CN111320686A

CN111320686A - Fully human monoclonal antibody 2G3 for resisting H7N9 as well as preparation method and application thereof

Info

Publication number: CN111320686A
Application number: CN201811526036.8A
Authority: CN
Inventors: 万晓春; 李俊鑫
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Biological Manufacturing Industry Innovation Center Co ltd
Priority date: 2018-12-13
Filing date: 2018-12-13
Publication date: 2020-06-23
Anticipated expiration: 2038-12-13
Also published as: WO2020119664A1; CN111320686B

Abstract

The application relates to an anti-H7N 9 fully human monoclonal antibody 2G3, a preparation method and application thereof. The fully human monoclonal antibody 2G3 is rapidly screened by a memory B cell PCR method and does not contain any murine components. The antibody can be targeted to hemagglutinin HA combined with H7N9 virus, and HAs the neutralizing activity for resisting H7N9 virus infection obviously; the antibody does not have toxic and side effects such as anti-mouse anti-antibody and the like, has better biocompatibility, and is more suitable and has more potential to become a macromolecular drug for treating influenza virus.

Description

Fully human monoclonal antibody 2G3 for resisting H7N9 as well as preparation method and application thereof

Technical Field

The invention belongs to the field of immunology, and particularly relates to a fully human monoclonal antibody 2G3 for resisting H7N9, and a preparation method and application thereof.

Background

In 2015, 6 of ten popular drugs are all humanized or humanized monoclonal antibody drugs. The first one is Humira, a fully human monoclonal antibody, which is a monoclonal antibody and is sold in 100 hundred million over 3 years. Since the first monoclonal antibody drug was marketed in 1986, the monoclonal antibody drugs underwent the stages of murine monoclonal antibody drugs (such as Orthoclone OKT3), chimeric monoclonal antibody drugs (Rituximab), humanized monoclonal antibody drugs (Herceptin), and fully human monoclonal antibody drugs (Humira). Because human bodies have anti-mouse antibody reaction (HAMA), murine monoclonal antibody drugs and chimeric monoclonal antibody drugs are gradually eliminated, and the monoclonal antibody drugs occupying the market at present are all humanized monoclonal antibody drugs. Compared with the internationally advanced human antibody production technology, Shenzhen and even China have great gap, mainly manifested in the weak innovation ability of the human antibody drug field, few varieties of independent research and development, no report of the market of original humanized monoclonal antibody drug exists at present, and the huge antibody drug market is occupied by foreign drug enterprises. China changes the lagging situation and strives for antibody drug markets with huge consumption potential at home and abroad, and needs to overcome the fully humanized monoclonal antibody technology urgently.

The human monoclonal antibody has high specificity and obvious curative effect on inflammation, cancer, especially influenza. Influenza is an infectious disease caused by influenza virus, and seriously threatens human health. About 10 million people worldwide are infected with seasonal influenza virus each year, with 25-50 million people dying. The H7N9 virus is an influenza virus, has drug resistance to traditional antiviral drugs amantadine and rimantadine, and no effective treatment means exists at present. The H7N9 virus needs to be bound with a receptor on a human cell by a specific molecule expressed by the virus itself when invading the cell, so that the cell can be infected and further amplified. The human antibody for neutralizing the virus is a certain specific antibody generated by human B lymphocytes, can be combined with the antigen on the surface of the virus, thereby preventing the virus from adhering to a target cell receptor, preventing the virus from invading cells and effectively preventing and treating the H7N9 influenza.

Disclosure of Invention

In one aspect, the application relates to the fully human monoclonal antibody 2G3 against H7N9 or a biologically active fragment derived from the monoclonal antibody capable of neutralizing the H7N9 virus.

In another aspect, the present application relates to a gene encoding the anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived from the monoclonal antibody that specifically binds to H7N9, and a vector or cell containing the gene.

In another aspect, the present application relates to methods of producing the anti-H7N 9 fully human monoclonal antibody 2G 3.

In another aspect, the present application relates to a pharmaceutical composition comprising said anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived from said monoclonal antibody capable of specifically binding to H7N 9.

In another aspect, the present application relates to the use of the anti-H7N 9 fully human monoclonal antibody 2G3 described herein or a biologically active fragment derived therefrom that is capable of specifically binding to H7N9 or said pharmaceutical composition.

In another aspect, the present application relates to a kit for detecting H7N9 virus.

Drawings

FIG. 1 is a graph showing the results of flow-based assay of CD40L expression in example 1 by NTH-3T 3.

FIG. 2 is a graph showing the results of sorting memory B cells by flow cytometry in example 1.

FIG. 3 is a graph showing the results of ELISA experiments in example 1.

FIG. 4 is a graph showing the results of the neutralization experiment in example 3.

Detailed Description

The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention.

In one aspect, the present application provides an anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived therefrom that specifically binds to H7N9, wherein the amino acid sequences of the heavy and light chain CDR1, CDR2 and CDR3 regions of the antibody are as follows:

heavy chain CDR1: GYIFTYE;

heavy chain CDR2, MNPESGET;

heavy chain CDR3: ATGNAECSGGSCYNWFEP;

light chain CDR1: KLKSYY;

light chain CDR2: GRN;

light chain CDR3: NSKETSGYHLV.

In some embodiments, the heavy chain variable region amino acid sequence of the antibody is shown as SEQ ID NO. 2, or the amino acid sequence with the same function is formed by replacing, deleting or adding one or more amino acids in the sequence; and/or

The variable region amino acid sequence of the light chain of the antibody is shown as SEQ ID NO. 4, or the sequence is formed by replacing, deleting or adding one or more amino acids to form an amino acid sequence with the same function.

In some embodiments, the heavy chain amino acid sequence of the antibody is shown as SEQ ID NO. 6, or the amino acid sequence with equivalent functions formed by replacing, deleting or adding one or more amino acids in the sequence; and/or

The light chain amino acid sequence of the antibody is shown as SEQ ID NO. 8, or the amino acid sequence with the same function is formed by replacing, deleting or adding one or more amino acids in the sequence.

Through ELISA experiment verification, the anti-H7N 9 fully human monoclonal antibody 2G3 can be targeted to and combined with hemagglutinin HA of H7N9 virus, and the affinity is 2.3 × 10^-9M; in a model of virus-infected cells, their IC₅₀The value is only around 0.0711 uM. Compared with a mouse antibody, the gene of the fully human antibody is completely derived from the human gene, has no other species of components, does not generate toxic and side effects such as anti-mouse anti-antibody and the like in a human body, has better biocompatibility, and is more suitable and has more potential to become a macromolecular drug for treating influenza virus.

In another aspect, the present application provides genes encoding the anti-H7N 9 fully human monoclonal antibody 2G3 described herein. In some embodiments, the gene comprises a nucleotide sequence encoding an amino acid having the amino acid sequence set forth in SEQ ID NO. 2, in some embodiments, the nucleotide sequence set forth in SEQ ID NO. 1; and/or

The gene comprises a nucleotide sequence encoding an amino acid having the amino acid sequence shown in SEQ ID NO. 4, and in some embodiments, the nucleotide sequence is shown in SEQ ID NO. 3.

In some embodiments, the gene comprises a nucleotide sequence encoding an amino acid having SEQ ID NO 6, in some embodiments, the nucleotide sequence is set forth in SEQ ID NO 5; and/or

The gene comprises a nucleotide sequence encoding an amino acid having the amino acid sequence shown in SEQ ID NO. 8, and in some embodiments, the nucleotide sequence is shown in SEQ ID NO. 7.

The sequence of SEQ ID NO 1-8 is shown in a sequence table, wherein:

(1) the sequence from 76 th to 99 th of SEQ ID NO. 1 and the sequence from 124 th to 147 th of SEQ ID NO. 5: sequences encoding the heavy chain CDR1 region;

(2) sequences 151 to 174 of SEQ ID NO. 1 and sequences 199 to 222 of SEQ ID NO. 5: sequences encoding the heavy chain CDR2 region;

(3) the sequence 289 to 342 of SEQ ID NO. 1 and the sequence 337 to 390 of SEQ ID NO. 5: sequences encoding the heavy chain CDR3 region;

(4) the sequence from 76 th to 93 th of SEQ ID NO. 3 and the sequence from 124 th to 141 th of SEQ ID NO. 7: sequences encoding the light chain CDR1 region;

(5) sequences 145-153 of SEQ ID NO 3 and sequences 193-201 of SEQ ID NO 7: sequences encoding the light chain CDR2 region;

(6) the sequences 262 to 294 of SEQ ID NO 3 and the sequences 310 to 342 of SEQ ID NO 7: sequences encoding the light chain CDR3 region;

(7) the sequence at positions 1 to 48 in SEQ ID NO 5 and SEQ ID NO 7 is a sequence for encoding a signal peptide.

(8) The 26 th to 33 th amino acid sequences in SEQ ID NO. 2 and SEQ ID NO. 6 are heavy chain CDR1 sequences; the 51-58 amino acid sequences in SEQ ID NO. 2 and SEQ ID NO. 6 are heavy chain CDR2 sequences; the 97 th to 114 th amino acid sequences in SEQ ID NO. 2 and SEQ ID NO. 6 are heavy chain CDR3 sequences.

(9) The 26 th to 31 th amino acid sequences in SEQ ID NO. 4 and SEQ ID NO. 8 are light chain CDR1 sequences; amino acid sequences 49-51 in SEQ ID NO. 4 and SEQ ID NO. 8 are light chain CDR2 sequences; amino acid sequences 88-98 in SEQ ID NO. 4 and SEQ ID NO. 8 are light chain CDR3 sequences.

In another aspect, the present application provides a vector comprising a gene as described above.

In a further aspect, the present application provides a cell comprising a gene as described above or a vector as described above.

In still another aspect, the present application provides a method for producing the anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N9, which comprises culturing genetically engineered cells containing the above gene encoding the heavy and light chains of the anti-H7N 9 fully human monoclonal antibody 2G3 or the above vector or directly culturing the above cells, collecting and purifying to obtain the anti-H7N 9 fully human monoclonal antibody 2G 3.

In the prior art, a method for preparing an anti-H7N 9 virus humanized monoclonal antibody by adopting a phage display technology exists, although the method has the advantages of low production cost and no complicated work such as immunization, cell fusion and the like, the method has obvious defects, and the antibody obtained from a non-immune antibody library is often insufficient in affinity, limited by the conversion rate of an exogenous gene, insufficient in library capacity of the antibody library to cover the antibody diversity of animals and the like. The present application separates B cells secreting functional antibodies from the blood of a patient, then extracts RNA and synthesizes cDNA, clones genes secreting the objective antibodies therefrom, and finally recombines and expresses fully human monoclonal antibodies. The technology is simple and quick to operate, the produced humanized antibody has high affinity and specificity, and in addition, the technology of the monoclonal antibody with the virus neutralizing or tumor killing function separated from the memory B cells can be further improved, so that the complicated operation and cost are greatly reduced.

In another aspect, the present application provides a pharmaceutical composition comprising the anti-H7N 9 fully human monoclonal antibody 2G3 described herein or a biologically active fragment derived therefrom that specifically binds to H7N 9.

In another aspect, the present application provides an application of the anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N9, or the pharmaceutical composition in the preparation of a medicament for treating diseases caused by H7N9 virus.

In another aspect, the present application provides a kit for detecting the level of H7N9 virus, comprising the anti-H7N 9 fully human monoclonal antibody 2G3 described herein or a biologically active fragment derived from the monoclonal antibody that specifically binds to H7N 9; in some embodiments, the kit further comprises a second antibody and an enzyme for detection or a fluorescent or radioactive label, and a buffer; the second antibody is, for example, an anti-antibody against monoclonal antibody 2G3 described herein.

Compared with the prior art, the method has the following beneficial effects:

(1) the anti-H7N 9 fully human monoclonal antibody 2G3 can be targeted to and combined with hemagglutinin HA of H7N9 virus, and HAs obvious neutralization activity against H7N9 virus infection.

(2) Compared with a murine antibody, the fully humanized antibody has the advantages that the gene of the fully humanized antibody is completely derived from the human gene, no other species of components exist, toxic and side effects such as anti-murine antibodies and the like do not occur in a human body, the fully humanized antibody has better biocompatibility, and is more suitable and has more potential to become a macromolecular drug for treating influenza viruses.

(3) Compared with the method for preparing the H7N9 virus-resistant human monoclonal antibody by using the phage display technology provided by the prior art, the method for developing the H7N9 virus-resistant antibody by using the single B cell has the advantages of simple and rapid operation, high affinity and specificity of the produced human antibody and the like.

For a clearer understanding of the technical features, objects and advantages of the present application, reference will now be made to the following detailed description of the embodiments of the present application, with the understanding that the examples are provided for illustration only and are not intended to limit the scope of the present application. In the examples, each raw reagent material is commercially available, and the experimental method not specifying the specific conditions is a conventional method and a conventional condition well known in the art, or a condition recommended by an instrument manufacturer.

Example 1

(1) Construction of NTH-3T3 cell line stably expressing CD40L (3T3-CD40L)

Lentivirus was used to establish 3T3-CD40L feeder cells. Constructing a lentivirus expression vector pLVX-CD40L, transfecting 293T cells, and collecting virus supernatant on the fourth day of transfection. NIH-3T3 cells were activated, cultured for 3 passages, infected with lentivirus, cultured further and passaged 3 times. Sorting cells with FITC fluorescence intensity near MFI by using a flow cytometer, adding the cells into a culture bottle again at 37 ℃ and 5% CO₂The cells were cultured and tested in an incubator, the results are shown in FIG. 1, 3T3 cells expressing CD40L and 3T3 cells transfected by an empty vector pLVX (with ZxGreen) were stained with anti-CD 40L with APC, and then analyzed by an up-flow cytometer⁷Placing the cells in an irradiator for 5000rads irradiation, and resuspending the cells in a freezing medium at a concentration of 3.5 × 10 per ml⁷The cells are packed in 1ml of freezing tubules and frozen in liquid nitrogen (can be stored for 2 years).

(2) Sorting and activation of memory B cells

Separating and freezing PBMC of convalescent patients infected with H7N9 virus by using lymph separating medium, wherein each tube is 10-50 × 10⁶Cells, frozen in liquid nitrogen tank. PBMC flow staining solutions were prepared, and the components thereof are shown in Table 1 below

TABLE 1PBMC flow staining solution

Antibodies	Volume (μ L)
		CD19-PE-Cy7	0.5
IgM-PE	1.0
		IgA-APC	2.5
IgD-FITC	2.5
		PBS-1％(wt/vol)BSA	43.5

Thawing PBMC, adding the above PBMC flow staining solution and sorting on flow cytometer, and sorting out CD19 as shown in FIG. 2⁺IgM^–IgA^–IgD^–The purity of the memory B cells is required to be more than 90%, and if the purity of the memory B cells is less than 90%, the sorting process is repeated. A mixed medium for activating B cells was prepared as shown in table 2 below:

TABLE 2

Components	Volume of
		Complete IMDM Medium	336mL
IL-2(10,000U mL^-1)	3.5mL
		IL-21(100μg mL^-1)	175μL
3T3-CD40L obtained in step (1)	10mL

Adding memory B cells into mixed culture medium, mixing, diluting in 384-well plate with 1 cell per well and 50 μ l volume, standing at 37 deg.C and 5% CO₂And (5) standing and culturing in an incubator. After 13 days, the supernatant was subjected to ELISA.

(3) Obtaining human monoclonal antibody 2G3

The influenza virus hemagglutinin HA is a virus envelope surface columnar antigen, can be combined with a plurality of erythrocyte receptors such as human, chicken, guinea pig and the like to cause erythrocyte agglutination, HAs immunogenicity, and can neutralize influenza virus by an anti-hemagglutinin antibody. In the present invention, B cells secreting antibody 2G3 binding to H7N9 virus were found by ELISA, and the secreted human monoclonal antibody 2G3 could target hemagglutinin HA binding to H7N9 virus (fig. 3).

The specific operation of the ELISA experiment is as follows:

(1) 100 ng/100. mu.l of HA protein of H7N9 virus (available from ACROBIOSystems) was coated in a 96-well microplate, 100. mu.l per well;

(2) standing in a refrigerator at 4 deg.C overnight;

(3) washing with PBST solution for three times, adding 5% skimmed milk powder solution 200 μ l per well, and incubating at 37 deg.C for 1 hr;

(4) washing with PBST solution for three times, adding 100 μ l of normal human serum without virus infection (negative control) or patient serum with virus infection or anti-H7N 9 fully human monoclonal antibody 2G3, each in triplicate;

(5) incubation for 1 hour at 37 ℃ followed by three washes with PBST solution;

(6) adding 100 mul of HRP-carrying anti-human IgG antibody (abcam) diluted at a ratio of 1:5000 into an enzyme-labeled plate;

(7) incubation for 1 hour at 37 ℃ followed by three washes with PBST solution;

(8) add 100. mu.l TMB substrate solution (Thermo Scientific) to each well for 5min at 37 ℃;

(9) the stop solution 2M sulfuric acid 100. mu.l was added to each well, and the absorbance was immediately measured at a wavelength of 450nm in a microplate reader. The results are shown in fig. 3, and an ELISA experiment indicates that the human monoclonal antibody 2G3 obtained in the present application can target hemagglutinin HA binding to H7N9 virus.

Example 2 cloning, recombination, expression and purification of humanized monoclonal antibody 2G3 Gene

The B cells capable of secreting 2G3 antibody that binds H7N9 virus obtained in example 1 were lysed, and the lysates were subjected to reverse transcription of RNA to obtain PCR template cDNA of the human antibody gene. Designing and synthesizing primers for cloning antibody genes, cloning heavy chain and light chain genes of the antibody by taking cDNA as a template, and recombining to express and purify in a eukaryotic cell 293F or HEK 293. Specifically, the method comprises the following steps:

(1) the lysed B cell fluid was transferred to a 96-well plate (Eppendorf, 030133366).

(2) Reverse transcription system: 150ng random primer (Invitrogen,48190-

III reverse transcriptase (Invitrogen,18080-044), DEPC water was supplied to 14. mu.l/well.

(3) Reverse transcription reaction procedure: 42 ℃ for 10 min; at 25 ℃ for 10 min; 50 ℃ for 60 min; 94 ℃ for 5 min.

(4) The cDNA was stored at-20 ℃.

(5) Design and synthesis of primers:

forward Primer 5 '-3' sequence (Forward Primer 5 '-3' sequence)

Heavy chain variable region PCR primers:

5′VH1 CTGCAACCGGTGTACATTCCCAGGTGCAGCTGGTGCAG(SEQ ID NO:9)

5′VH1/5 CTGCAACCGGTGTACATTCCGAGGTGCAGCTGGTGCAG(SEQ ID NO:10)

5′VH3 CTGCAACCGGTGTACATTCTGAGGTGCAGCTGGTGGAG(SEQ ID NO:11)

5′VH3-23 CTGCAACCGGTGTACATTCTGAGGTGCAGCTGTTGGAG(SEQ ID NO:12)

5′VH4 CTGCAACCGGTGTACATTCCCAGGTGCAGCTGCAGGAG(SEQ ID NO:13)

5′VH 4-34 CTGCAACCGGTGTACATTCCCAGGTGCAGCTACAGCAGTG(SEQ ID NO:14)

5′VH 1-18 CTGCAACCGGTGTACATTCCCAGGTTCAGCTGGTGCAG(SEQ ID NO:15)

5′VH 1-24 CTGCAACCGGTGTACATTCCCAGGTCCAGCTGGTACAG(SEQ ID NO:16)

5′VH3-33 CTGCAACCGGTGTACATTCTCAGGTGCAGCTGGTGGAG(SEQ ID NO:17)

5′VH 3-9 CTGCAACCGGTGTACATTCTGAAGTGCAGCTGGTGGAG(SEQ ID NO:18)

5′VH4-39 CTGCAACCGGTGTACATTCCCAGCTGCAGCTGCAGGAG(SEQ ID NO:19)

5′VH 6-1 CTGCAACCGGTGTACATTCCCAGGTACAGCTGCAGCAG(SEQ ID NO:20)

3′JH 1/2/4/5 TGCGAAGTCGACGCTGAGGAGACGGTGACCAG(SEQ ID NO:21)

3′JH 3 TGCGAAGTCGACGCTGAAGAGACGGTGACCATTG(SEQ ID NO:22)

3′JH 6 TGCGAAGTCGACGCTGAGGAGACGGTGACCGTG(SEQ ID NO:23)

kappa light chain variable region PCR product

5′Vκ1-5 CTGCAACCGGTGTACATTCTGACATCCAGATGACCCAGTC(SEQ ID NO:24)

5′Vκ1-9 TTGTGCTGCAACCGGTGTACATTCAGACATCCAGTTGACCCAGTCT(SEQ ID NO:25)

5′Vκ1D-43 CTGCAACCGGTGTACATTGTGCCATCCGGATGACCCAGTC(SEQ ID NO:26)

5′Vκ2-24 CTGCAACCGGTGTACATGGGGATATTGTGATGACCCAGAC(SEQ ID NO:27)

5′Vκ2-28 CTGCAACCGGTGTACATGGGGATATTGTGATGACTCAGTC(SEQ ID NO:28)

5′Vκ2-30 CTGCAACCGGTGTACATGGGGATGTTGTGATGACTCAGTC(SEQ ID NO:29)

5′Vκ3-11 TTGTGCTGCAACCGGTGTACATTCAGAAATTGTGTTGACACAGTC(SEQ ID NO:30)

5′Vκ3-15CTGCAACCGGTGTACATTCAGAAATAGTGATGACGCAGTC(SEQ ID NO:31)

5′Vκ3-20 TTGTGCTGCAACCGGTGTACATTCAGAAATTGTGTTGACGCAGTCT(SEQ ID NO:32)

5′Vκ4-1 CTGCAACCGGTGTACATTCGGACATCGTGATGACCCAGTC(SEQ ID NO:33)

3′Jκ1/4 GCCACCGTACGTTTGATYTCCACCTTGGTC(SEQ ID NO:34)

3′Jκ2 GCCACCGTACGTTTGATCTCCAGCTTGGTC(SEQ ID NO:35)

3′Jκ3 GCCACCGTACGTTTGATATCCACTTTGGTC(SEQID NO:36)

3′Jκ5 GCCACCGTACGTTTAATCTCCAGTCGTGTC(SEQ ID NO:37)

(6) Heavy and light chains of the antibody gene were PCR amplified using the KOD-Plus-Neo (TOYOBO, KOD401) kit, respectively, in a 40. mu.L system: 3.5. mu.L of cDNA, 20nM mixed primer, 4. mu.L of buffer (buffer), 4. mu.L of 2mM dNTPs, 2.4. mu.L of LMgSO₄，1μL KOD。

(7) Reaction procedure: 94 ℃ for 2 min; 45 cycles: 10s at 98 ℃; at 58 ℃ for 30 s; 68 ℃ for 28 s.

(8) The amplified products were subjected to agarose gel, and as a result, it was found that the size of the antibody light chain was 327bp and the size of the heavy chain was 375 bp.

(9) The sequencing result of the antibody gene heavy chain variable region PCR product is shown as the sequence shown in SEQ ID NO. 1, and the corresponding amino acid sequence is shown as the sequence shown in SEQ ID NO. 2. The sequencing result of the antibody gene light chain variable region PCR product is shown as the sequence shown in SEQ ID NO. 3, and the corresponding amino acid sequence is shown as the sequence shown in SEQ ID NO. 4.

Designing and entrusting Invitrogen company to synthesize the full-length H gene of the heavy chain of the antibody gene according to the obtained heavy chain and light chain variable region sequence, wherein the H gene has BamH1/EcoR1 double enzyme cutting sites; and the full-length L gene of the light chain of the antibody gene, which carries the double enzyme cutting sites of Not1/Xho 1.

(10) The H gene and pcDNA3.1 are respectively subjected to BamH1/EcoR1 double enzyme digestion and then connected to form pcDNA3.1-H vector.

(11) The L gene and pcDNA3.1 were digested separately with Not1/Xho1 and ligated to form pcDNA3.1-L vector.

(12) 293F cells were cultured.

(13) Mu.g of pcDNA3.1-H (the nucleotide sequence of the H gene is shown in SEQ ID NO: 5) vector and 10. mu.g of pcDNA3.1-L (the nucleotide sequence of the L gene is shown in SEQ ID NO: 7) vector were co-transfected into 293F cells and cultured for 96 hours.

(14) Taking the supernatant to perform ELISA (ABC is the supernatant, DEF is the positive control, GH is the negative control); the specific experimental procedures of ELISA were as described above, and the results of ELISA are shown in Table 3 below and FIG. 3:

TABLE 3

Data of	450nm	Data of	450nm
				A	1.601	E	1.185
B	1.999	F	1.201
				C	1.785	G	0.0675
D	1.114	H	0.0554

As can be seen from the data in table 3 and fig. 3: the supernatant contained antibodies capable of binding to H7N9 virus.

(15) Purification process, specifically, the purification process of the fully human monoclonal antibody 2G3 is as follows:

(a) 200. mu.g of pcDNA3.1-L vector and 100. mu.g of pcDNA3.1-H vector were co-transfected into 300ml of 293F cells and cultured for 96 hours.

(b) The supernatant was collected, applied to a proteinA affinity column, washed with 10-fold PBS, and 2ml of 0.1M glycine (ph 3.0) was added to collect the antibody. Mu.l of a neutralization buffer (1M Tri-HCL) was added to the collection tubes to neutralize in time the pH of the eluted antibody fluid.

(c) Dialyzed against Phosphate Buffered Saline (PBS), and after dialysis, recently used was stored at 4 ℃ for a long period of time at-20 ℃. In total, 500. mu.g of 2G3 pure antibody was obtained, the amino acid sequence of the heavy chain is shown in SEQ ID NO. 6, and the amino acid sequence of the light chain is shown in SEQ ID NO. 8.

EXAMPLE 3 neutralization assay and antibody affinity assay of purified fully human monoclonal antibody 2G3

(1) Purpose of experiment

The inhibitory effect and effect of the 2G3 antibody on H7N9 influenza virus were evaluated by a microneutralization-ELISA assay using a virus-infected cell model (canine kidney cell MDCK), and the antibody was tested for anti-influenza virus activity.

(2) Experimental procedure

(2.1) cell plating

Pancreatin digesting MDCK canine kidney cells in logarithmic growth phase, centrifuging and collecting after termination, blowing off uniformly to prepare single cell suspension, adjusting cell concentration to 5 × 10 with cell culture solution⁴Inoculating to 96-well cell culture plate, placing the cells at 37 deg.C and 5% CO₂The culture was carried out overnight in an incubator.

(2.2) pretreatment of 2G3 antibody with H7N9 virus (the virus A/Anhui/1/2013 was obtained from institute of microbiology, national academy of sciences)

2G3 antibody sets up 10 concentration gradients which are 10-10 in sequence¹⁰Dilution was doubled with 3 parallel wells for each concentration in each group.

(2.3) viral infection

The cell culture supernatant cultured in step (2.1) was discarded and washed 3 times with PBS. The premixed antibody-virus mixture (at 10)²Mu.g/ml 2G3 monoclonal antibody in turn 10-10¹⁰Double dilution, each concentration of 2G3 antibody with an equal volume of 100TCID₅₀The viruses were mixed to obtain the mixture). Add 96-well cell culture plates, incubate at 37 ℃ for 1h, aspirate the mixture and wash with PBS 2 times.

(2.4) preparation of a maintenance liquid

TPCK-Trypsin (TPCK-Trypsin) (maintenance medium) was added to serum-free DMEM at a final concentration of 2. mu.g/ml. PBS in a 96-well plate was discarded, 100. mu.l of maintenance medium was added to each well, and the mixture was incubated at 37 ℃ with 5% CO₂The incubator is used for 20 h.

(2.5) neutralization assay-ELISA method

(2.5.1) discarding the maintenance solution in the microplate;

(2.5.2) washing the cells once with 100. mu.l PBS;

(2.5.3) discard PBS (not allow cells to dry) and add 50 μ l/well fixative (volume ratio acetone: absolute ethanol 2: 3);

(2.5.4) covering the microplate, and fixing the cells at room temperature for 10 min;

(2.5.5) discard the fixative, wash the cells with 100. mu.l PBS, repeat the wash 3 times (gently shaking to avoid vigorous washing) to remove residual acetone.

(2.5.6) blocking the cells with 5% skim milk powder at room temperature for 1h, washing the cells 1 time with 100. mu.l PBS;

(2.5.7) coating with PBS 1: dilution 1 of the antibody (commercially available NP monoclonal antibody against H7N 9) was added to each well in 50. mu.l of the diluted antibody, and the mixture was allowed to act at room temperature for 1 hour.

(2.5.8) wash the plate 5 times with 100. mu.l PBST to remove 1 antibody;

(2.5.9) 2 anti (HRP-bearing anti-mouse IgG antibody) was diluted 1:2000 with PBS and 50. mu.l was added to each well and allowed to act at room temperature for 1 hour.

(2.5.10) plates were washed 6 times with 100. mu.l PBST to remove 2 antibody.

(2.5.11) 50. mu.l of TMB developing solution was added to each well.

(2.5.12) after development of color at room temperature for about 10 minutes in the absence of light, 50. mu.l of 2M hydrochloric acid was added to each well to terminate the reaction.

(2.5.13) read the OD per well on an ELISA assay (450 nm).

(3) Statistical analysis

Data were analyzed and dose-response curves were plotted using GraphPad Prism 6.0.1, and IC was calculated₅₀. Inhibition rate calculation formula:

inhibition rate was 100% (OD well-OD negative cell control well) - (OD drug well-OD negative cell control well) ]/(OD well-OD negative cell control well) × 100%.

The resulting structure is shown in FIG. 4, from which FIG. 4 the IC of 2G3 can be seen₅₀＝0.0711ug/mL。

As can be seen from example 3, the present application 2G3 has good IC for H7N9₅₀The value proves that 2G3 has good virus neutralizing capacity.

The application compares the application number of the monoclonal antibody 2L11 submitted to the intellectual property office of China in 2016 (05 years) and 10 days, the application number of the monoclonal antibody 2L11 is 201610303416.X, the invention name of the monoclonal antibody is anti-H7N 9 (all-human), the preparation method thereof and the application thereof, the monoclonal antibody 2J17 submitted to the intellectual property office of China in 2016 (05 months) and 03 days, the application number of the monoclonal antibody is 201610288358.8, the invention name of the monoclonal antibody 2J17 is anti-H7N 9 (all-human), the preparation method thereof and the application thereof, and the monoclonal antibody 5J13 submitted to the intellectual property office of China in 2016 (11 months) and 11 days, the application number of the monoclonal antibody 5J13 is 201611038444.X, the invention name of the monoclonal antibody 5J13 is anti-H7N 9, the preparation thereof and the application thereof. Application 2G3 neutralization of active IC₅₀0.0711ug/mL, whereas the 2L11 and 2J17 antibodies had no neutralizing activity. The 2G3 antibody of the present application has a lower IC than the 5J13 antibody₅₀And more potent neutralizing activity, the virus can be killed using low doses of antibody.

Antibody affinity detection:

the affinity detection instrument is Fortebio of PALL, 200 μ l of 50 μ G/ml 2G3 antibody is prepared, the binding protein A sensor is carried out for 120 seconds, HA antigen is prepared into 100nM, 50nM, 2.5nM, 12.5nM, 6.25nM and 0nM concentration solution, the binding antibody is carried out for 120 seconds, the dissociation time is 5 minutes, the 2G3 HAs higher affinity to H7N9 virus, KD is 2.3 × 10^-9M。

Finally, the description is as follows: the above embodiments are only used for illustrating the implementation processes and features of the present application, and not for limiting the technical solutions of the present application, and although the present application is described in detail with reference to the above embodiments, those skilled in the art should understand that: modifications and equivalents may be made thereto without departing from the spirit and scope of the present application, and it is intended to cover any modifications or partial substitutions within the scope of the present application.

Sequence listing

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> anti-H7N 9 fully human monoclonal antibody 2G3, and preparation method and application thereof

<130>GAI18CN6458

<160>37

<170>SIPOSequenceListing 1.0

<210>1

<211>375

<212>DNA

<213> Artificial sequence ()

<400>1

caagtgcagc tggtggagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60

tcctgcaagg cttctggata catattcacc agttatgaga tcaactgggt gcgacaggcc 120

actggccaag ggcttgagtg gatgggatgg atgaaccctg agagtggtga gacaggcttt 180

gcacagaagt tccagggcag agtcaccatg accaggaaca cctccataac cacagcctac 240

atggagctga gcagcctgac ttctgaggac acggccgtgt attactgtgc gacaggaaat 300

gcggaatgta gtggtggtag ctgctacaat tggttcgaac cctggggcca gggaaccctg 360

gtcaccgtct cctca 375

<210>2

<211>114

<212>PRT

<213> Artificial sequence ()

<400>2

Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr Ser Tyr

20 25 30

Glu Ile Asn Trp Val Arg Gln Ala Thr Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Met Asn Pro Glu Ser Gly Glu Thr Gly Phe Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Met Thr Arg Asn Thr Ser Ile Thr Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Thr Gly Asn Ala Glu Cys Ser Gly Gly Ser Cys Tyr Asn Trp Phe

100 105 110

Glu Pro

<210>3

<211>327

<212>DNA

<213> Artificial sequence ()

<400>3

tcgtctgagc tgactcagga ccctgctgtg tctgtggcct tgggacagac agtcaggatc 60

acatgccaag gagacaaact caaaagctat tatgcaagct ggtaccagca gaagccagga 120

caggcccctg tacttgtcat ctatggtaga aacaaccggc cctcagggat cccagaccga 180

ttctctggct ccagctcagg aaacacagct tccttgacca tcactggggc tcaggcggaa 240

gatgaggctg actattactg taactccaag gagaccagtg gttaccatct ggtgttcggc 300

ggagggacca agctgaccgt cctagta 327

<210>4

<211>109

<212>PRT

<213> Artificial sequence ()

<400>4

Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln

1 5 10 15

Thr Val Arg Ile Thr Cys Gln Gly Asp Lys Leu Lys Ser Tyr Tyr Ala

20 25 30

Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr

35 40 45

Gly Arg Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser

50 55 60

Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Lys Glu Thr Ser Gly Tyr His

85 90 95

Leu Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Val

100 105

<210>5

<211>1416

<212>DNA

<213> Artificial sequence ()

<400>5

atgggctggt cctgcatcat cctgttcctg gtggccaccg ccaccggcca agtgcagctg 60

gtggagtctg gggctgaggt gaagaagcct ggggcctcag tgaaggtctc ctgcaaggct 120

tctggataca tattcaccag ttatgagatc aactgggtgc gacaggccac tggccaaggg 180

cttgagtgga tgggatggat gaaccctgag agtggtgaga caggctttgc acagaagttc 240

cagggcagag tcaccatgac caggaacacc tccataacca cagcctacat ggagctgagc 300

agcctgactt ctgaggacac ggccgtgtat tactgtgcga caggaaatgc ggaatgtagt 360

ggtggtagct gctacaattg gttcgaaccc tggggccagg gaaccctggt caccgtctcc 420

tcagctagca ccaagggccc atcggtcttc cccctggcac cctcctccaa gagcacctct 480

gggggcacag cggccctggg ctgcctggtc aaggactact tccccgaacc ggtgacggtg 540

tcgtggaact caggcgccct gaccagcggc gtgcacacct tcccggccgt cctacagtcc 600

tcaggactct actccctcag cagcgtggtg accgtgccct ccagcagctt gggcacccag 660

acctacatct gcaacgtgaa tcacaagccc agcaacacca aggtggacaa gagagttgag 720

cccaaatctt gtgacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 780

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 840

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 900

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 960

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 1020

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 1080

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggat 1140

gagctgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 1200

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 1260

gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 1320

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca caaccactac 1380

acgcagaaga gcctctccct gtctccgggt aaatga 1416

<210>6

<211>455

<212>PRT

<213> Artificial sequence ()

<400>6

Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

15 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr Ser Tyr

20 25 30

Glu Ile Asn Trp Val Arg Gln Ala Thr Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Met Asn Pro Glu Ser Gly Glu Thr Gly Phe Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Met Thr Arg Asn Thr Ser Ile Thr Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Thr Gly Asn Ala Glu Cys Ser Gly Gly Ser Cys Tyr Asn Trp Phe

100 105 110

Glu Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr

115 120 125

Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser

130 135 140

Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu

145 150 155 160

Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His

165170 175

Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser

180 185 190

Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys

195 200 205

Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu

210 215 220

Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

225 230 235 240

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

245 250 255

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

260 265 270

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

275 280 285

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

290 295 300

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

305 310 315 320

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

325330 335

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

340 345 350

Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys

355 360 365

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

370 375 380

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

385 390 395 400

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

405 410 415

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

420 425 430

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

435 440 445

Leu Ser Leu Ser Pro Gly Lys

450 455

<210>7

<211>696

<212>DNA

<213> Artificial sequence ()

<400>7

atgggctggt cctgcatcat cctgttcctg gtggccaccg ccaccggctc gtctgagctg 60

actcaggacc ctgctgtgtc tgtggccttg ggacagacag tcaggatcac atgccaagga 120

gacaaactca aaagctatta tgcaagctgg taccagcaga agccaggaca ggcccctgta 180

cttgtcatct atggtagaaa caaccggccc tcagggatcc cagaccgatt ctctggctcc 240

agctcaggaa acacagcttc cttgaccatc actggggctc aggcggaaga tgaggctgac 300

tattactgta actccaagga gaccagtggt taccatctgg tgttcggcgg agggaccaag 360

ctgaccgtcc tagtaaccgt ggccgccccc tccgtgttca tcttcccccc ctccgacgag 420

cagctgaagt ccggcaccgc ctccgtggtg tgcctgctga acaacttcta cccccgggag 480

gccaaggtgc agtggaaggt ggacaacgcc ctgcagtccg gcaactccca ggagtccgtg 540

accgagcagg actccaagga ctccacctac tccctgtcct ccaccctgac cctgtccaag 600

gccgactacg agaagcacaa ggtgtacgcc tgcgaggtta cccaccaggg cctgtcctcc 660

cccgtgacca agtccttcaa ccggggcgag tgctag 696

<210>8

<211>215

<212>PRT

<213> Artificial sequence ()

<400>8

Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln

1 5 10 15

Thr Val Arg Ile Thr Cys Gln Gly Asp Lys Leu Lys Ser Tyr Tyr Ala

20 25 30

Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr

35 4045

Gly Arg Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser

50 55 60

Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Lys Glu Thr Ser Gly Tyr His

85 90 95

Leu Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Val Thr Val Ala

100 105 110

Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser

115 120 125

Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu

130 135 140

Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser

145 150 155 160

Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu

165 170 175

Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val

180 185 190

Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys

195 200 205

Ser Phe Asn Arg Gly Glu Cys

210 215

<210>9

<211>38

<212>DNA

<213> Artificial sequence ()

<400>9

ctgcaaccgg tgtacattcc caggtgcagc tggtgcag 38

<210>10

<211>38

<212>DNA

<213> Artificial sequence ()

<400>10

ctgcaaccgg tgtacattcc gaggtgcagc tggtgcag 38

<210>11

<211>38

<212>DNA

<213> Artificial sequence ()

<400>11

ctgcaaccgg tgtacattct gaggtgcagc tggtggag 38

<210>12

<211>38

<212>DNA

<213> Artificial sequence ()

<400>12

ctgcaaccgg tgtacattct gaggtgcagc tgttggag 38

<210>13

<211>38

<212>DNA

<213> Artificial sequence ()

<400>13

ctgcaaccgg tgtacattcc caggtgcagc tgcaggag 38

<210>14

<211>40

<212>DNA

<213> Artificial sequence ()

<400>14

ctgcaaccgg tgtacattcc caggtgcagc tacagcagtg 40

<210>15

<211>38

<212>DNA

<213> Artificial sequence ()

<400>15

ctgcaaccgg tgtacattcc caggttcagc tggtgcag 38

<210>16

<211>38

<212>DNA

<213> Artificial sequence ()

<400>16

ctgcaaccgg tgtacattcc caggtccagc tggtacag 38

<210>17

<211>38

<212>DNA

<213> Artificial sequence ()

<400>17

ctgcaaccgg tgtacattct caggtgcagc tggtggag 38

<210>18

<211>38

<212>DNA

<213> Artificial sequence ()

<400>18

ctgcaaccgg tgtacattct gaagtgcagc tggtggag 38

<210>19

<211>38

<212>DNA

<213> Artificial sequence ()

<400>19

ctgcaaccgg tgtacattcc cagctgcagc tgcaggag 38

<210>20

<211>38

<212>DNA

<213> Artificial sequence ()

<400>20

ctgcaaccgg tgtacattcc caggtacagc tgcagcag 38

<210>21

<211>32

<212>DNA

<213> Artificial sequence ()

<400>21

tgcgaagtcg acgctgagga gacggtgacc ag 32

<210>22

<211>34

<212>DNA

<213> Artificial sequence ()

<400>22

tgcgaagtcg acgctgaaga gacggtgacc attg 34

<210>23

<211>33

<212>DNA

<213> Artificial sequence ()

<400>23

tgcgaagtcg acgctgagga gacggtgacc gtg 33

<210>24

<211>40

<212>DNA

<213> Artificial sequence ()

<400>24

ctgcaaccgg tgtacattct gacatccaga tgacccagtc 40

<210>25

<211>46

<212>DNA

<213> Artificial sequence ()

<400>25

ttgtgctgca accggtgtac attcagacat ccagttgacc cagtct 46

<210>26

<211>40

<212>DNA

<213> Artificial sequence ()

<400>26

ctgcaaccgg tgtacattgt gccatccgga tgacccagtc 40

<210>27

<211>40

<212>DNA

<213> Artificial sequence ()

<400>27

ctgcaaccgg tgtacatggg gatattgtga tgacccagac 40

<210>28

<211>40

<212>DNA

<213> Artificial sequence ()

<400>28

ctgcaaccgg tgtacatggg gatattgtga tgactcagtc 40

<210>29

<211>40

<212>DNA

<213> Artificial sequence ()

<400>29

ctgcaaccgg tgtacatggg gatgttgtga tgactcagtc 40

<210>30

<211>45

<212>DNA

<213> Artificial sequence ()

<400>30

ttgtgctgca accggtgtac attcagaaat tgtgttgaca cagtc 45

<210>31

<211>40

<212>DNA

<213> Artificial sequence ()

<400>31

ctgcaaccgg tgtacattca gaaatagtga tgacgcagtc 40

<210>32

<211>46

<212>DNA

<213> Artificial sequence ()

<400>32

ttgtgctgca accggtgtac attcagaaat tgtgttgacg cagtct 46

<210>33

<211>40

<212>DNA

<213> Artificial sequence ()

<400>33

ctgcaaccgg tgtacattcg gacatcgtga tgacccagtc 40

<210>34

<211>30

<212>DNA

<213> Artificial sequence ()

<400>34

gccaccgtac gtttgatytc caccttggtc 30

<210>35

<211>30

<212>DNA

<213> Artificial sequence ()

<400>35

gccaccgtac gtttgatctc cagcttggtc 30

<210>36

<211>30

<212>DNA

<213> Artificial sequence ()

<400>36

gccaccgtac gtttgatatc cactttggtc 30

<210>37

<211>30

<212>DNA

<213> Artificial sequence ()

<400>37

gccaccgtac gtttaatctc cagtcgtgtc 30

Claims

1. An anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived therefrom that specifically binds H7N9, wherein the amino acid sequences of the heavy and light chain CDR1, CDR2 and CDR3 regions of said antibody are as follows:

heavy chain CDR1: GYIFTYE;

heavy chain CDR2, MNPESGET;

heavy chain CDR3: ATGNAECSGGSCYNWFEP;

light chain CDR1: KLKSYY;

light chain CDR2: GRN;

light chain CDR3: NSKETSGYHLV.

2. The anti-H7N 9 fully human monoclonal antibody 2G3 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N9 according to claim 1, wherein the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO. 2, or the amino acid sequence with equivalent functions formed by replacing, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2; and/or

The amino acid sequence of the light chain variable region of the antibody is shown as SEQ ID NO. 4, or the amino acid sequence with the same function is formed by replacing, deleting or adding one or more amino acids in the sequence shown as SEQ ID NO. 4;

preferably, the heavy chain amino acid sequence of the antibody is shown as SEQ ID NO. 6, or the amino acid sequence with the same function formed by replacing, deleting or adding one or more amino acids in the sequence shown as SEQ ID NO. 6; and/or

The light chain amino acid sequence of the antibody is shown as SEQ ID NO. 8, or the amino acid sequence with the same function is formed by replacing, deleting or adding one or more amino acids in the sequence shown as SEQ ID NO. 8.

3. A gene encoding the anti-H7N 9 fully human monoclonal antibody 2G3 of claim 1 or 2 or a biologically active fragment derived therefrom capable of specifically binding to H7N 9; preferably, the gene comprises a nucleotide sequence which codes for an amino acid with the amino acid sequence shown in SEQ ID NO. 2, more preferably, the nucleotide sequence of the gene is shown in SEQ ID NO. 1; and/or

The gene comprises a nucleotide sequence which codes amino acid shown as SEQ ID NO. 4, and preferably, the nucleotide sequence of the gene is shown as SEQ ID NO. 3.

4. The gene of claim 3, wherein the gene comprises a nucleotide sequence encoding an amino acid sequence shown as SEQ ID NO. 6, preferably the nucleotide sequence of the gene is shown as SEQ ID NO. 5; and/or

The gene comprises a nucleotide sequence which codes amino acid shown as SEQ ID NO. 8, and preferably, the nucleotide sequence of the gene is shown as SEQ ID NO. 7.

5. A vector comprising the gene of claim 3 or 4.

6. A cell containing the gene according to claim 3 or 4 or the vector according to claim 5.

7. A method of producing the anti-H7N 9 fully human monoclonal antibody 2G3 of claim 1 or 2, or a biologically active fragment derived therefrom that specifically binds H7N9, the method comprising:

culturing a genetically engineered cell comprising the gene of claim 3 or 4, or the vector of claim 5, encoding the heavy and light chain of fully human monoclonal antibody 2G3 against H7N9, or directly culturing the cell of claim 6; collecting and purifying to obtain the anti-H7N 9 fully human monoclonal antibody 2G 3.

8. A pharmaceutical composition comprising the anti-H7N 9 fully human monoclonal antibody 2G3 of claim 1 or 2 or a biologically active fragment derived therefrom that is capable of specifically binding H7N 9.

9. Use of the anti-H7N 9 fully human monoclonal antibody 2G3 of claim 1 or 2 or a biologically active fragment derived therefrom that specifically binds to H7N9, or the pharmaceutical composition of claim 8 in the manufacture of a medicament for the treatment of a disease caused by the H7N9 virus.

10. A kit for detecting the level of H7N9 virus, comprising the anti-H7N 9 fully human monoclonal antibody 2G3 of claim 1 or 2, or a biologically active fragment derived therefrom that specifically binds to H7N 9; preferably, the kit further comprises: a second antibody and an enzyme for detection or a fluorescent or radioactive label, and a buffer; preferably, the second antibody is an anti-antibody against the monoclonal antibody 2G3 of claim 1 or 2.