria for producing the xanthan gum provided by the invention comprises the following steps: improving the expression quantity and/or activity of GumE protein in Xanthomonas campestris.
In the construction method of the xanthan gum-producing engineering bacteria, the method for improving the expression quantity and/or activity of GumE protein in Xanthomonas campestris is to over-express GumE protein in Xanthomonas campestris Campestris.
Further, the overexpression method is to introduce a nucleic acid molecule encoding a GumE protein into Xanthomonas campestris.
Further, the nucleic acid molecule encoding the GumE protein is introduced into Xanthomonas campestris campestis via pBBAD-E plasmid. The pBBAD-E plasmid is obtained by replacing a gumE gene fragment shown in SEQ ID No.4 with a fragment (comprising KpnI and PstI enzyme cutting site sequences) between KpnI and PstI enzyme cutting sites of a pBBAD vector, and keeping other sequences of the pBBAD vector unchanged.
In the construction method of the xanthan gum-producing engineering bacteria, the GumE protein is c1) or c 2):
c1) a protein consisting of an amino acid sequence shown in SEQ ID No. 3;
c2) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.3, has the activity of GumE protein and is derived from c 1).
In the above construction method of the xanthan gum-producing engineering bacteria, the nucleic acid molecule encoding the GumE protein is C1) or C2) or C3):
C1) a cDNA molecule or a genomic DNA molecule as shown in SEQ ID No. 4;
C2) a cDNA molecule or a genomic DNA molecule hybridizing under stringent conditions to the DNA molecule defined in C1) and encoding said gumme protein;
C3) a cDNA molecule or a genomic DNA molecule having 90% or more identity to the DNA molecule defined by C1) or C2) and encoding said GumE protein.
In the construction method of the xanthan gum producing engineering bacteria, the Xanthomonas campestris Xanthomonas campestris can be common Xanthomonas campestris Xanthomonas campestris Campesris in the prior art for producing xanthan gum, such as Xanthomonas campestris Campesris NRRL B-1459(ATCC No. 13951), Xanthomonas campestris Campesris pv. Campesris B100, and the like. In a specific embodiment of the invention, said Xanthomonas campestris is Xanthomonas campestris pv. campestris with ATCC accession No. 33913.
In order to solve the above technical problems, the present invention further provides a biomaterial as described in any one of (1) to (3) below:
(1) the construction method of the engineering bacteria for producing the xanthan gum is adopted to construct the obtained engineering bacteria for producing the xanthan gum;
(2) the above nucleic acid molecule encoding a GumE protein;
(3) contains the expression cassette, the recombinant vector and the recombinant bacteria of the nucleic acid molecule for encoding the GumE protein in the step (2).
In order to solve the technical problems, the invention also provides a new application of the biological material.
The invention provides application of the biological material in producing xanthan gum.
The invention also provides application of the biological material in producing high-viscosity xanthan gum.
The invention also provides application of the biological material in improving viscosity of xanthan gum.
In order to solve the above technical problems, the present invention finally provides a method for producing xanthan gum.
The method for producing xanthan gum provided by the invention comprises the following steps: and carrying out fermentation culture on the engineering bacteria constructed by the construction method of the engineering bacteria for producing the xanthan gum to obtain a fermentation product, and preparing the xanthan gum from the fermentation product.
In the method for producing xanthan gum, the engineering bacteria further comprise the following steps before fermentation culture: selecting engineering bacteria, streaking on slant culture medium, and culturing at 28 deg.C for 2 d. Then inoculating the engineering bacteria into a seed culture medium, culturing at 28 ℃ and 200rpm to OD6001.2-1.5, a culture was obtained. The culture was then transferred to fresh seed medium and cultured at 28 ℃ and 200rpm to OD6000.8-1.0 to obtain seed liquid.
The solvent of the slant culture medium is water, and the solute composition and the final concentration are as follows: 10g/L of sucrose, 5g/L of peptone, 3g/L of beef extract, 0.5g/L, NaCl 2g/L of yeast extract and 20g/L of agar, and adjusting the pH value to 7.0.
The solvent of the seed culture medium is water, and the solute composition and the final concentration are as follows: 10g/L glucose, 5g/L peptone, 3g/L beef extract and 0.5g/L, NaCl 1g/L yeast extract, and adjusting the pH value to 7.0.
The seed culture medium also contains gentamicin, and the concentration of the gentamicin in the seed culture medium is 15 mug/mL.
In the above method for producing xanthan gum, the method for fermentation culture comprises the following steps: and adding the seed solution, arabinose and gentamicin into a fermentation culture medium for fermentation culture to obtain a fermentation product.
Further, the mass fraction of the arabinose in the fermentation culture system can be (0.01-0.2)%, and specifically can be 0.05%.
The concentration of the gentamicin in the fermentation culture system can be (5-30) mu g/mL, and specifically can be 15 mu g/mL.
The volume ratio of the seed liquid to the fermentation medium can be 1 (5-20), and specifically can be 1: 9.
Furthermore, the solvent of the fermentation medium is water, and the solute composition and the final concentration thereof are as follows: 40g/L of starch and 0.6g/L, CaCO of bean flour32g/L, and adjusting the pH value to 7.0.
In the above method for producing xanthan gum, the conditions of the fermentation culture are as follows: fermenting at 25-30 deg.C for 80-130 hr, specifically at pH 7, introducing air at 5L/min, dissolving oxygen at 30%, and fermenting at 28 deg.C for 130 hr.
In the above method for producing xanthan gum, the production of xanthan gum from the fermentation product comprises the steps of: diluting the fermentation product with distilled water, centrifuging, and collecting supernatant; adding absolute ethyl alcohol into the supernatant, and stirring until flocculent precipitates appear; and filtering and collecting the flocculent precipitate, and drying and crushing the flocculent precipitate in sequence to obtain the xanthan gum.
Further, diluting the fermentation product by 4-8 times with distilled water, centrifuging, and collecting supernatant; adding 2-3 times of anhydrous ethanol into the supernatant, and stirring until flocculent precipitate appears.
Further, the centrifugation conditions may be 12000rpm for 30 min.
The drying condition can be drying at 60 ℃ for 2-3 h.
And sieving the crushed xanthan gum with a 80-mesh sieve to obtain the xanthan gum.
The invention provides a construction method of engineering bacteria for producing xanthan gum, which comprises the following steps: improving the expression quantity and/or activity of GumE protein in Xanthomonas campestris. According to the invention, through genetic modification of the production strain xanthomonas campestris, the expression quantity of protein related to xanthan gum polymerization is increased, the viscosity of the produced xanthan gum is increased, and the high-viscosity xanthan gum product can be successfully obtained through a genetic engineering means.
Drawings
FIG. 1 is a pBBAD-E plasmid map.
Fig. 2 shows the viscosity measurement results of different xanthan gum samples.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the quantitative tests in the following examples, three replicates were set up and the results averaged.
The strains and plasmids in the following examples are shown in table 1.
Xanthomonas campestris pv. Campesris ATCC33913(Xanthomonas campestris pv. Campesris ATCC33913, ATCC33913 for short) was purchased from American type culture collection (ATCC for short) and ATCC number 33913.
The plasmid pBBAD is a plasmid used for gene overexpression, is a wide host vector, contains a pBBR1MCS-5 replicon, expresses a gentamycin resistance gene in xanthomonas campestris, has an arabinose-induced promoter derived from E.coli, and has a nucleotide sequence shown in SEQ ID No. 1.
The plasmid pBBAD-E is used for over-expressing the gumE gene, and the nucleotide sequence of the plasmid is shown as SEQ ID No. 2.
TABLE 1 bacterial strains and plasmids
| Strains or plasmids | Related features |
| Bacterial strains | |
| ATCC33913 | Wild type |
| ATCC33913E | ATCC33913/pBBAD-E |
| E.coli DH5α | Commonly used cloning host strains |
| Plasmids | |
| pBBAD | GmrArabinose inducible promoter |
| pBBAD-E | pBBAD, gumE arabinose-derived inducible overexpression vector |
The media formulations in the following examples are as follows:
the solvent of the NYGB liquid culture medium is water, and the solute composition and the final concentration thereof are as follows: 5g/L of peptone, 3g/L of yeast extract and 20g/L of glycerol. The NYGB solid culture medium is obtained by uniformly mixing agar and an NYGB liquid culture medium, wherein the final concentration of the agar in the NYGB solid culture medium is 20 g/L.
The solvent of the slant culture medium is water, and the solute composition and the final concentration are as follows: 10g/L of sucrose, 5g/L of peptone, 3g/L of beef extract, 0.5g/L, NaCl 2g/L of yeast extract and 20g/L of agar, and adjusting the pH value to 7.0.
The solvent of the seed culture medium is water, and the solute composition and the final concentration are as follows: 10g/L glucose, 5g/L peptone, 3g/L beef extract and 0.5g/L, NaCl 1g/L yeast extract, and adjusting the pH value to 7.0.
The solvent of the fermentation medium is water, and the solute composition and the final concentration are as follows: 40g/L of starch and 0.6g of bean flour/L、CaCO32g/L, and adjusting the pH value to 7.0.
The primers used in the following examples are shown in Table 2.
TABLE 2 primers used in the present invention
| Primer and method for producing the same | Sequence coding | Description of the invention |
| E1 | GAGGAATTAACCATGCTGATTCAAATGAGCGAGCAGGCG | GumE primers |
| E2 | GCCGCGCGGCACCAGTCACCGCGGCGCTCCTGC | GumE primers |
Example 1 construction of engineering bacteria for production of high viscosity Xanthan Gum
Construction of overexpression plasmid pBBAD-E
Using ATCC33913 genomic DNA as a template, primers E1 and E2 in Table 2 were used for PCR amplification to obtain a gumE gene fragment. Then, the gumE gene fragment was ligated with the KpnI and PstI digested pBBAD vector using the Clon express MultiS One Step Cloning Kit of Nanjing Novone Kinza to construct a gumE gene overexpression plasmid pBBAD-E. GumE Gene overexpression plasmid pBBAD-E expresses GumE protein. The amino acid sequence of GumE protein is shown in SEQ ID No. 3.
pBBAD-E plasmid was sequence verified. The sequencing result shows that: the pBBAD-E plasmid is obtained by replacing the sequence between KpnI and PstI cleavage sites of the pBBAD vector (including the sequence of KpnI and PstI cleavage sites) with the sequence of the gumE gene shown in SEQ ID No.4, and keeping the other sequences of the pBBAD vector unchanged.
Second, construction of engineering bacteria for producing high-viscosity xanthan gum
1. Preparation of ATCC33913 electroporation competent cells
ATCC33913 electroporation competent cells were prepared as follows:
1) streaking ATCC33913 on NYGB solid medium, and performing inverted culture at 28 ℃ for 2 days;
2) selecting a single colony, inoculating the single colony in 4mL NYGB liquid culture medium, and carrying out shaking culture at 28 ℃ and 200rpm overnight;
3) the culture solution is transferred into 50mL of NYGB liquid culture medium, the inoculation amount is 1%, the culture is performed at 28 ℃ and 200rpm in a shaking way until the medium-term logarithmic growth (OD600 is 0.8-0.9);
4) cooling in ice bath for 10min, centrifuging at 4 deg.C, and collecting thallus;
5) washing the mycelia with ice-precooled sterile 10% glycerol for three times, and discarding the supernatant;
6) after the supernatant was discarded for the last time, the bacteria were resuspended in 1mL of 10% volume fraction glycerol;
7) subpackaging at 100 μ L/tube, and storing at-80 deg.C.
2. Overexpression plasmid pBBAD-E shock transformation ATCC33913
And (2) melting the ATCC33913 electroconceptive cells prepared in the step (1) on ice, adding a proper amount (100-300ng) of plasmid DNA (pBBAD-E plasmid) constructed in the step one, uniformly mixing, carrying out electric shock transformation at 15kv/cm, adding 900 mu L NYGB culture medium, recovering for 2h at a low rotating speed of 28 ℃, coating a proper amount of bacterial liquid on an NYGB plate containing gentamicin (15 mu g/mL) for culture and screening to obtain positive recombinant bacteria, and recording the recombinant bacteria containing the pBBAD-E plasmid as ATCC33 33913E.
Example 2 application of engineering bacteria for producing high viscosity xanthan gum in producing xanthan gum
Preparation of xanthan gum by fermentation culture of recombinant bacteria
1. Preparation of seed liquid
ATCC33913 and the recombinant strain ATCC33913E obtained in example 1 were individually picked up and streaked on different slant medium, and cultured at 28 ℃ for 2 d; then inoculated into seed medium (50mL medium/500 mL shake flask), cultured at 28 ℃ and 200rpm to OD6001.2-1.5, 20-25mL of the culture was transferred to fresh seed medium (500mL medium/2000 mL shake flask), cultured at 28 ℃ and 200rpm to OD600Seed solutions were obtained, respectively, at 0.8 to 1.0. Gentamicin (final concentration 15. mu.g/mL) was added to the recombinant strain medium.
2. Fermentation culture of seed liquid
500mL of seed solution, gentamicin and arabinose were added to 4.5L of fermentation medium (Bio Flo 310 fermentor) to obtain a fermentation culture system, the final concentration of gentamicin in the fermentation culture system was 15. mu.g/mL, and the mass fraction of arabinose in the fermentation culture system was 0.05%. 2% NaOH and 2% H2SO4Regulating pH to 7, ventilating at 5L/min, dissolving oxygen at 30%, and fermenting at 28 deg.C for 130 hr to obtain fermentation liquid. The wild strain is fermented without adding gentamicin and arabinose, and the fermentation time is 80 h.
3. Preparation of Xanthan Gum samples
Diluting the fermentation liquor by 4-8 times with distilled water, centrifuging at 12000rpm for 30min, removing thallus, adding 2-3 times volume of anhydrous ethanol into the supernatant, slowly stirring until flocculent precipitate appears, filtering and collecting flocculent precipitate, drying at 60 deg.C for 2-3h, pulverizing, and sieving with 80 mesh sieve to obtain xanthan gum sample.
Taking a xanthan gum sample obtained by fermenting and culturing the recombinant strain ATCC33913E as an ATCC33913E-gum xanthan gum sample; the xanthan gum sample obtained by the fermentation culture of ATCC33913 was designated as ATCC33913-gum xanthan gum sample.
Measurement of viscosity of Xanthan gum
1. Preparation of xanthan gum solution
Respectively taking 3g of the xanthan gum sample prepared in the step one and 3g of potassium chloride, uniformly mixing, slowly adding into 300mL of deionized water, stirring at room temperature at 800r/min for 2h, and respectively obtaining a xanthan gum solution with the mass fraction of 1%.
2. Measurement of viscosity of Xanthan gum
The viscosity of aqueous xanthan gum solutions was measured at room temperature (25 ℃) and at elevated temperature (80 ℃) using a Brookfield DV3T viscometer, respectively. The detection conditions were as follows: placing a proper amount of xanthan gum aqueous solution with the mass fraction of 1% in a 100mL high-volume beaker, selecting a No. 63 rotor at 25 ℃ and 80 ℃ respectively, setting the rotating speed to be 6rpm, and recording the viscosity of the sample after the reading is stable.
The results of the viscosity measurement of ATCC33913E-gum xanthan gum samples are shown in FIG. 2, and the viscosity (8560mPa.s) of ATCC33913E-gum xanthan gum samples was increased by 12.9% as compared with ATCC33913-gum xanthan gum samples (7580mPa.s) at 25 ℃, which indicates that the viscosity of xanthan gum can be increased by increasing the expression level of GumE. The viscosity (4760mPa.s) of the ATCC33913E-gum xanthan gum sample at 80 ℃ is improved by 15.0 percent compared with that of the ATCC33913-gum xanthan gum sample (4140mPa.s), which shows that the temperature resistance of the xanthan gum can be improved by increasing the expression level of GumE.
Sequence listing
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof
<160>4
<170>PatentIn version 3.5
<210>1
<211>6017
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ctcgggccgt ctcttgggct tgatcggcct tcttgcgcat ctcacgcgct cctgcggcgg 60
cctgtagggc aggctcatac ccctgccgaa ccgcttttgt cagccggtcg gccacggctt 120
ccggcgtctc aacgcgcttt gagattccca gcttttcggc caatccctgc ggtgcatagg 180
cgcgtggctc gaccgcttgc gggctgatgg tgacgtggcc cactggtggc cgctccaggg 240
cctcgtagaa cgcctgaatg cgcgtgtgac gtgccttgct gccctcgatg ccccgttgca 300
gccctagatc ggccacagcg gccgcaaacg tggtctggtc gcgggtcatc tgcgctttgt 360
tgccgatgaa ctccttggcc gacagcctgc cgtcctgcgt cagcggcacc acgaacgcgg 420
tcatgtgcgg gctggtttcg tcacggtgga tgctggccgt cacgatgcga tccgccccgt 480
acttgtccgc cagccacttg tgcgccttct cgaagaacgc cgcctgctgt tcttggctgg 540
ccgacttcca ccattccggg ctggccgtca tgacgtactc gaccgccaac acagcgtcct 600
tgcgccgctt ctctggcagc aactcgcgca gtcggcccat cgcttcatcg gtgctgctgg 660
ccgcccagtg ctcgttctct ggcgtcctgc tggcgtcagc gttgggcgtc tcgcgctcgc 720
ggtaggcgtg cttgagactg gccgccacgt tgcccatttt cgccagcttc ttgcatcgca 780
tgatcgcgta tgccgccatg cctgcccctc ccttttggtg tccaaccggc tcgacggggg 840
cagcgcaagg cggtgcctcc ggcgggccac tcaatgcttg agtatactca ctagactttg 900
cttcgcaaag tcgtgaccgc ctacggcggc tgcggcgccc tacgggcttg ctctccgggc 960
ttcgccctgc gcggtcgctg cgctcccttg ccagcccgtg gatatgtgga cgatggccgc 1020
gagcggccac cggctggctc gcttcgctcg gcccgtggac aaccctgctg gacaagctga 1080
tggacaggct gcgcctgccc acgagcttga ccacagggat tgcccaccgg ctacccagcc 1140
ttcgaccaca tacccaccgg ctccaactgc gcggcctgcg gccttgcccc atcaattttt 1200
ttaattttct ctggggaaaa gcctccggcc tgcggcctgc gcgcttcgct tgccggttgg 1260
acaccaagtg gaaggcgggt caaggctcgc gcagcgaccg cgcagcggct tggccttgac 1320
gcgcctggaa cgacccaagc ctatgcgagt gggggcagtc gaaggcgaag cccgcccgcc 1380
tgccccccga gcctcacggc ggcgagtgcg ggggttccaa gggggcagcg ccaccttggg 1440
caaggccgaa ggccgcgcag tcgatcaaca agccccggag gggccacttt ttgccggagg 1500
gggagccgcg ccgaaggcgt gggggaaccc cgcaggggtg cccttctttg ggcaccaaag 1560
aactagatat agggcgaaat gcgaaagact taaaaatcaa caacttaaaa aaggggggta 1620
cgcaacagct cattgcggca ccccccgcaa tagctcattg cgtaggttaa agaaaatctg 1680
taattgactg ccacttttac gcaacgcata attgttgtcg cgctgccgaa aagttgcagc 1740
tgattgcgca tggtgccgca accgtgcggc accctaccgc atggagataa gcatggccac 1800
gcagtccaga gaaatcggca ttcaagccaa gaacaagccc ggtcactggg tgcaaacgga 1860
acgcaaagcg catgaggcgt gggccgggct tattgcgagg aaacccacgg cggcaatgct 1920
gctgcatcac ctcgtggcgc agatgggcca ccagaacgcc gtggtggtca gccagaagac 1980
actttccaag ctcatcggac gttctttgcg gacggtccaa tacgcagtca aggacttggt 2040
ggccgagcgc tggatctccg tcgtgaagct caacggcccc ggcaccgtgt cggcctacgt 2100
ggtcaatgac cgcgtggcgt ggggccagcc ccgcgaccag ttgcgcctgt cggtgttcag 2160
tgccgccgtg gtggttgatc acgacgacca ggacgaatcg ctgttggggc atggcgacct 2220
gcgccgcatc ccgaccctgt atccgggcga gcagcaacta ccgaccggcc ccggcgagga 2280
gccgcccagc cagcccggca ttccgggcat ggaaccagac ctgccagcct tgaccgaaac 2340
ggaggaatgg gaacggcgcg ggcagcagcg cctgccgatg cccgatgagc cgtgttttct 2400
ggacgatggc gagccgttgg agccgccgac acgggtcacg ctgccgcgcc ggtagcactt 2460
gggttgcgca gcaacccgta agtgcgctgt tccagactat cggctgtagc cgcctcgccg 2520
ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg gccacctcga 2580
cctgaatgga agccggcggc acctcgctaa cggattcacc gtttttatca ggctctggga 2640
ggcagaataa atgatcatat cgtcaattat tacctccacg gggagagcct gagcaaactg 2700
gcctcaggca tttgagaagc acacggtcac actgcttccg gtagtcaata aaccggtaaa 2760
ccagcaatag acataagcgg ctatttaacg accctgccct gaaccgacga ccgggtcgaa 2820
tttgctttcg aatttctgcc attcatccgc ttattatcac ttattcaggc gtagcaccag 2880
gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcatcgc 2940
agtcggcctg ccctgccact catcgcagtc ggcctacata ttctgctgac gcaccggtgc 3000
agcctttttt ctcctgccac atgaagcact tcactgacac cctcatcagt gccaacatag 3060
taagccagta tacactccgc tagcgcgtcg acgaaaggcc cagtctttcg actgagcctt 3120
tcgttttatt tgatgcctgg cagttcccta ctctcgcatg gggagacccc acactaccat 3180
cggcgctacg gcgtttcact tctgagttcg gcatggggtc aggtgggacc accgcgctac 3240
tgccgccagg caaattctgt tttatcagac cgcttctgcg ttctgattta atctgtatta 3300
gtggtggtgg tggtggtggc tgccgcgcgg caccagctgc agaccgagct caccgaattc 3360
accactagta ccagatctac cctcgaggct gccgcgcggc accaggccgc tgctgtgatg 3420
atgatgatga tgagaggtac ccatggttaa ttcctcctgt tagcccaaaa aacgggtatg 3480
gagaaacagt agagagttgc gataaaaagc gtcaggtagg atccgctaat cttatggata 3540
aaaatgctat ggcatagcaa agtgtgacgc cgtgcaaata atcaatgtgg acttttctgc 3600
cgtgattata gacacttttg ttacgcgttt ttgtcatggc tttggtcccg ctttgttaca 3660
gaatgctttt aataagcggg gttaccggtt tggttagcga gaagagccag taaaagacgc 3720
agtgacggca atgtctgatg caatatggac aattggtttc ttctctgaat ggcgggagta 3780
tgaaaagtat ggctgaagcg caaaatgatc ccctgctgcc gggatactcg tttaatgccc 3840
atctggtggc gggtttaacg ccgattgagg ccaacggtta tctcgatttt tttatcgacc 3900
gaccgctggg aatgaaaggt tatattctca atctcaccat tcgcggtcag ggggtggtga 3960
aaaatcaggg acgagaattt gtttgccgac cgggtgatat tttgctgttc ccgccaggag 4020
agattcatca ctacggtcgt catccggagg ctcgcgaatg gtatcaccag tgggtttact 4080
ttcgtccgcg cgcctactgg catgaatggc ttaactggcc gtcaatattt gccaatacgg 4140
ggttctttcg cccggatgaa gcgcaccagc cgcatttcag cgacctgttt gggcaaatca 4200
ttaacgccgg gcaaggggaa gggcgctatt cggagctgct ggcgataaat ctgcttgagc 4260
aattgttact gcggcgcatg gaagcgatta acgagtcgct ccatccaccg atggataatc 4320
gggtacgcga ggcttgtcag tacatcagcg atcacctggc agacagcaat tttgatatcg 4380
ccagcgtcgc acagcatgtt tgcttgtcgc cgtcgcgtct gtcacatctt ttccgccagc 4440
agttagggat tagcgtctta agctggcgcg aggaccaacg tatcagccag gcgaagctgc 4500
ttttgagcac cacccggatg cctatcgcca ccgtcggtcg caatgttggt tttgacgatc 4560
aactctattt ctcgcgggta tttaaaaaat gcaccggggc cagcccgagc gagttccgtg 4620
ccggttgtga agaaaaagtg aatgatgtag ccgtcaagtt gtcataattg gtaacgaatc 4680
agacaattga cggcttgacg gagtagcata gggtttgcag aatccctgct tcgtccattt 4740
gacaggcaca cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 4800
atcggccaac gcgcggggag aggcggtttg cgtattgggc gcatgcataa aaactgttgt 4860
aattcattaa gcattctgcc gacatggaag ccatcacaaa cggcatgatg aacctgaatc 4920
gccagcggca tcagcacctt gtcgccttgc gtataatatt tgcccatgga cgcacaccgt 4980
ggaaacggat gaaggcacga acccagttga cataagcctg ttcggttcgt aaactgtaat 5040
gcaagtagcg tatgcgctca cgcaactggt ccagaacctt gaccgaacgc agcggtggta 5100
acggcgcagt ggcggttttc atggcttgtt atgactgttt ttttgtacag tctatgcctc 5160
gggcatccaa gcagcaagcg cgttacgccg tgggtcgatg tttgatgtta tggagcagca 5220
acgatgttac gcagcagcaa cgatgttacg cagcagggca gtcgccctaa aacaaagtta 5280
ggtggctcaa gtatgggcat cattcgcaca tgtaggctcg gccctgacca agtcaaatcc 5340
atgcgggctg ctcttgatct tttcggtcgt gagttcggag acgtagccac ctactcccaa 5400
catcagccgg actccgatta cctcgggaac ttgctccgta gtaagacatt catcgcgctt 5460
gctgccttcg accaagaagc ggttgttggc gctctcgcgg cttacgttct gcccaggttt 5520
gagcagccgc gtagtgagat ctatatctat gatctcgcag tctccggcga gcaccggagg 5580
cagggcattg ccaccgcgct catcaatctc ctcaagcatg aggccaacgc gcttggtgct 5640
tatgtgatct acgtgcaagc agattacggt gacgatcccg cagtggctct ctatacaaag 5700
ttgggcatac gggaagaagt gatgcacttt gatatcgacc caagtaccgc cacctaacaa 5760
ttcgttcaag ccgagatcgg cttcccggcc gcggagttgt tcggtaaatt gtcacaacgc 5820
cgccaggtgg cacttttcgg ggaaatgtgc gcgcccgcgt tcctgctggc gctgggcctg 5880
tttctggcgc tggacttccc gctgttccgt cagcagcttt tcgcccacgg ccttgatgat 5940
cgcggcggcc ttggcctgca tatcccgatt caacggcccc agggcgtcca gaacgggctt 6000
caggcgctcc cgaaggt 6017
<210>2
<211>7313
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ctcgggccgt ctcttgggct tgatcggcct tcttgcgcat ctcacgcgct cctgcggcgg 60
cctgtagggc aggctcatac ccctgccgaa ccgcttttgt cagccggtcg gccacggctt 120
ccggcgtctc aacgcgcttt gagattccca gcttttcggc caatccctgc ggtgcatagg 180
cgcgtggctc gaccgcttgc gggctgatgg tgacgtggcc cactggtggc cgctccaggg 240
cctcgtagaa cgcctgaatg cgcgtgtgac gtgccttgct gccctcgatg ccccgttgca 300
gccctagatc ggccacagcg gccgcaaacg tggtctggtc gcgggtcatc tgcgctttgt 360
tgccgatgaa ctccttggcc gacagcctgc cgtcctgcgt cagcggcacc acgaacgcgg 420
tcatgtgcgg gctggtttcg tcacggtgga tgctggccgt cacgatgcga tccgccccgt 480
acttgtccgc cagccacttg tgcgccttct cgaagaacgc cgcctgctgt tcttggctgg 540
ccgacttcca ccattccggg ctggccgtca tgacgtactc gaccgccaac acagcgtcct 600
tgcgccgctt ctctggcagc aactcgcgca gtcggcccat cgcttcatcg gtgctgctgg 660
ccgcccagtg ctcgttctct ggcgtcctgc tggcgtcagc gttgggcgtc tcgcgctcgc 720
ggtaggcgtg cttgagactg gccgccacgt tgcccatttt cgccagcttc ttgcatcgca 780
tgatcgcgta tgccgccatg cctgcccctc ccttttggtg tccaaccggc tcgacggggg 840
cagcgcaagg cggtgcctcc ggcgggccac tcaatgcttg agtatactca ctagactttg 900
cttcgcaaag tcgtgaccgc ctacggcggc tgcggcgccc tacgggcttg ctctccgggc 960
ttcgccctgc gcggtcgctg cgctcccttg ccagcccgtg gatatgtgga cgatggccgc 1020
gagcggccac cggctggctc gcttcgctcg gcccgtggac aaccctgctg gacaagctga 1080
tggacaggct gcgcctgccc acgagcttga ccacagggat tgcccaccgg ctacccagcc 1140
ttcgaccaca tacccaccgg ctccaactgc gcggcctgcg gccttgcccc atcaattttt 1200
ttaattttct ctggggaaaa gcctccggcc tgcggcctgc gcgcttcgct tgccggttgg 1260
acaccaagtg gaaggcgggt caaggctcgc gcagcgaccg cgcagcggct tggccttgac 1320
gcgcctggaa cgacccaagc ctatgcgagt gggggcagtc gaaggcgaag cccgcccgcc 1380
tgccccccga gcctcacggc ggcgagtgcg ggggttccaa gggggcagcg ccaccttggg 1440
caaggccgaa ggccgcgcag tcgatcaaca agccccggag gggccacttt ttgccggagg 1500
gggagccgcg ccgaaggcgt gggggaaccc cgcaggggtg cccttctttg ggcaccaaag 1560
aactagatat agggcgaaat gcgaaagact taaaaatcaa caacttaaaa aaggggggta 1620
cgcaacagct cattgcggca ccccccgcaa tagctcattg cgtaggttaa agaaaatctg 1680
taattgactg ccacttttac gcaacgcata attgttgtcg cgctgccgaa aagttgcagc 1740
tgattgcgca tggtgccgca accgtgcggc accctaccgc atggagataa gcatggccac 1800
gcagtccaga gaaatcggca ttcaagccaa gaacaagccc ggtcactggg tgcaaacgga 1860
acgcaaagcg catgaggcgt gggccgggct tattgcgagg aaacccacgg cggcaatgct 1920
gctgcatcac ctcgtggcgc agatgggcca ccagaacgcc gtggtggtca gccagaagac 1980
actttccaag ctcatcggac gttctttgcg gacggtccaa tacgcagtca aggacttggt 2040
ggccgagcgc tggatctccg tcgtgaagct caacggcccc ggcaccgtgt cggcctacgt 2100
ggtcaatgac cgcgtggcgt ggggccagcc ccgcgaccag ttgcgcctgt cggtgttcag 2160
tgccgccgtg gtggttgatc acgacgacca ggacgaatcg ctgttggggc atggcgacct 2220
gcgccgcatc ccgaccctgt atccgggcga gcagcaacta ccgaccggcc ccggcgagga 2280
gccgcccagc cagcccggca ttccgggcat ggaaccagac ctgccagcct tgaccgaaac 2340
ggaggaatgg gaacggcgcg ggcagcagcg cctgccgatg cccgatgagc cgtgttttct 2400
ggacgatggc gagccgttgg agccgccgac acgggtcacg ctgccgcgcc ggtagcactt 2460
gggttgcgca gcaacccgta agtgcgctgt tccagactat cggctgtagc cgcctcgccg 2520
ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg gccacctcga 2580
cctgaatgga agccggcggc acctcgctaa cggattcacc gtttttatca ggctctggga 2640
ggcagaataa atgatcatat cgtcaattat tacctccacg gggagagcct gagcaaactg 2700
gcctcaggca tttgagaagc acacggtcac actgcttccg gtagtcaata aaccggtaaa 2760
ccagcaatag acataagcgg ctatttaacg accctgccct gaaccgacga ccgggtcgaa 2820
tttgctttcg aatttctgcc attcatccgc ttattatcac ttattcaggc gtagcaccag 2880
gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcatcgc 2940
agtcggcctg ccctgccact catcgcagtc ggcctacata ttctgctgac gcaccggtgc 3000
agcctttttt ctcctgccac atgaagcact tcactgacac cctcatcagt gccaacatag 3060
taagccagta tacactccgc tagcgcgtcg acgaaaggcc cagtctttcg actgagcctt 3120
tcgttttatt tgatgcctgg cagttcccta ctctcgcatg gggagacccc acactaccat 3180
cggcgctacg gcgtttcact tctgagttcg gcatggggtc aggtgggacc accgcgctac 3240
tgccgccagg caaattctgt tttatcagac cgcttctgcg ttctgattta atctgtatta 3300
gtggtggtgg tggtggtggc tgccgcgcgg caccagctgc agaccgagct caccgaattc 3360
accactagta ccagatctac cctcgaggct gccgcgcggc accaggccgc tgctgtgatg 3420
atgatgatga tgagaggtac ctcaccgcgg cgctcctgcg ggcaacggca catgcacgcc 3480
gttgtccgtt ggatcttcct tgtttgtgtc acgcaccggc acggctgacg ctgatggcat 3540
caggtgccac atgcagccgc agacaaacca ccacagcgcc gaagtcttga tcgagaaata 3600
gccgttagac accaacaggc tcagtgcaaa ggcaaacatc gcctggtttt tgaacaactg 3660
cccttccttg ctcggcatca gcagcaggaa cgaataagac agcaggaacg ccagcacgcc 3720
gacaatcgac tgcgaagcaa taaagtaaga aataccgctg tcgaaatacc ggtaggcctg 3780
cgcaaaatcc aggcccatcc acgactcgaa cgatagattg ttcatcgaat tcacagtgaa 3840
gaagatgcgc cccatcgtgg tgtcctggta ggccgtaatc ccggtcatcc acaccagcag 3900
ccaggcagag gcgatcacaa acaggaacaa caggaacgcc aaccgctgat ccatccgttt 3960
caataacggc gacagcagca ccatcagcac acaggtgccg gcagccagtc ggccgtcgga 4020
tgccacaatc atgaagccga tcaatccaat agacagaatc agcatcgacg gccgcatcca 4080
gcgccagaac gtcaatacga tcgcggtgaa gaagcagatg taattgccca tcgtcaccgg 4140
ctcgatgaac caggaagagg cgcgtggcag gttcgagcct gggaggaagt tgcgctcacc 4200
gggtcgtgtg gcactgacga atagattgct gtcctcgttc cagaaccctt ctgcactcat 4260
gccgcgcgca ttgacgaaga agctcttcgg gttgaccaga tcgccataag ccgagggcat 4320
cgccagctcg aacgcagcga ccaatgacac gatgatcgtc atgcgtatga acagcttggg 4380
caacgagccg gtgtaagcag accccagcac gacaaatgca aagaccacca gggcatcgcg 4440
gaagaacttg gggtcgatct gccagttgac caggaaacgc acgaacatca gcgtcacgat 4500
caagcctagc ccgccgaaga tcatcgcgat gcgctgtcgg ctcatcgagc ccagcccgag 4560
caggaaacag gctgcgtaga ccagaaattc cactgcatat gtgatcaccg gacgtacggt 4620
gaacacgttg gcgttgatca acgccagcag caggttgtag cccacgccgg tcagcagggt 4680
cagctcgatc agcgcgttgt gccaacgcac ccgcgcctgc tcgctcattt gaatcagcat 4740
ggttaattcc tcctgttagc ccaaaaaacg ggtatggaga aacagtagag agttgcgata 4800
aaaagcgtca ggtaggatcc gctaatctta tggataaaaa tgctatggca tagcaaagtg 4860
tgacgccgtg caaataatca atgtggactt ttctgccgtg attatagaca cttttgttac 4920
gcgtttttgt catggctttg gtcccgcttt gttacagaat gcttttaata agcggggtta 4980
ccggtttggt tagcgagaag agccagtaaa agacgcagtg acggcaatgt ctgatgcaat 5040
atggacaatt ggtttcttct ctgaatggcg ggagtatgaa aagtatggct gaagcgcaaa 5100
atgatcccct gctgccggga tactcgttta atgcccatct ggtggcgggt ttaacgccga 5160
ttgaggccaa cggttatctc gattttttta tcgaccgacc gctgggaatg aaaggttata 5220
ttctcaatct caccattcgc ggtcaggggg tggtgaaaaa tcagggacga gaatttgttt 5280
gccgaccggg tgatattttg ctgttcccgc caggagagat tcatcactac ggtcgtcatc 5340
cggaggctcg cgaatggtat caccagtggg tttactttcg tccgcgcgcc tactggcatg 5400
aatggcttaa ctggccgtca atatttgcca atacggggtt ctttcgcccg gatgaagcgc 5460
accagccgca tttcagcgac ctgtttgggc aaatcattaa cgccgggcaa ggggaagggc 5520
gctattcgga gctgctggcg ataaatctgc ttgagcaatt gttactgcgg cgcatggaag 5580
cgattaacga gtcgctccat ccaccgatgg ataatcgggt acgcgaggct tgtcagtaca 5640
tcagcgatca cctggcagac agcaattttg atatcgccag cgtcgcacag catgtttgct 5700
tgtcgccgtc gcgtctgtca catcttttcc gccagcagtt agggattagc gtcttaagct 5760
ggcgcgagga ccaacgtatc agccaggcga agctgctttt gagcaccacc cggatgccta 5820
tcgccaccgt cggtcgcaat gttggttttg acgatcaact ctatttctcg cgggtattta 5880
aaaaatgcac cggggccagc ccgagcgagt tccgtgccgg ttgtgaagaa aaagtgaatg 5940
atgtagccgt caagttgtca taattggtaa cgaatcagac aattgacggc ttgacggagt 6000
agcatagggt ttgcagaatc cctgcttcgt ccatttgaca ggcacacact gcccgctttc 6060
cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc 6120
ggtttgcgta ttgggcgcat gcataaaaac tgttgtaatt cattaagcat tctgccgaca 6180
tggaagccat cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg 6240
ccttgcgtat aatatttgcc catggacgca caccgtggaa acggatgaag gcacgaaccc 6300
agttgacata agcctgttcg gttcgtaaac tgtaatgcaa gtagcgtatg cgctcacgca 6360
actggtccag aaccttgacc gaacgcagcg gtggtaacgg cgcagtggcg gttttcatgg 6420
cttgttatga ctgttttttt gtacagtcta tgcctcgggc atccaagcag caagcgcgtt 6480
acgccgtggg tcgatgtttg atgttatgga gcagcaacga tgttacgcag cagcaacgat 6540
gttacgcagc agggcagtcg ccctaaaaca aagttaggtg gctcaagtat gggcatcatt 6600
cgcacatgta ggctcggccc tgaccaagtc aaatccatgc gggctgctct tgatcttttc 6660
ggtcgtgagt tcggagacgt agccacctac tcccaacatc agccggactc cgattacctc 6720
gggaacttgc tccgtagtaa gacattcatc gcgcttgctg ccttcgacca agaagcggtt 6780
gttggcgctc tcgcggctta cgttctgccc aggtttgagc agccgcgtag tgagatctat 6840
atctatgatc tcgcagtctc cggcgagcac cggaggcagg gcattgccac cgcgctcatc 6900
aatctcctca agcatgaggc caacgcgctt ggtgcttatg tgatctacgt gcaagcagat 6960
tacggtgacg atcccgcagt ggctctctat acaaagttgg gcatacggga agaagtgatg 7020
cactttgata tcgacccaag taccgccacc taacaattcg ttcaagccga gatcggcttc 7080
ccggccgcgg agttgttcgg taaattgtca caacgccgcc aggtggcact tttcggggaa 7140
atgtgcgcgc ccgcgttcct gctggcgctg ggcctgtttc tggcgctgga cttcccgctg 7200
ttccgtcagc agcttttcgc ccacggcctt gatgatcgcg gcggccttgg cctgcatatc 7260
ccgattcaac ggccccaggg cgtccagaac gggcttcagg cgctcccgaa ggt 7313
<210>3
<211>432
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>3
Met Leu Ile Gln Met Ser Glu Gln Ala Arg Val Arg Trp His Asn Ala
1 5 10 15
Leu Ile Glu Leu Thr Leu Leu Thr Gly Val Gly Tyr Asn Leu Leu Leu
20 25 30
Ala Leu Ile Asn Ala Asn Val Phe Thr Val Arg Pro Val Ile Thr Tyr
35 40 45
Ala Val Glu Phe Leu Val Tyr Ala Ala Cys Phe Leu Leu Gly Leu Gly
50 55 60
Ser Met Ser Arg Gln Arg Ile Ala Met Ile Phe Gly Gly Leu Gly Leu
65 70 75 80
Ile Val Thr Leu Met Phe Val Arg Phe Leu Val Asn Trp Gln Ile Asp
85 90 95
Pro Lys Phe Phe Arg Asp Ala Leu Val Val Phe Ala Phe Val Val Leu
100 105 110
Gly Ser Ala Tyr Thr Gly Ser Leu Pro Lys Leu Phe Ile Arg Met Thr
115 120 125
Ile Ile Val Ser Leu Val Ala Ala Phe Glu Leu Ala Met Pro Ser Ala
130 135 140
Tyr Gly Asp Leu Val Asn Pro Lys Ser Phe Phe Val Asn Ala Arg Gly
145 150 155 160
Met Ser Ala Glu Gly Phe Trp Asn Glu Asp Ser Asn Leu Phe Val Ser
165 170 175
Ala Thr Arg Pro Gly Glu Arg Asn Phe Leu Pro Gly Ser Asn Leu Pro
180 185 190
Arg Ala Ser Ser Trp Phe Ile Glu Pro Val Thr Met Gly Asn Tyr Ile
195 200 205
Cys Phe Phe Thr Ala Ile Val Leu Thr Phe Trp Arg Trp Met Arg Pro
210 215 220
Ser Met Leu Ile Leu Ser Ile Gly Leu Ile Gly Phe Met Ile Val Ala
225 230 235 240
Ser Asp Gly Arg Leu Ala Ala Gly Thr Cys Val Leu Met Val Leu Leu
245 250 255
Ser Pro Leu Leu Lys Arg Met Asp Gln Arg Leu Ala Phe Leu Leu Phe
260 265 270
Leu Phe Val Ile Ala Ser Ala Trp Leu Leu Val Trp Met Thr Gly Ile
275 280 285
Thr Ala Tyr Gln Asp Thr Thr Met Gly Arg Ile Phe Phe Thr Val Asn
290 295 300
Ser Met Asn Asn Leu Ser Phe Glu Ser Trp Met Gly Leu Asp Phe Ala
305 310 315 320
Gln Ala Tyr Arg Tyr Phe Asp Ser Gly Ile Ser Tyr Phe Ile Ala Ser
325 330 335
Gln Ser Ile Val Gly Val Leu Ala Phe Leu Leu Ser Tyr Ser Phe Leu
340 345 350
Leu Leu Met Pro Ser Lys Glu Gly Gln Leu Phe Lys Asn Gln Ala Met
355 360 365
Phe Ala Phe Ala Leu Ser Leu Leu Val Ser Asn Gly Tyr Phe Ser Ile
370 375 380
Lys Thr Ser Ala Leu Trp Trp Phe Val Cys Gly Cys Met Trp His Leu
385 390 395 400
Met Pro Ser Ala Ser Ala Val Pro Val Arg Asp Thr Asn Lys Glu Asp
405 410 415
Pro Thr Asp Asn Gly Val His Val Pro Leu Pro Ala Gly Ala Pro Arg
420 425 430
<210>4
<211>1299
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
atgctgattc aaatgagcga gcaggcgcgg gtgcgttggc acaacgcgct gatcgagctg 60
accctgctga ccggcgtggg ctacaacctg ctgctggcgt tgatcaacgc caacgtgttc 120
accgtacgtc cggtgatcac atatgcagtg gaatttctgg tctacgcagc ctgtttcctg 180
ctcgggctgg gctcgatgag ccgacagcgc atcgcgatga tcttcggcgg gctaggcttg 240
atcgtgacgc tgatgttcgt gcgtttcctg gtcaactggc agatcgaccc caagttcttc 300
cgcgatgccc tggtggtctt tgcatttgtc gtgctggggt ctgcttacac cggctcgttg 360
cccaagctgt tcatacgcat gacgatcatc gtgtcattgg tcgctgcgtt cgagctggcg 420
atgccctcgg cttatggcga tctggtcaac ccgaagagct tcttcgtcaa tgcgcgcggc 480
atgagtgcag aagggttctg gaacgaggac agcaatctat tcgtcagtgc cacacgaccc 540
ggtgagcgca acttcctccc aggctcgaac ctgccacgcg cctcttcctg gttcatcgag 600
ccggtgacga tgggcaatta catctgcttc ttcaccgcga tcgtattgac gttctggcgc 660
tggatgcggc cgtcgatgct gattctgtct attggattga tcggcttcat gattgtggca 720
tccgacggcc gactggctgc cggcacctgt gtgctgatgg tgctgctgtc gccgttattg 780
aaacggatgg atcagcggtt ggcgttcctg ttgttcctgt ttgtgatcgc ctctgcctgg 840
ctgctggtgt ggatgaccgg gattacggcc taccaggaca ccacgatggg gcgcatcttc 900
ttcactgtga attcgatgaa caatctatcg ttcgagtcgt ggatgggcct ggattttgcg 960
caggcctacc ggtatttcga cagcggtatt tcttacttta ttgcttcgca gtcgattgtc 1020
ggcgtgctgg cgttcctgct gtcttattcg ttcctgctgc tgatgccgag caaggaaggg 1080
cagttgttca aaaaccaggc gatgtttgcc tttgcactga gcctgttggt gtctaacggc 1140
tatttctcga tcaagacttc ggcgctgtgg tggtttgtct gcggctgcat gtggcacctg 1200
atgccatcag cgtcagccgt gccggtgcgt gacacaaaca aggaagatcc aacggacaac 1260
ggcgtgcatg tgccgttgcc cgcaggagcg ccgcggtga 1299
Claims (10)
1. The construction method of the engineering bacteria for producing the xanthan gum comprises the following steps: increase xanthomonas campestrisXanthomonas campestrisThe expression level of GumE protein;
the Xanthomonas campestris isXanthomonas campestrisXanthomonas campestris with ATCC number 33913Xanthomonas campestris pv. Campestris；
The GumE protein is a protein consisting of an amino acid sequence shown in SEQ ID No. 3.
2. The construction method according to claim 1, characterized in that: the increase of Xanthomonas campestrisXanthomonas campestrisThe method for expressing GumE protein is that in wild rapeXanthomonas campestrisXanthomonas campestrisOver-expressing GumE protein.
3. The construction method according to claim 2, wherein: the overexpression method is to introduce a nucleic acid molecule for coding GumE protein into Xanthomonas campestrisXanthomonas campestrisIn (1).
4. The construction method according to claim 3, wherein: the nucleic acid molecule for coding GumE protein is introduced into Xanthomonas campestris through pBBAD-E plasmidXanthomonas campestrisIn (1).
5. The construction method according to claim 3 or 4, characterized in that: the nucleic acid molecule for encoding GumE protein is a cDNA molecule or a genome DNA molecule shown in SEQ ID No. 4.
6. The xanthan gum-producing engineering bacteria constructed by the construction method of any one of claims 1 to 5.
7. The use of the engineered bacterium of claim 6 in the production of xanthan gum;
or, the use of the engineered bacteria of claim 6 to increase xanthan gum viscosity.
8. A method of producing xanthan gum comprising the steps of: carrying out fermentation culture on the xanthan gum-producing engineering bacteria constructed by the construction method of any one of claims 1-5 to obtain a fermentation product, and preparing xanthan gum from the fermentation product.
9. The method of claim 8, wherein: the conditions of the fermentation culture are as follows: fermenting and culturing at 25-30 deg.C for 80-130 h.
10. The method according to claim 8 or 9, characterized in that: the method for preparing xanthan gum from the fermentation product comprises the following steps: diluting the fermentation product with distilled water, centrifuging, and collecting supernatant; adding absolute ethyl alcohol into the supernatant, and stirring until flocculent precipitates appear; and filtering and collecting the flocculent precipitate, and drying and crushing the flocculent precipitate in sequence to obtain the xanthan gum.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811523520.5A CN111321185B (en) | 2018-12-13 | 2018-12-13 | Engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811523520.5A CN111321185B (en) | 2018-12-13 | 2018-12-13 | Engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111321185A CN111321185A (en) | 2020-06-23 |
| CN111321185B true CN111321185B (en) | 2022-04-05 |
Family
ID=71168377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811523520.5A Active CN111321185B (en) | 2018-12-13 | 2018-12-13 | Engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111321185B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115873771A (en) * | 2021-09-27 | 2023-03-31 | 中国科学院天津工业生物技术研究所 | Construction method and application of engineering bacteria for high-yield high-viscosity xanthan gum |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1946841A (en) * | 2004-04-23 | 2007-04-11 | 汉高两合股份公司 | Novel alkaline proteases, and detergents and cleaners containing the same |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998056942A1 (en) * | 1997-06-12 | 1998-12-17 | Shin-Etsu Bio, Inc. | Production of non-native bacterial exopolysaccharide in a recombinant bacterial host |
| US7285409B1 (en) * | 2000-05-09 | 2007-10-23 | Fundacao De Amparo A Pesquisa Do Estado De Sao Paulo | Isolated gum operon from Xyllela fastidiosa, isolated nucleic acid molecules therefrom, and uses thereof |
| US7439044B2 (en) * | 2003-03-21 | 2008-10-21 | Cp Kelco U.S., Inc. | High viscosity xanthan polymer preparations |
| DE102007041861A1 (en) * | 2007-09-03 | 2009-03-05 | Evonik Degussa Gmbh | Producing an acylated polymer with a low degree of acylation, especially xanthan gum, comprises culturing a polymer-producing microorganism that has been modified to overexpress an acylase |
| US20220119822A9 (en) * | 2018-05-11 | 2022-04-21 | Peking University | Method for reconstructing complex biological system on the basis of polyprotein, and use thereof in high activity super simplified nitrogen fixation system construction |
-
2018
- 2018-12-13 CN CN201811523520.5A patent/CN111321185B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1946841A (en) * | 2004-04-23 | 2007-04-11 | 汉高两合股份公司 | Novel alkaline proteases, and detergents and cleaners containing the same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111321185A (en) | 2020-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107142225B (en) | A kind of pichia yeast recombinant bacterium of the source overexpression Streptomyces sp.FA1 zytase | |
| CN110484471B (en) | Acid-resistant strain for high yield of bacterial cellulose and method for producing bacterial cellulose by using acid-resistant strain | |
| CN108467876A (en) | A kind of fermentation process improving curdlan yield | |
| US20100093095A1 (en) | Compositions and methods for enhanced bacterial exopolysaccharide production | |
| CN111057711B (en) | Sphingomonas engineering bacteria and construction method and application thereof | |
| CN111321185B (en) | Engineering bacterium for producing high-viscosity xanthan gum and construction method and application thereof | |
| CN113106112B (en) | Genetically engineered bacterium for heterologously expressing xanthan endonuclease and application thereof | |
| CN111518710B (en) | Enterobacter strain and application thereof in preparation of microbial polysaccharide | |
| CN100348720C (en) | Mannase and its coding gene and uses | |
| CN107236680B (en) | Pichia pastoris recombinant bacterium for expressing Streptomyces sp.FA1-derived xylanase | |
| CN108004153B (en) | Trichoderma reesei strain capable of producing pectin lyase in high yield and application thereof | |
| CN110343624B (en) | Recombinant strain and application thereof in improving yield of cellulase | |
| CN109554378B (en) | Xanthan gum yield related gene and application thereof in constructing high-yield xanthan gum engineering bacteria | |
| CN109929892A (en) | A kind of technique that fermentation produces high-quality yellow virgin rubber | |
| CN111471636B (en) | Genetically engineered bacterium for expressing human epidermal growth factor and application thereof | |
| CN113943662A (en) | Trichoderma reesei strain for heterologous expression of xylanase/cellulase CbXyn10c gene and application thereof | |
| CN112646831A (en) | Shuttle plasmid, construction method and application thereof in synechocystis transformation exogenous gene | |
| CN115873771A (en) | Construction method and application of engineering bacteria for high-yield high-viscosity xanthan gum | |
| CN110066839A (en) | Culture medium for xanthan gum fermentation | |
| CN1485431A (en) | Gene engineering yeast strain of expressing beta-1,3-1,4-glucanase | |
| CN114836361B (en) | Bacillus amyloliquefaciens engineering strain for high yield of glucosamine and application thereof | |
| CN116042687B (en) | Carrier, low molecular weight hyaluronic acid synthetic strain, construction method and application | |
| CN114854778B (en) | Fucoidan gene Fcn1 and application thereof | |
| CN113913450B (en) | Method for expressing chitosanase by rhodopseudomonas palustris, chitosanase, recombinant plasmid, recombinant bacteria, fermentation bacteria and application | |
| CN109536395A (en) | It is a kind of it is high expression 'beta '-mannase pichia pastoris engineered strain and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |