CN111308091B

CN111308091B - Cas 9-sgRNA-based virus LTR immunoprecipitation screening for regulation and control of viral transcription targets

Info

Publication number: CN111308091B
Application number: CN202010131159.2A
Authority: CN
Inventors: 于丹; 刘荣雕; 高祥; 姚开虎
Original assignee: Beijing Childrens Hospital
Current assignee: Beijing Childrens Hospital
Priority date: 2020-02-28
Filing date: 2020-02-28
Publication date: 2020-10-30
Anticipated expiration: 2040-02-28
Also published as: CN111948403B; CN111948403A; CN111308091A

Abstract

The invention discloses a method for screening and controlling a virus transcription target by using a virus LTR immunoprecipitation based on Cas9-sgRNA and application thereof. The invention adopts Cas9-sgRNA combined immunoprecipitation for the first time to detect the host protein of the interaction of the LTR of the HIV promoter region, and proves that the method can be used for screening the host protein which is combined with the virus LTR to regulate the transcription of the HIV-1 gene, and has the advantages of high efficiency, objectivity, accuracy and the like; meanwhile, the invention screens out a host protein CNOT1 which can regulate and control the transcription of the virus based on the method.

Description

Cas 9-sgRNA-based virus LTR immunoprecipitation screening for regulation and control of viral transcription targets

Technical Field

The invention belongs to the technical field of protein screening, and particularly relates to a method for screening and controlling a virus transcription target by combining Cas 9-sgRNA-based virus LTR immunoprecipitation with mass spectrometry analysis and application.

Background

The virus is one of the chief causes of the global non-smoke warfare in recent years, and is an important task for scientists in the screening of antiviral drug targets and the research and development of new drugs. After the virus invades the host cell, host proteins are responsible for transcription of viral nucleic acids inside the cell, synthesizing the complete viral mRNA, which is an essential step for most virus assembly and mass propagation and is also a major target for antiviral drugs. The antiviral drugs on the market in the world are very limited, and the severe virus epidemic situation urgently needs the invention to accelerate the target search of the antiviral drugs and the research and development of new drugs.

At present, the main means for researching the regulation and control of viral gene transcription by host protein are as follows: (1) starting from a single protein: after the sequence of the viral promoter region is analyzed, a potential conserved binding site of the host transcription factor binding protein is found, and then the transcription function research is carried out. The disadvantage of this approach is that the transcription protein being studied needs to be a binding sequence that is widely studied and known to be conserved. (2) Based on high-throughput analysis means such as proteomics, transcriptomics and the like, host protein expression difference before and after virus infection is compared, and host proteins possibly directly or indirectly participating in virus transcription regulation are searched. The method has the defect that most of host proteins with differential expression are not directly involved in the process of virus gene transcription regulation, but probably are the overall reaction of the host after virus infection, and are not specific to the research of virus gene transcription regulation. (3) sgRNA/shRNA library screening: after the host gene is knocked down or knocked out through the library, host protein influencing virus gene transcription is screened, and then the transcription function verification is carried out. This approach has the disadvantage that deletion of many key genes can affect cell growth, such as essential genes for cell survival, etc. The noise background of the gene knockdown often influences the screening result, and obvious indirect effects exist. (4) The biotin probe is combined with a virus promoter segment, for example, beads coupled with streptomycin are used for separating and purifying host protein interacting with the segment, although the regulation factor found by the method is more direct, the specificity of the protein enriched by the method is poor because the non-specificity of the combination of the biotin-labeled probe and the fragmented DNA is higher.

Based on the fact that all DNA viruses and retroviruses undergo a transcription process in which host proteins are involved in the synthesis of viral mRNA, this process requires Long terminal repeats LTR (LTR), the region where the viral promoter is located, to interact with the host protein to regulate viral gene transcription. In conclusion, screening for host proteins that interact directly with the viral LTR promoter region is the most direct method to find the regulation of viral transcription.

With the maturation and development of CRISPR-Cas9 technology, various manipulation methods are derived based on this technology, including the use of targeted function of Cas9 to find interacting proteins at specific regions on chromosomes. However, the Cas9 targeting property is not reported at home and abroad to assist in screening virus LTR interaction protein. The viral genome does not naturally exist on a host cell chromosome, even if the immunoprecipitation is manually operated to integrate a viral promoter onto the host chromosome, the DNA copy number is very low, high-efficiency interaction protein enrichment is difficult to realize, and the operation of introducing live viruses greatly limits the range of an operable laboratory, which are main problems for limiting the application of the CRISPR-Cas9 technology to the interaction screening of viral DNA and protein.

Human Immunodeficiency Virus (HIV) is a worldwide significant infectious disease that seriously harms Human health, and no drug has been available to date to completely eliminate HIV in patients. HIV is divided into HIV-1 and HIV-2 types, and the major research is currently focused on HIV-1, since type 1 accounts for more than 95% of the worldwide epidemics. The transcriptional regulation of the HIV-1 gene is mainly dependent on the binding of host proteins in the HIV-1LTR region. The HIV-1LTR contains upstream DNA regulatory sequences of transcription initiation factor interaction, including binding sites of multiple transcription factors, TATA sequence and a highly active initiator sequence, and the interaction condition of the transcription factors and the LTR determines the strength of HIV-1 transcription activity. Further search for new proteins that interact with the HIV-1LTR is the basis for finding new targets for antiviral drugs.

The invention is provided in view of the above.

Disclosure of Invention

As HIV-1LTR is the promoter region which is most widely applied to lentiviral vectors at present and is an ideal and typical viral LTR representative, the invention takes the example as an example to optimize the screening experiment method of the viral promoter region LTR interacting protein. The invention is based on CRISPR-Cas9 technology for the first time, the virus full-length 5' LTR is transiently transfected in a host cell, the virus LTR immunoprecipitation of Cas9/sgRNA is adopted to detect the host protein interacted with the virus promoter LTR region, and a successfully established system proves that the experimental process can be used for screening the host protein combined with the virus LTR, and no relevant research report exists at home and abroad at present.

Therefore, the first objective of the invention is to provide a method for screening interaction protein with viral LTR by using Cas 9-sgRNA-based viral LTR immunoprecipitation, and a method for screening a target for regulating viral transcription;

the second purpose of the invention is to provide the identified host protein CNOT1 interacting with LTR for the related application of regulating the transcription of virus genes and the like;

in order to realize the purpose of the invention, the invention achieves the realization of the endogenous interaction effectiveness by designing sgRNA of a specific targeting LTR region, transcribing the sgRNA in vitro and purifying dCas9 with a label, incubating the sgRNA and the DNA with ultrasonic disruption after incubating and combining the sgRNA in vitro and the DNA with ultrasonic disruption, enriching proteins interacting with LTR after immunoprecipitation, analyzing and identifying the obtained protein information by mass spectrum and the like, and verifying the test effectiveness by ChIP-q-PCR and the like on the condition of the viral LTR region interacting protein integrated in cells. Finally, the interaction protein obtained directly binding to the viral LTR region was further evaluated for its effect on viral gene transcription. It can be seen that the screening method of the present invention mainly utilizes the targeting connection of sgRNA to establish the connection between Cas9 and LTR, so that proteins interacting with LTR are immunoprecipitated based on the tag of Cas 9. Thus, although the examples of the invention only exemplify experiments with dCas9, it is reasonable to expect in the art that an inactivated Cas9 protein is equally suitable for the present invention and is within the scope of the present invention.

The invention specifically provides the following technical scheme:

the invention provides a method for screening interaction protein with virus LTR or screening and regulating a virus transcription target, which is characterized in that the method is based on Cas9-sgRNA virus LTR immunoprecipitation and comprises the following steps:

1) preparing a complex Cas9-sgRNA against the viral LTR region;

2) incubating the complex Cas9-sgRNA with a cell lysate containing the viral LTR;

3) immunoprecipitation enriches proteins that interact with LTR;

in some embodiments, the steps further comprise the steps of:

4) identifying proteins that interact with the LTR.

In some embodiments, the step 1) of preparing a complex Cas9-sgRNA against a viral LTR region further comprises:

a. designing and preparing sgRNA specifically targeting LTR;

b. preparing Cas 9;

c. preparation of complex Cas 9-sgRNA.

Further, step a also includes a rapid identification step of the effective LTR sgRNA, such as a reporter system for LTR fusion luciferase expression: different sgRNA sequences are respectively constructed to a plasmid containing Cas9, the plasmid and a luciferase report plasmid containing LTR as a promoter are co-transferred into cells, and effective sgRNAs are screened based on the luciferase expression quantity.

Further, Cas9 prepared in step b is tagged Cas9, tagging is mainly used for immunoprecipitation, exemplarily, 3 × Flag, Strep, HA, etc.;

further, in step c, after quantification using the tagged Cas9 and sgRNA, the resulting protein was purified by 1 × buffer (20mM Hepes ph7.9,100mm NaCl,5mM MgCl) according to Cas9: sgRNA mole number 1:3₂) In vitro incubation in solution.

In some embodiments, the cell lysate containing viral LTR in step 2) is prepared as follows: transfecting LTR plasmid in Hela cell, fixing, collecting cell, adding SDS lysate containing proteinase inhibitor and DTT to resuspend cell, and DNA fragmenting, preferably to obtain DNA fragment of 500-1000 bp.

In some embodiments, said step 3) immunoprecipitation enriches proteins that interact with LTRs, using tag-beads, preferably Flag beads, for incubation; after eluting the beads with the DNA product, a protein product is obtained.

In some embodiments, the identification in step 4) may be any protein identification method in the art, for example, some may employ common experimental methods including but not limited to immunoblotting, mass spectrometry, sequencing analysis, and the like; preferably, the proteins that interact with the LTRs are analyzed by mass spectrometry.

In some preferred embodiments, the virus is all DNA viruses such as adenovirus and all retroviruses, and includes all RNA viruses containing a typical 5' LTR; preferably the HIV virus; more preferably, it is an HIV-1 type virus.

In some preferred embodiments, the Cas9 protein is Cas9 with no cleavage activity.

In some preferred embodiments, the protein is a host protein.

In some preferred embodiments, the sgRNA is any one or a combination of sgrnas shown in SEQ ID nos. 5,6, 7; preferably, the sgRNA is a combination of sgrnas shown in SEQ ID nos. 5 and 6 and 7.

The invention also provides application of the virus LTR immunoprecipitation based on the Cas9-sgRNA in screening virus LTR interacting protein or screening a target for regulating and controlling virus transcription;

in some embodiments, the application comprises the steps of:

1) preparing a complex Cas9-sgRNA against the viral LTR region;

3) immunoprecipitation enriches proteins that interact with LTR;

preferably, the method further comprises 4) identifying the interacting protein.

The invention also provides a system for screening the virus LTR interaction protein or screening and regulating the virus transcription target, which is characterized in that the system comprises a Cas9 protein, sgRNA, virus LTR and corresponding immunoprecipitation components;

in some embodiments, the system implements the steps of:

1) preparing a complex Cas9-sgRNA against the viral LTR region;

3) immunoprecipitation enriches proteins that interact with LTR;

In some embodiments, the system is a screening kit.

In some embodiments, the viruses in the above methods, uses and systems include all DNA viruses such as adenovirus and all retroviruses, and include all RNA viruses containing a typical 5' LTR; preferably the HIV virus; more preferably, HIV-1 type virus; in some preferred embodiments, the Cas9 protein is Cas9 with no cleavage activity; in some preferred embodiments, the protein is a host protein; in some preferred embodiments, the sgRNA is any one or a combination of sgrnas shown in SEQ id nos. 5,6, 7; preferably, the sgRNA is a combination of sgrnas shown in SEQ ID nos. 5 and 6 and 7.

The invention also provides a method for regulating the transcription of the HIV virus in the cells, which is characterized in that the method regulates the activity or the content of the CNOT1 protein in the cells to regulate the transformation rate of the HIV virus in the cells.

In some embodiments, the modulation is inhibition, modulating HIV viral transcription in a cell by decreasing CNOT1 activity or protein content in the cell; or the regulation is enhancement, and HIV virus transcription is activated by increasing the activity or content of CNOT 1.

In some embodiments, the cell is a host cell.

The invention also provides application of the CNOT1 protein in regulation and control of HIV virus transcription in cells.

In some embodiments, the cell is a host cell.

The invention also provides a composition characterized in that it comprises viral LTR and CNOT 1.

The invention also provides a compound of the separated virus LTR and CNOT1 protein.

The invention also provides application of the CNOT1 protein or the composition or the complex thereof in preparing a medicament, a reagent or a composition for regulating and controlling virus transcription.

The invention also provides application of the CNOT1 protein in screening or identifying compounds for inhibiting HIV virus transcription, which is characterized in that the compounds for inhibiting virus transcription are screened or identified by monitoring the condition that the combination of CNOT1 and LTR is regulated or improved by the compounds.

The invention also provides application of the CNOT1 protein in identifying the virus infection stage in host cells, which is characterized in that the identification is carried out by detecting the content of the CNOT1 protein or the combination of the CNOT1 and LTR in the host cells; preferably, the virus infection phases are a virus latent phase and an active phase.

In some embodiments, the virus is an HIV virus, preferably an HIV-type 1 virus.

In some embodiments, the CNOT1 protein sequence is as shown in figure 4.

The invention has the beneficial technical effects that:

1) the screening method can realize efficient interaction protein enrichment for a sample with low DNA copy quantity, has high sensitivity, is applied to screening of host protein of virus LTR interaction for the first time, and can be used for screening targets for regulating and controlling virus transcription.

2) The method adopts sgRNA in-vitro transcription and Cas9 in-vitro purification, effectively ensures the purification efficiency and quality of sgRNA and Cas9, and ensures convenient and controllable experiment operation.

3) According to the invention, through designing a plurality of sgRNAs, optimally screening 3 sgRNAs efficiently targeting different regions of LTR and mixing the sgRNAs to guide Cas9 to LTR, and through experiments, the effectiveness of the strategy is proved.

4) The invention successfully screens and identifies the protein CNOT1 interacting with the virus LTR for the first time, and proves that the protein CNOT1 can regulate the transcription of the virus for the first time, can be used as an effective drug target and is used for preventing, diagnosing and treating HIV related diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

Fig. 1 sgRNA design;

FIG. 2 determination of the effectiveness of sgRNA in targeting LTR by detecting luciferase expression;

FIG. 3 Coomassie blue staining to detect purified dCas9 protein;

FIG. 4 Western-blot detection of purified dCas9 protein;

FIG. 5 results of PCR amplified DNA templates;

fig. 6 sgRNA products transcribed in vitro;

FIG. 7 ChIP-qPCR confirmed the binding of dCas9 to the HIV-1LTR region and dCas9 to the HIV-1 Nascent region.

FIG. 8 ChIP-qPCR confirmed the binding of dCas9 to the HIV-1LTR region and dCas9 to the HIV-1 Promoter region.

FIG. 9 ChIP-qPCR confirmed the binding of dCas9 to the HIV-1LTR region and dCas9 to the control GAPDH region.

FIG. 10 ChIP-qPCR detects the binding of CNOT1 in the LTR region.

FIG. 11 knockdown of CNOT1 by shRNA.

FIG. 12 Effect of CNOT1 knockdown on HIV-1 gene transcription.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Definition of partial terms

Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.

As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.

Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.

The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

The following terms or definitions are provided only to aid in understanding the present invention. These definitions should not be construed to have a scope less than understood by those skilled in the art.

Some technical terms in the present invention are explained as follows:

as used herein, "Immunoprecipitation (IP)" refers to Immunoprecipitation (Immunoprecipitation) in which an antibody against a specific target Protein forms an immune complex with a target Protein in a sample (cell lysate, etc.), and then the immune complex is precipitated from the mixture using Protein A-beads or Protein G-beads. Finally, the target protein is eluted from the magnetic beads, and the eluted protein is analyzed by means of SDS-PAGE, Western Blot and the like.

The invention relates to a virus LTR immunoprecipitation (dCas9/sgRNA-guidedviral LTR IP) based on Cas9-sgRNA, which is based on the principle of CRISPR-Cas9, by designing specific sgRNA targeting LTR region, Cas9 with a label is guided to LTR region, and because Cas9 has the label for subsequent immunoprecipitation enrichment, all related proteins interacting with LTR can be enriched, namely the aim of screening virus LTR interacting protein is achieved.

The 'dCas 9' refers to inactivated Cas9, and Cas9 which retains the recognition and binding capacity with sgRNA but loses the capacity of cutting DNA.

The CNOT1 protein is a transcription factor, namely CCR4-NOT transcription complete subBunit 1(CNOT 1).

The invention is further described by the accompanying drawings and the following examples, which are intended to illustrate specific embodiments of the invention and are not to be construed as limiting the scope of the invention in any way.

Example 1 design of sgRNA targeting LTR

The invention designs 7 sgRNAs with different sequences, which respectively target different regions of HIV-1LTR (see figure 1), and the specific sequences are shown in the following table 1:

table 1 designed sgRNA sequences for LTR

Serial number	Sequence information
		SEQ ID NO.1	CCCCACAGGGTGTAACAAGC
SEQ ID NO.2	CCACGTGATGAAATGCTAGG
		SEQ ID NO.3	TGATATCGAGCTTGCTACAA
SEQ ID NO.4	CTGATATCGAGCTTGCTACA
		SEQ ID NO.5	TAACTCGAGAGACCCAGTAC
SEQ ID NO.6	GGGAGCTCTCTGGCTAACTA
		SEQ ID NO.7	TGCTTATATGCAGGATCTGA

Usually, several weeks of screening time is required to verify whether sgrnas can effectively knock out a gene, and finally, the effectiveness of the sgrnas is verified by finding a knock-out strain. The present invention differs from gene knock-out in that the aim is to identify sgRNA sequences that effectively target the LTR. Therefore, the invention establishes a rapid report system, different sgRNA sequences are respectively constructed to PX459 vector plasmid containing Cas9, and the plasmid and luciferase report plasmid containing 5' LTR of full-length HIV-1 as a promoter are co-transferred into 293T cells. HIV-1 transcription is activated upon addition of the Tat protein. Effective sgRNA will specifically target LTR region to destroy luciferase expression, and luciferase expression amount is reduced.

The results show that of 7 sgrnas targeting the sg-LTR region, SEQ ID nos. 5,6, and 7 had significant effect of down-regulating luciferase expression (see fig. 2), indicating that SEQ ID nos. 5,6, and 7 sgrnas could effectively target 3 different regions of LTR. Furthermore, in order to further increase the enrichment efficiency of LTR sequence and exclude the factors that the single sgRNA/dCas9 and host protein may occupy a certain region of LTR in space to cause low protein interaction binding efficiency, the invention creatively selects the sgRNA sequence combination, i.e. sg-LTR-5,6,7(SEQ ID NO.5,6,7sgRNA) to be mixed as the sgRNA pool for subsequent interaction with dCas9, and excludes other interference factors from the experimental design as much as possible.

Example 23 XFlag-dCas 9-His protein purification

Purifying dCas9 protein with His label at the N end and 3 Xflag label at the C end by using a Ni-NTA column, wherein the sequence information of the dCas9 protein is shown in SEQ ID NO. 8:

the plasmid was transformed into E.coli BL21,after picking monoclonal shake bacteria overnight, 1: 100 were inoculated into 200ml of LB medium without antibiotics and grown at 37 ℃ for about 3h to OD₆₀₀Standing at room temperature for 20min, taking out 1ml of the bacterial liquid as an uninduced control sample after the temperature is reduced, and adding 0.3mM IPTG to induce protein expression for 20h at 16 ℃ by a shaking table. Centrifuging at 5,000rpm for 25min to collect bacteria liquid, discarding supernatant, adding lysis buffer, and freeze thawing at-80 deg.C for 2 times to help lysis. The ultrasonication conditions were: power 40, on 15sec, off 60sec, lap time 2 min. Sonication was repeated 1 time. Centrifuge at 115,000rpm for 1h, leave pellet samples, and remove supernatant to bind to beads. 1ml of Ni-NTA beads were washed once with lysate, 20ml of the lysate supernatant was added and incubated at 4 ℃ for 1h with shaking. The Ni-NTA beads were collected by centrifugation at 2,000rpm for 1min, and the supernatant was collected and left as a supernatant sample. The beads were transferred to a bed and washed 5 times with Wash buffer using 10 column volumes each time. Elutionbuffer eluted 4 tubes, 500. mu.l each. The polyacrylamide gel was run and coomassie blue stained to observe the position and size of dCas9 (see fig. 3), and Flag tag expression of dCas9 was verified by Western-blot (see fig. 4).

Example 3 sgRNA in vitro Synthesis

The sgRNA5,6, and 7 was verified as effective sgRNA for subsequent experiments. After synthesis of DNA primers, the template was amplified by PCR using HiScribe^TMThe Quick T7 High Yield RNA Synthesis Kit (NEB # E2050) Kit was used for in vitro transcription. The figures show controls No. 1-4, and controls negative with RNAse addition (see FIGS. 5, 6). sgRNA5,6,7 transcribed in vitro were mixed and incubated as a pool of effective sgRNA with dCas 9.

Example 4 preparation of sgRNA/dCas9 Complex

The tagged dCas9 purified in example 2 and sgRNA synthesized in vitro in example 3 were quantified, respectively, at 1 XDcas 9 buffer (20mM Hepes pH7.9,100mM NaCl,5mM MgCl) in terms of dCas9: sgRNA molar number ═ 1:3₂) The solution was incubated in vitro at 37 ℃ for 30min to obtain sgRNA/dCas9 complex for use.

Example 5 immunoprecipitation preparation of host proteins that interact with LTR

Separately, HIV-1LTR plasmid was transfected into Hela cells toAnd empty vector (as a negative control group), each sample having 15cm-dish cells for a total of 10 dishes. 48 hours after transfection, 1% methanol-free formaldehyde (Pierce) was used^TM16% Formaldehyde (w/v), methane-free, cat # 28906) were fixed for 12 min. After 5min of reaction with 0.125M Glycine, the supernatant was discarded and the cells were washed twice with pre-cooled PBS. Cells were collected by adding 2ml of PBS containing protease inhibitor to each plate, and after collecting cells by centrifugation at 1600rpm, cells were resuspended in SDS lysate containing protease inhibitor and DTT to homogenize the cells.

Breaking the DNA by an ultrasonic instrument to obtain the DNA with the size of 500bp to 1000 bp; after centrifugation at 15000rpm, 2.5ml of the fragmented DNA were incubated with the sgRNAs/dCas9 complex formed as described above for 2 hours at 4 ℃. Adding Flag beads to incubate overnight at 4 ℃; and washing the beads with the DNA product by a Wash buffer, and eluting by an Elution buffer to obtain a protein product to be identified (a mass spectrometric identification sample is directly frozen in a refrigerator at-80 ℃ by eluting with 3 XFlag peptide).

Example 6 qPCR verification of binding of dCas9 in HIV-1LTR region

In order to further verify the effectiveness of the experimental process, namely whether dCas9 is effectively combined with HIV-1LTR, part of the sample to be identified is further taken in the experiment, RNA enzyme and protease treatment is carried out after 65 ℃ of overnight decrosslinking, and DNA is purified by using a PCR fragment recovery kit; the binding of dCas9 in the HIV-1LTR region was detected by q-PCR.

Different regions Nascent (+10 to +59) and Promoter (-168 to +80) of LTR are amplified by designing primers, and the validity of the experimental process is verified by detecting through ChIP-qPCR experiments (see figures 7-9) that sg-LTR can obviously guide 3 XFlag dCas9 to the LTR region relative to a negative control group without dCas9 and with sg-Gal 4.

Example 7 Mass Spectrometry

The protein product prepared in example 5 was subjected to mass spectrometry Preparation pretreatment using the FASP method (Filter Aided sample Preparation) consisting essentially of: 8M urea denatured protein, detergent removed; centrifuging at high speed for 30min for 3 times; carrying out reductive alkylation treatment on the sample by using DTT and iodoacetamide successively at normal temperature; DTT for 30min, and high-speed centrifugation for 30 min; iodoacetamide 30min, highCentrifuging for 30 min; normal temperature 100mM NH₄HCO3 displaces 8M urea, reducing the urea concentration; centrifuging at high speed for 30min for 3 times; carrying out overnight enzymolysis treatment on the protein by using pancreatin Trypsin at normal temperature; standing overnight at 37 ℃, and centrifuging at high speed for more than 16h to obtain a peptide fragment sample after enzymolysis; centrifuging at high speed for 30min for 2 times; desalting the peptide segment by using a C18 column by adopting a StageTip method at normal temperature; and sending to a mass spectrum platform Orbitrap Fusion Lumos instrument of Xiamen university for identification and analysis. The results show that a variety of host proteins capable of binding to LTR were screened (table 2), where mepec, CDK9, PAF1 and CCNT1 are proteins known in the art to bind to LTR, and also demonstrate the accuracy and effectiveness of this method.

Table 2 proteins binding to LTR selected

In addition, CNOT1 is a newly discovered host protein that can bind to LTR, and its amino acid sequence is shown in SEQ ID No.9, and there is no disclosure in the prior art that CNOT1 protein binds to LTR.

Example 8 ChIP-q-PCR validation of CNOT1 binding to LTR

NH1 cells were cultured in 115 cm plates (cells integrated with HIV-1 LTR-luciferase fragment) to assess that the target protein could indeed bind to the HIV-1LTR on the endogenous chromosome. Cells were fixed using 1% methanol-free formaldehyde for 12 min. After 5min of reaction with 0.125M Glycine, the supernatant was discarded and the cells were washed twice with pre-cooled PBS. Cells were collected by adding 2ml of PBS containing protease inhibitor to each plate, and after collecting cells by centrifugation at 1600rpm, cells were resuspended in SDS lysate containing protease inhibitor and DTT to homogenize the cells.

Breaking the DNA by an ultrasonic instrument to obtain the DNA with the size of 500bp to 1000 bp; after centrifugation at 15000rpm, the CNOT1 antibody was added and incubated overnight, and Protein A magnetic beads (Thermo Fisher) were added and incubated at 4 ℃ for 2 h; washing the beads with the DNA product by a Wash buffer, and then eluting by an Elution buffer; after cross-linking is removed at 65 ℃ overnight, RNA enzyme and protease treatment is carried out, and DNA is purified by a PCR fragment recovery kit; the binding of CNOT1 in the HIV-1LTR region was detected by q-PCR, and CNOT1 was clearly bound in the promoter region and 3 'UTR region of LTR (see FIG. 10) and CNOT1 was bound in 3' UTR of gene in accordance with the literature report, relative to the LTR Nascelent and GADPH regions.

Example 9 knockdown of CNOT1 protein inhibits HIV-1 Gene transcription

Two shRNA sequences targeting different regions of CNOT1 are designed for knocking down CNOT1 protein, the sequences are constructed on PLKO.1 plasmid, shscarmble (contrast), shCNOT1-1 and shCNOT1-2 are transiently transfected into Hela cells, the cells are collected after 48 hours, total RNA is extracted by using a kit, after reverse transcription into cDNA, CNOT1 gene is amplified by Realtime q-PCR to detect the effects of the two shRNA for knocking down CNOT1 (see figure 11).

In order to evaluate the effect of CNOT1 on the transcription of HIV-1 gene integrated endogenously on the host chromosome, the present invention used NH1 cell system to measure the effect of knocking-down CNOT1 on the transcription of HIV-1 gene. The HIV-1LTR promoter in the cell line is integrated in the host chromosome and is used as the promoter of the luciferase gene, so that the effect of knocking down the transcription of a specific protein on the HIV-1 gene can be detected by detecting the luciferase signal as a reporter system. Shscarmble (control), shCNOT1-1, shCNOT1-2 were transiently transfected into NH1 cells, and divided into two groups of cells with Tat (Tat protein activation is required for HIV-1 gene transcription) and without Tat (used for evaluating background gene transcription level of cells). The results show that knocking down CNOT1 did not affect the cellular background gene transcription level, but could specifically inhibit HIV-1 gene transcription (see fig. 12). The above data show that CNOT1 is a host protein for specifically regulating HIV-1 gene transcription, and the protein can be used as an effective drug target for prevention, diagnosis and treatment of HIV related diseases.

The above description of the specific embodiments of the present application is not intended to limit the present application, and those skilled in the art may make various changes and modifications according to the present application without departing from the spirit of the present application, which is intended to fall within the scope of the appended claims.

SEQUENCE LISTING

<110> Beijing Children hospital affiliated to capital medical university

<120> Cas 9-sgRNA-based viral LTR immunoprecipitation screening for regulatory viral transcription targets

<130>2020

<160>9

<170>PatentIn version 3.5

<210>1

<211>20

<212>DNA

<213> Artificial sequence

<400>1

ccccacaggg tgtaacaagc 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence

<400>2

ccacgtgatg aaatgctagg 20

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

tgatatcgag cttgctacaa 20

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

ctgatatcga gcttgctaca 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<400>5

taactcgaga gacccagtac 20

<210>6

<211>20

<212>DNA

<213> Artificial sequence

<400>6

gggagctctc tggctaacta 20

<210>7

<211>20

<212>DNA

<213> Artificial sequence

<400>7

tgcttatatg caggatctga 20

<210>8

<211>1366

<212>PRT

<213>Streptococcus pyogenes

<400>8

Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val Gly

1 5 10 15

Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys

20 25 30

Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly

35 40 45

Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys

50 55 60

Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr

65 70 75 80

Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe

85 90 95

His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu

100 105 110

Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu

115 120 125

Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser Thr

130 135 140

Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile

145 150 155 160

Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn

165 170 175

Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln

180 185 190

Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala

195 200 205

Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile

210 215 220

Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile

225 230 235 240

Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu

245 250 255

Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp

260 265 270

Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe

275 280 285

Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu

290 295 300

Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile

305 310 315 320

Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu

325 330 335

Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln

340 345 350

Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu

355 360 365

Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr

370 375 380

Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln

385 390 395 400

Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu

405 410 415

Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys

420 425 430

Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr

435 440 445

Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr

450 455 460

Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val

465 470 475 480

Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe

485 490 495

Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu

500 505 510

Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val

515 520 525

Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys

530 535 540

Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys

545 550 555 560

Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val

565 570 575

Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr

580 585 590

His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu

595 600 605

Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe

610 615 620

Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu

625 630 635 640

Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly

645 650 655

Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln

660 665 670

Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn

675 680 685

Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu

690 695 700

Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu

705 710 715 720

His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu

725 730 735

Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His

740 745 750

Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr

755 760 765

Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu

770 775 780

Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val Glu

785 790 795 800

Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn

805 810 815

Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser

820 825 830

Asp Tyr Asp Val Asp Ala Ile Val Pro Gln Ser Phe Leu Lys Asp Asp

835 840 845

Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys

850 855 860

Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr

865 870 875 880

Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp

885 890 895

Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys Ala

900 905 910

Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys His

915 920 925

Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn

930 935 940

Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu

945 950 955 960

Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile

965 970 975

Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly

980 985 990

Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr

995 1000 1005

Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser

1010 1015 1020

Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser

1025 1030 1035

Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly

1040 1045 1050

Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly

1055 1060 1065

Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys

1070 1075 1080

Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val

1085 1090 1095

Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn

1100 1105 1110

Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys

1115 1120 1125

Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val

11301135 1140

Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val

1145 1150 1155

Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu

1160 1165 1170

Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val

1175 1180 1185

Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu

1190 1195 1200

Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu

1205 1210 1215

Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe

1220 1225 1230

Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu

1235 1240 1245

Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr

1250 1255 1260

Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val

1265 1270 1275

Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn

1280 1285 1290

Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile

1295 1300 1305

His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys

1310 1315 1320

Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys

1325 1330 1335

Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu

1340 1345 1350

Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp

1355 1360 1365

<210>9

<211>2371

<212>PRT

<213>Homo sapiens

<400>9

Met Asn Leu Asp Ser Leu Ser Leu Ala Leu Ser Gln Ile Ser Tyr Leu

1 5 10 15

Val Asp Asn Leu Thr Lys Lys Asn Tyr Arg Ala Ser Gln Gln Glu Ile

20 25 30

Gln His Ile Val Asn Arg His Gly Pro Glu Ala Asp Arg His Leu Leu

35 40 45

Arg Cys Leu Phe Ser His Val Asp Phe Ser Gly Asp Gly Lys Ser Ser

50 55 60

Gly Lys Asp Phe His Gln Thr Gln Phe Leu Ile Gln Glu Cys Ala Leu

65 70 75 80

Leu Ile Thr Lys Pro Asn Phe Ile Ser Thr Leu Ser Tyr Ala Ile Asp

85 90 95

Asn Pro Leu His Tyr Gln Lys Ser Leu Lys Pro Ala Pro His Leu Phe

100 105 110

Ala Gln Leu Ser Lys Val Leu Lys Leu Ser Lys Val Gln Glu Val Ile

115 120 125

Phe Gly Leu Ala Leu Leu Asn Ser Ser Ser Ser Asp Leu Arg Gly Phe

130 135 140

Ala Ala Gln Phe Ile Lys Gln Lys Leu Pro Asp Leu Leu Arg Ser Tyr

145 150 155 160

Ile Asp Ala Asp Val Ser Gly Asn Gln Glu Gly Gly Phe Gln Asp Ile

165 170 175

Ala Ile Glu Val Leu His Leu Leu Leu Ser His Leu Leu Phe Gly Gln

180 185 190

Lys Gly Ala Phe Gly Val Gly Gln Glu Gln Ile Asp Ala Phe Leu Lys

195 200 205

Thr Leu Arg Arg Asp Phe Pro Gln Glu Arg Cys Pro Val Val Leu Ala

210 215 220

Pro Leu Leu Tyr Pro Glu Lys Arg Asp Ile LeuMet Asp Arg Ile Leu

225 230 235 240

Pro Asp Ser Gly Gly Val Ala Lys Thr Met Met Glu Ser Ser Leu Ala

245 250 255

Asp Phe Met Gln Glu Val Gly Tyr Gly Phe Cys Ala Ser Ile Glu Glu

260 265 270

Cys Arg Asn Ile Ile Val Gln Phe Gly Val Arg Glu Val Thr Ala Ala

275 280 285

Gln Val Ala Arg Val Leu Gly Met Met Ala Arg Thr His Ser Gly Leu

290 295 300

Thr Asp Gly Ile Pro Leu Gln Ser Ile Ser Ala Pro Gly Ser Gly Ile

305 310 315 320

Trp Ser Asp Gly Lys Asp Lys Ser Asp Gly Ala Gln Ala His Thr Trp

325 330 335

Asn Val Glu Val Leu Ile Asp Val Leu Lys Glu Leu Asn Pro Ser Leu

340 345 350

Asn Phe Lys Glu Val Thr Tyr Glu Leu Asp His Pro Gly Phe Gln Ile

355 360 365

Arg Asp Ser Lys Gly Leu His Asn Val Val Tyr Gly Ile Gln Arg Gly

370 375 380

Leu Gly Met Glu Val Phe Pro Val Asp Leu Ile Tyr ArgPro Trp Lys

385 390 395 400

His Ala Glu Gly Gln Leu Ser Phe Ile Gln His Ser Leu Ile Asn Pro

405 410 415

Glu Ile Phe Cys Phe Ala Asp Tyr Pro Cys His Thr Val Ala Thr Asp

420 425 430

Ile Leu Lys Ala Pro Pro Glu Asp Asp Asn Arg Glu Ile Ala Thr Trp

435 440 445

Lys Ser Leu Asp Leu Ile Glu Ser Leu Leu Arg Leu Ala Glu Val Gly

450 455 460

Gln Tyr Glu Gln Val Lys Gln Leu Phe Ser Phe Pro Ile Lys His Cys

465 470 475 480

Pro Asp Met Leu Val Leu Ala Leu Leu Gln Ile Asn Thr Ser Trp His

485 490 495

Thr Leu Arg His Glu Leu Ile Ser Thr Leu Met Pro Ile Phe Leu Gly

500 505 510

Asn His Pro Asn Ser Ala Ile Ile Leu His Tyr Ala Trp His Gly Gln

515 520 525

Gly Gln Ser Pro Ser Ile Arg Gln Leu Ile Met His Ala Met Ala Glu

530 535 540

Trp Tyr Met Arg Gly Glu Gln Tyr Asp Gln Ala Lys Leu Ser ArgIle

545 550 555 560

Leu Asp Val Ala Gln Asp Leu Lys Ala Leu Ser Met Leu Leu Asn Gly

565 570 575

Thr Pro Phe Ala Phe Val Ile Asp Leu Ala Ala Leu Ala Ser Arg Arg

580 585 590

Glu Tyr Leu Lys Leu Asp Lys Trp Leu Thr Asp Lys Ile Arg Glu His

595 600 605

Gly Glu Pro Phe Ile Gln Ala Cys Met Thr Phe Leu Lys Arg Arg Cys

610 615 620

Pro Ser Ile Leu Gly Gly Leu Ala Pro Glu Lys Asp Gln Pro Lys Ser

625 630 635 640

Ala Gln Leu Pro Pro Glu Thr Leu Ala Thr Met Leu Ala Cys Leu Gln

645 650 655

Ala Cys Ala Gly Ser Val Ser Gln Glu Leu Ser Glu Thr Ile Leu Thr

660 665 670

Met Val Ala Asn Cys Ser Asn Val Met Asn Lys Ala Arg Gln Pro Pro

675 680 685

Pro Gly Val Met Pro Lys Gly Arg Pro Pro Ser Ala Ser Ser Leu Asp

690 695 700

Ala Ile Ser Pro Val Gln Ile Asp Pro Leu Ala Gly Met Thr Ser Leu

705 710 715 720

Ser Ile Gly Gly Ser Ala Ala Pro His Thr Gln Ser Met Gln Gly Phe

725 730 735

Pro Pro Asn Leu Gly Ser Ala Phe Ser Thr Pro Gln Ser Pro Ala Lys

740 745 750

Ala Phe Pro Pro Leu Ser Thr Pro Asn Gln Thr Thr Ala Phe Ser Gly

755 760 765

Ile Gly Gly Leu Ser Ser Gln Leu Pro Val Gly Gly Leu Gly Thr Gly

770 775 780

Ser Leu Thr Gly Ile Gly Thr Gly Ala Leu Gly Leu Pro Ala Val Asn

785 790 795 800

Asn Asp Pro Phe Val Gln Arg Lys Leu Gly Thr Ser Gly Leu Asn Gln

805 810 815

Pro Thr Phe Gln Gln Thr Asp Leu Ser Gln Val Trp Pro Glu Ala Asn

820 825 830

Gln His Phe Ser Lys Glu Ile Asp Asp Glu Ala Asn Ser Tyr Phe Gln

835 840 845

Arg Ile Tyr Asn His Pro Pro His Pro Thr Met Ser Val Asp Glu Val

850 855 860

Leu Glu Met Leu Gln Arg Phe Lys Asp Ser Thr Ile Lys Arg Glu Arg

865 870 875 880

Glu Val Phe Asn Cys Met Leu Arg Asn Leu Phe Glu Glu Tyr Arg Phe

885 890 895

Phe Pro Gln Tyr Pro Asp Lys Glu Leu His Ile Thr Ala Cys Leu Phe

900 905 910

Gly Gly Ile Ile Glu Lys Gly Leu Val Thr Tyr Met Ala Leu Gly Leu

915 920 925

Ala Leu Arg Tyr Val Leu Glu Ala Leu Arg Lys Pro Phe Gly Ser Lys

930 935 940

Met Tyr Tyr Phe Gly Ile Ala Ala Leu Asp Arg Phe Lys Asn Arg Leu

945 950 955 960

Lys Asp Tyr Pro Gln Tyr Cys Gln His Leu Ala Ser Ile Ser His Phe

965 970 975

Met Gln Phe Pro His His Leu Gln Glu Tyr Ile Glu Tyr Gly Gln Gln

980 985 990

Ser Arg Asp Pro Pro Val Lys Met Gln Gly Ser Ile Thr Thr Pro Gly

995 1000 1005

Ser Ile Ala Leu Ala Gln Ala Gln Ala Gln Ala Gln Val Pro Ala

1010 1015 1020

Lys Ala Pro Leu Ala Gly Gln Val Ser Thr Met Val Thr Thr Ser

1025 1030 1035

Thr Thr Thr Thr Val Ala Lys Thr Val Thr Val Thr Arg Pro Thr

1040 1045 1050

Gly Val Ser Phe Lys Lys Asp Val Pro Pro Ser Ile Asn Thr Thr

1055 1060 1065

Asn Ile Asp Thr Leu Leu Val Ala Thr Asp Gln Thr Glu Arg Ile

1070 1075 1080

Val Glu Pro Pro Glu Asn Ile Gln Glu Lys Ile Ala Phe Ile Phe

1085 1090 1095

Asn Asn Leu Ser Gln Ser Asn Met Thr Gln Lys Val Glu Glu Leu

1100 1105 1110

Lys Glu Thr Val Lys Glu Glu Phe Met Pro Trp Val Ser Gln Tyr

1115 1120 1125

Leu Val Met Lys Arg Val Ser Ile Glu Pro Asn Phe His Ser Leu

1130 1135 1140

Tyr Ser Asn Phe Leu Asp Thr Leu Lys Asn Pro Glu Phe Asn Lys

1145 1150 1155

Met Val Leu Asn Glu Thr Tyr Arg Asn Ile Lys Val Leu Leu Thr

1160 1165 1170

Ser Asp Lys Ala Ala Ala Asn Phe Ser Asp Arg Ser Leu Leu Lys

1175 1180 1185

Asn Leu Gly His Trp Leu Gly Met Ile Thr Leu Ala Lys Asn Lys

1190 1195 1200

Pro Ile Leu His Thr Asp Leu Asp Val Lys Ser Leu Leu Leu Glu

1205 1210 1215

Ala Tyr Val Lys Gly Gln Gln Glu Leu Leu Tyr Val Val Pro Phe

1220 1225 1230

Val Ala Lys Val Leu Glu Ser Ser Ile Arg Ser Val Val Phe Arg

1235 1240 1245

Pro Pro Asn Pro Trp Thr Met Ala Ile Met Asn Val Leu Ala Glu

1250 1255 1260

Leu His Gln Glu His Asp Leu Lys Leu Asn Leu Lys Phe Glu Ile

1265 1270 1275

Glu Val Leu Cys Lys Asn Leu Ala Leu Asp Ile Asn Glu Leu Lys

1280 1285 1290

Pro Gly Asn Leu Leu Lys Asp Lys Asp Arg Leu Lys Asn Leu Asp

1295 1300 1305

Glu Gln Leu Ser Ala Pro Lys Lys Asp Val Lys Gln Pro Glu Glu

1310 1315 1320

Leu Pro Pro Ile Thr Thr Thr Thr Thr Ser Thr Thr Pro Ala Thr

1325 1330 1335

Asn Thr Thr Cys Thr Ala Thr Val Pro Pro Gln Pro Gln Tyr Ser

1340 1345 1350

Tyr His Asp Ile Asn Val Tyr Ser Leu Ala Gly Leu Ala Pro His

1355 1360 1365

Ile Thr Leu Asn Pro Thr Ile Pro Leu Phe Gln Ala His Pro Gln

1370 1375 1380

Leu Lys Gln Cys Val Arg Gln Ala Ile Glu Arg Ala Val Gln Glu

1385 1390 1395

Leu Val His Pro Val Val Asp Arg Ser Ile Lys Ile Ala Met Thr

1400 1405 1410

Thr Cys Glu Gln Ile Val Arg Lys Asp Phe Ala Leu Asp Ser Glu

1415 1420 1425

Glu Ser Arg Met Arg Ile Ala Ala His His Met Met Arg Asn Leu

1430 1435 1440

Thr Ala Gly Met Ala Met Ile Thr Cys Arg Glu Pro Leu Leu Met

1445 1450 1455

Ser Ile Ser Thr Asn Leu Lys Asn Ser Phe Ala Ser Ala Leu Arg

1460 1465 1470

Thr Ala Ser Pro Gln Gln Arg Glu Met Met Asp Gln Ala Ala Ala

1475 1480 1485

Gln Leu Ala Gln Asp Asn Cys Glu Leu Ala Cys Cys Phe Ile Gln

1490 1495 1500

Lys Thr Ala Val Glu Lys Ala Gly Pro Glu Met Asp LysArg Leu

1505 1510 1515

Ala Thr Glu Phe Glu Leu Arg Lys His Ala Arg Gln Glu Gly Arg

1520 1525 1530

Arg Tyr Cys Asp Pro Val Val Leu Thr Tyr Gln Ala Glu Arg Met

1535 1540 1545

Pro Glu Gln Ile Arg Leu Lys Val Gly Gly Val Asp Pro Lys Gln

1550 1555 1560

Leu Ala Val Tyr Glu Glu Phe Ala Arg Asn Val Pro Gly Phe Leu

1565 1570 1575

Pro Thr Asn Asp Leu Ser Gln Pro Thr Gly Phe Leu Ala Gln Pro

1580 1585 1590

Met Lys Gln Ala Trp Ala Thr Asp Asp Val Ala Gln Ile Tyr Asp

1595 1600 1605

Lys Cys Ile Thr Glu Leu Glu Gln His Leu His Ala Ile Pro Pro

1610 1615 1620

Thr Leu Ala Met Asn Pro Gln Ala Gln Ala Leu Arg Ser Leu Leu

1625 1630 1635

Glu Val Val Val Leu Ser Arg Asn Ser Arg Asp Ala Ile Ala Ala

1640 1645 1650

Leu Gly Leu Leu Gln Lys Ala Val Glu Gly Leu Leu Asp Ala Thr

1655 1660 1665

Ser Gly Ala Asp Ala Asp Leu Leu Leu Arg Tyr Arg Glu Cys His

1670 1675 1680

Leu Leu Val Leu Lys Ala Leu Gln Asp Gly Arg Ala Tyr Gly Ser

1685 1690 1695

Pro Trp Cys Asn Lys Gln Ile Thr Arg Cys Leu Ile Glu Cys Arg

1700 1705 1710

Asp Glu Tyr Lys Tyr Asn Val Glu Ala Val Glu Leu Leu Ile Arg

1715 1720 1725

Asn His Leu Val Asn Met Gln Gln Tyr Asp Leu His Leu Ala Gln

1730 1735 1740

Ser Met Glu Asn Gly Leu Asn Tyr Met Ala Val Ala Phe Ala Met

1745 1750 1755

Gln Leu Val Lys Ile Leu Leu Val Asp Glu Arg Ser Val Ala His

1760 1765 1770

Val Thr Glu Ala Asp Leu Phe His Thr Ile Glu Thr Leu Met Arg

1775 1780 1785

Ile Asn Ala His Ser Arg Gly Asn Ala Pro Glu Gly Leu Pro Gln

1790 1795 1800

Leu Met Glu Val Val Arg Ser Asn Tyr Glu Ala Met Ile Asp Arg

1805 1810 1815

Ala His Gly Gly Pro Asn Phe Met Met His Ser Gly Ile Ser Gln

1820 1825 1830

Ala Ser Glu Tyr Asp Asp Pro Pro Gly Leu Arg Glu Lys Ala Glu

1835 1840 1845

Tyr Leu Leu Arg Glu Trp Val Asn Leu Tyr His Ser Ala Ala Ala

1850 1855 1860

Gly Arg Asp Ser Thr Lys Ala Phe Ser Ala Phe Val Gly Gln Met

1865 1870 1875

His Gln Gln Gly Ile Leu Lys Thr Asp Asp Leu Ile Thr Arg Phe

1880 1885 1890

Phe Arg Leu Cys Thr Glu Met Cys Val Glu Ile Ser Tyr Arg Ala

1895 1900 1905

Gln Ala Glu Gln Gln His Asn Pro Ala Ala Asn Pro Thr Met Ile

1910 1915 1920

Arg Ala Lys Cys Tyr His Asn Leu Asp Ala Phe Val Arg Leu Ile

1925 1930 1935

Ala Leu Leu Val Lys His Ser Gly Glu Ala Thr Asn Thr Val Thr

1940 1945 1950

Lys Ile Asn Leu Leu Asn Lys Val Leu Gly Ile Val Val Gly Val

1955 1960 1965

Leu Leu Gln Asp His Asp Val Arg Gln Ser Glu Phe Gln Gln Leu

1970 1975 1980

Pro Tyr His ArgIle Phe Ile Met Leu Leu Leu Glu Leu Asn Ala

1985 1990 1995

Pro Glu His Val Leu Glu Thr Ile Asn Phe Gln Thr Leu Thr Ala

2000 2005 2010

Phe Cys Asn Thr Phe His Ile Leu Arg Pro Thr Lys Ala Pro Gly

2015 2020 2025

Phe Val Tyr Ala Trp Leu Glu Leu Ile Ser His Arg Ile Phe Ile

2030 2035 2040

Ala Arg Met Leu Ala His Thr Pro Gln Gln Lys Gly Trp Pro Met

2045 2050 2055

Tyr Ala Gln Leu Leu Ile Asp Leu Phe Lys Tyr Leu Ala Pro Phe

2060 2065 2070

Leu Arg Asn Val Glu Leu Thr Lys Pro Met Gln Ile Leu Tyr Lys

2075 2080 2085

Gly Thr Leu Arg Val Leu Leu Val Leu Leu His Asp Phe Pro Glu

2090 2095 2100

Phe Leu Cys Asp Tyr His Tyr Gly Phe Cys Asp Val Ile Pro Pro

2105 2110 2115

Asn Cys Ile Gln Leu Arg Asn Leu Ile Leu Ser Ala Phe Pro Arg

2120 2125 2130

Asn Met Arg Leu Pro Asp Pro Phe Thr Pro Asn Leu Lys Val Asp

2135 21402145

Met Leu Ser Glu Ile Asn Ile Ala Pro Arg Ile Leu Thr Asn Phe

2150 2155 2160

Thr Gly Val Met Pro Pro Gln Phe Lys Lys Asp Leu Asp Ser Tyr

2165 2170 2175

Leu Lys Thr Arg Ser Pro Val Thr Phe Leu Ser Asp Leu Arg Ser

2180 2185 2190

Asn Leu Gln Val Ser Asn Glu Pro Gly Asn Arg Tyr Asn Leu Gln

2195 2200 2205

Leu Ile Asn Ala Leu Val Leu Tyr Val Gly Thr Gln Ala Ile Ala

2210 2215 2220

His Ile His Asn Lys Gly Ser Thr Pro Ser Met Ser Thr Ile Thr

2225 2230 2235

His Ser Ala His Met Asp Ile Phe Gln Asn Leu Ala Val Asp Leu

2240 2245 2250

Asp Thr Glu Gly Arg Tyr Leu Phe Leu Asn Ala Ile Ala Asn Gln

2255 2260 2265

Leu Arg Tyr Pro Asn Ser His Thr His Tyr Phe Ser Cys Thr Met

2270 2275 2280

Leu Tyr Leu Phe Ala Glu Ala Asn Thr Glu Ala Ile Gln Glu Gln

2285 2290 2295

Ile Thr Arg Val Leu Leu Glu Arg Leu Ile Val Asn Arg Pro His

2300 2305 2310

Pro Trp Gly Leu Leu Ile Thr Phe Ile Glu Leu Ile Lys Asn Pro

2315 2320 2325

Ala Phe Lys Phe Trp Asn His Glu Phe Val His Cys Ala Pro Glu

2330 2335 2340

Ile Glu Lys Leu Phe Gln Ser Val Ala Gln Cys Cys Met Gly Gln

2345 2350 2355

Lys Gln Ala Gln Gln Val Met Glu Gly Thr Gly Ala Ser

2360 2365 2370

Claims

1. A method of screening for proteins that interact with a viral LTR, or screening for targets that modulate viral transcription, comprising the steps of: 1) preparing a complex Cas9-sgRNA against the viral LTR region; 2) incubating the complex Cas9-sgRNA with a cell lysate containing the viral LTR; 3) cas9 immunoprecipitates enriched for proteins that interact with LTRs.

2. The method for screening for proteins interacting with a viral LTR, or for screening for targets that regulate viral transcription of claim 1, wherein the step 1) of preparing a complex Cas9-sgRNA against a viral LTR region further comprises: a. designing and preparing sgRNA specifically targeting LTR, b. preparing Cas9 in vitro, c. preparing complex Cas 9-sgRNA.

3. The method for screening interacting protein with viral LTR or screening and regulating viral transcription target of claim 2, wherein the a further comprises a rapid identification step of effectively targeting LTR sgRNA, different sgRNA sequences are respectively constructed to PX459 vector plasmid containing Cas9, the plasmid and luciferase report plasmid containing LTR as promoter are co-transferred into cells, and effective sgRNA is screened based on luciferase expression quantity; the Cas9 prepared in b is a tagged Cas 9; and c, after the labeled Cas9 and the sgRNA are respectively quantified, incubation is carried out according to the Cas9: sgRNA molar number which is 1: 3.

4. The method for screening for proteins interacting with viral LTR or screening for targets regulating viral transcription according to any one of claims 1 to 3, wherein the cell lysate containing viral LTR in step 2) is prepared as follows: transfecting LTR plasmids in cells, centrifuging after fixing, collecting the cells, adding SDS lysate containing protease inhibitor and DTT to resuspend the cells, and performing DNA fragmentation treatment on the resuspended cells; the protein interacted with LTR is enriched by immunoprecipitation in the step 3), and Flag-beads are adopted for incubation; eluting the beads with the DNA product to obtain a protein product.

5. The method for screening interacting protein with viral LTR of claim 4, wherein the DNA fragmentation in step 2) obtains DNA fragment between 500bp and 1000 bp.

6. The method for screening for proteins interacting with viral LTRs, or for screening for targets that modulate viral transcription as claimed in any one of claims 1 to 5, further comprising step 4): identifying proteins that interact with the LTRs; the identification method is immunoblotting, mass spectrometry or sequencing analysis.

7. The method of screening for proteins interacting with viral LTR or screening for targets that regulate transcription of a virus of any one of claims 1-6, wherein said virus is an HIV virus.

8. The method for screening for a protein that interacts with a viral LTR or screening for a target that modulates transcription of a virus of any one of claims 1-7, wherein the Cas9 protein is an inactivated Cas9 protein.

9. The method for screening for interacting protein with viral LTR or screening for target of regulating viral transcription according to any one of claims 2-8, wherein the sgRNA is any one or combination of the sgRNA shown in SEQ ID No.5,6, 7.

10. Use of Cas 9-sgRNA-based immunoprecipitation of viral LTRs for screening for proteins that interact with viral LTRs, or for screening for targets that regulate viral transcription, comprising the steps of: 1) preparing a complex Cas9-sgRNA against the viral LTR region; 2) incubating the complex Cas9-sgRNA with a cell lysate containing the viral LTR; 3) cas9 immunoprecipitates enriched for proteins that interact with LTRs.

11. A system for screening for proteins interacting with a viral LTR, the system comprising a Cas9 protein, a sgRNA and a viral LTR and corresponding immunoprecipitation components, the system implementing the steps of: 1) preparing a complex Cas9-sgRNA against the viral LTR region; 2) incubating the complex Cas9-sgRNA with a cell lysate containing the viral LTR; 3) immunoprecipitation enriches proteins that interact with LTRs.

12. The system for screening for viral LTR interacting proteins of claim 11, wherein the system is a kit.